text
stringlengths 24
612k
|
|---|
1. Technical Field
The present disclosure relates to a lithium ion secondary battery.
2. Related Art
To prevent the short-circuiting between a positive electrode and a negative electrode of a lithium ion secondary battery, a technique of providing a tape with an insulating property (hereinafter referred to as “insulating tape”) at a part of the positive electrode and/or the negative electrode has been known. For example, JP-A-2006-147392 discloses a lithium ion secondary battery configured such that an insulating tape covers a part of a main plane of a positive electrode current collector included in a positive electrode and a part of a surface of an end of a positive electrode mixture layer included in the positive electrode. |
# frozen_string_literal: true
require 'spec_helper'
RSpec.describe PersonalAccessTokens::CreateService do
describe '#execute' do
context 'with valid params' do
it 'creates personal access token record' do
user = create(:user)
params = { name: 'Test token', impersonation: true, scopes: [:api], expires_at: Date.today + 1.month }
response = described_class.new(user, params).execute
personal_access_token = response.payload[:personal_access_token]
expect(response.success?).to be true
expect(personal_access_token.name).to eq(params[:name])
expect(personal_access_token.impersonation).to eq(params[:impersonation])
expect(personal_access_token.scopes).to eq(params[:scopes])
expect(personal_access_token.expires_at).to eq(params[:expires_at])
expect(personal_access_token.user).to eq(user)
end
end
end
end
|
#include "ace/OS_NS_stdio.h"
#include "ace/Get_Opt.h"
#include "TestC.h"
const ACE_TCHAR *ior_server = 0;
int
parse_args (int argc, ACE_TCHAR *argv[])
{
ACE_Get_Opt get_opts (argc, argv, ACE_TEXT ("k:"));
int c;
while ((c = get_opts ()) != -1)
switch (c)
{
case 'k':
ior_server = get_opts.opt_arg ();
break;
case '?':
default:
ACE_ERROR_RETURN ((LM_ERROR,
"usage: %s "
"-k file://<iorfile>"
"\n",
argv [0]),
-1);
}
// Indicates successful parsing of the command line
return 0;
}
int
ACE_TMAIN (int argc, ACE_TCHAR *argv[])
{
try
{
CORBA::ORB_var orb = CORBA::ORB_init (argc, argv);
if (parse_args (argc, argv) != 0)
ACE_ERROR_RETURN ((LM_ERROR, "Wrong arguments\n"), -1);
CORBA::Object_var tmp = orb->string_to_object (ior_server);
Test::Server_var server =
Test::Server::_unchecked_narrow (tmp.in ());
if (CORBA::is_nil (server.in ()))
ACE_ERROR_RETURN ((LM_ERROR, "Nil reference\n"), -1);
server->shutdown ();
orb->destroy ();
}
catch (const ::CORBA::Exception &ex)
{
ex._tao_print_exception ("Exception in client.cpp:\n");
return -1;
}
return 0;
}
|
Q:
Program stucks in infinite loop although there is a condition to terminate it: MATLAB
I'm building a program that fills a hollow cube with many small cubes. Then, makes a connected path through random cubes. The path is found step by step by looking at the direct neighbors of each cube and select anyone of them as the next step. To illustrate, The following picture shows the path that consists of cubes (red cubes),
To build the path I started form some cube, colored it with red, found its neighbor cubes (6 neighbors because we have 6 faces), selected any of them randomly, colored the selected one with red, then find its neighbors by repeating the same process. This method is good, but if a neighbor cube is already red (already belongs to the path) it won't recognize that and it can select it again. To solve this I did the following,
1- I made an array called visited, and I stored the index of any visited cube in it.
2- I stored the neighbors of the current cube in another array called a and compared it with the visited one, and I deleted any common elements, then took a random number from the elements remaining in a.
3- Sometimes all of the neighbors can be visited, so a will become empty. In this case, I looked for any of the current cube's, selected any of them randomly, checked for its neighbors, stored them in the neighbors array (a) and compared that with the visited cubes array. This will keep repeating (while loop) if the neighbors array is not empty. But in my case, the program gets stuck in the while loop. Also, sometime it doesn't get stuck, but the number of cubes in the path becomes less than the specified one.
I have obtained the code that builds the main cube, fills it with small cubes, and gets the neighbors by Hoki in a previous question (Filing the entire volume of a cube with small cubes in MATLAB) I just added the mechanism that builds the path using the neighbors. Here is the code,
%%
clf; figure(1); format compact
h(1) = axes('Position',[0.2 0.2 0.6 0.6]);
%These are the different 8 vertices of the cube, each is defined by its 3 x y z coordinates:
vert = [ 1 1 -1; -1 1 -1; -1 1 1; 1 1 1; -1 -1 1; 1 -1 1; 1 -1 -1; -1 -1 -1];
%These are the 6 faces of the cube, each is defined by connecting 4 of the available vertices:
fac = [1 2 3 4; 4 3 5 6; 6 7 8 5; 1 2 8 7; 6 7 1 4; 2 3 5 8];
%// How many small cube do we want
MainCubeSide = 2 ; %// dimension of the side of the main cube
nCubeOnSide = 5 ; %// number of small cube in one "row/column" of the main cube
nCubesTotal = nCubeOnSide^3 ; %// total number of small cube
% define the Main container cube
MainCube.Vertices = vert *(2/MainCubeSide) ; %// because the cube as defined above has already a side=2
disp (2/ MainCubeSide);
MainCube.Faces = fac ;
MainCube.FaceColor = 'w' ;
hMainCube = patch(MainCube); %// patch function for the first big cube. MainCube can be seen as an object that contains all the infor that the patch function needs.
axis([-1, 1, -1, 1, -1, 1]);
axis equal;
hold on; %wait we didn't finish yet.
material metal;
alpha('color');
alphamap('rampdown');
view(138,24)
%view(3);
%% // generate all the coordinates of each cube first
dstep = MainCubeSide / nCubeOnSide ; %// step size for small cube vertices, this will determine the edge length for the small cube that best fits the required small cubes per edge.
vElem = bsxfun(@plus, vert / nCubeOnSide , -( MainCubeSide/2 - dstep/2)*[1 1 1] ) ; %// elementary cube vertices. Because the small cube was defined in the center of the big cube, to push it to one side we only need to move it by half the size of the main cube (minus half the size of a small cube)
%%
hold on;
coords = zeros( size(vElem,1),size(vElem,2), nCubesTotal ) ; %// To store the coordinates (8 rows * 3 columns) in every of the nCubesTotal slices.
colors = zeros( nCubesTotal , 3 ) ; %// To store the RBG colours for every small cube.
hcube = zeros( nCubesTotal , 1 ) ; %// To store the handles of the patch objects
iNeighbour = zeros( nCubesTotal , 6 ) ; %// To save the index of the neighbours
idc = permute( reshape(1:nCubesTotal,nCubeOnSide,nCubeOnSide,nCubeOnSide) , [3 2 1] ) ;
%// For each cube ...
iCube = 0 ;
for iline=1:nCubeOnSide %// Lines
for icol=1:nCubeOnSide %// Columns
for ih=1:nCubeOnSide %// Slice (height)* all for loops have the smame length, because the total number of cubes = mCubeOnSide^3
iCube = iCube + 1 ;
%// Take the base corner coordinates and add an offset to each coordinate
coords(:,:,iCube) = bsxfun(@plus, vElem , dstep*[(iline-1) (icol-1) (ih-1)]); %the fist one will not have offset, iline-1=0.
%// Save the colour
colors(iCube,:) = rand(1,3) ;
%// Draw the cube and store its info in the cube handler hcube.
hcube(iCube) = patch('Faces', fac, 'Vertices', coords(:,:,iCube), 'FaceColor', colors(iCube,:) ) ; %Remember each slice of coords contains the vertices of one of the small cubes, that's why it corresponds to vertices here.
drawnow %// just for intermediate display, you can comment these 2 lines
pause(0.05) %// just for intermediate display, you can comment these 2 lines
%// save adjacent cubes indices
ixAdj = [iline-1 iline+1 icol-1 icol+1 ih-1 ih+1] ; %// indices of adjacent cubes
idxFalse = (ixAdj<1) | (ixAdj>nCubeOnSide) ; %// detect cube which would be "out" of the main cube
ixAdj(idxFalse) = 1 ; %// just to not get an "indexing" error at this stage
iNeighbour(iCube,:) = [idc(ixAdj(1),icol,ih) idc(ixAdj(2),icol,ih) ...
idc(iline,ixAdj(3),ih) idc(iline,ixAdj(4),ih) ...
idc(iline,icol,ixAdj(5)) idc(iline,icol,ixAdj(6)) ] ;
iNeighbour(iCube,idxFalse) = NaN ;
end
end
end
getNeighbourIndex = @(idx) iNeighbour(idx,~isnan(iNeighbour(idx,:))) ;
set(hcube,'Visible','off') %// turn off all small cubes
cubeOfInterest = 32 ; %// select one cube
%// display the main cube of interest, and it's neighbours in transparency
set(hcube(cubeOfInterest),'Visible','on','FaceColor','r','FaceAlpha',1)
%set(hcube(getNeighbourIndex(CubeOfInterest)),'Visible','on','FaceColor','g','FaceAlpha',.05)
visited= []; %to hold the indices of the visited cubes.
for i=1:124
visited (i) = cubeOfInterest; %the first visited cube is the cube of interest.
a= (getNeighbourIndex(cubeOfInterest)); %get all the neighbors\ indices and store them in an array so we can select randomly from them.
disp (a);
looping=true;
while looping==true %To avoid visiting any previously visited cube.
disp ('program is looping') %just to know if the program is stuck in an infinite loop.
inds = find(ismember(a, visited)); %store the indices of the common elements if found.
a(inds)= []; %delete the indices of the common elements.
if (isempty (a)==1)
temp = randsample((getNeighbourIndex(cubeOfInterest)), 1);
a= getNeighbourIndex(temp);
disp (a)
else
looping=false ;
end
end
x = randsample(a, 1);
set(hcube(x),'Visible','on','FaceColor','r','FaceAlpha',1)
cubeOfInterest= x;
end
Building the path in the code above starts from the line in which I initialize the visited cubes array (visited = []).
Can anyone please tell me why the program gets stuck in the while loop?
EDIT: I've added some code to Hoki's code to make the path continue even if the neighbors are visited. It will select any not visited cube and move to it if it will not make the path disconnected. The code is now working vey well as required. Here is the modified part,
%% // Random path
rng(1) %// set that if you want reproducible results, otherwise comment it
set(hcube,'Visible','off')
startCubeIndex = randi([1 numel(hcube)],1) ; %// random starting cube
%// startCubeIndex = 1 ; %// or fixed one
maxPathLength = 125 ; %// maximum length of path
maxPathLength= maxPathLength+1;
path_terminated = false ; %// condition to get out of loop
path_visited = [] ; %// store the generated path (visited cubes)this to be checked in case 2 as well.
ptIndex = 1 ;
path_visited(1) = startCubeIndex ;
set(hcube( path_visited(ptIndex) ) ,'Visible','on','FaceColor','r','FaceAlpha',1)
availableAll =[1:125];
while ~path_terminated
available_next = getNeighbourIndex( path_visited(ptIndex) ) ; %// get all the neighbours
[~,~,ib] = intersect(path_visited,available_next) ; %// check if we already went through some
if ~isempty(ib)
available_next(ib) = [] ; %// remove visited cube from "available" list
end
nAvail = numel(available_next) ; %// number of actually available neighbour
if nAvail == 0 %// Exit loop if no neighbour available
msgTerm = 'Path blocked. No other neighbour available.' ; %// Reason for terminating path
%//path_terminated = true ;
%//here I want to make the modification.
looping=true; %//To keep looping until we find the correct next move.
counter=0; %//to iterate through the cubes which are not visisted.
while looping==true
counter= counter+1;
jump= availableAll (counter); %//select the first available cube and check if it is suitable or not
if (~isempty (intersect(getNeighbourIndex(jump), path_visited))) %// if the selcted cube has a visited neighbor, it means it is suitable. The path will stay connected.
%good we found it.
ptIndex = ptIndex+1 ;
path_visited(ptIndex) = jump ; %//add the selected cube to the path.
availableAll (availableAll==jump)= []; %//remove the selected cube from the list of available cubes.
looping= false; %//stop looping.
end
%continue
end
else
ptIndex = ptIndex+1 ;
path_visited(ptIndex) = available_next( randi([1 nAvail],1) ) ;
availableAll (availableAll==path_visited(ptIndex))= []; %//remove the selected cube from the list of available cubes.
end
if ptIndex >= maxPathLength %// exit loop if we reached the max number of elements
msgTerm = 'Path terminated. Reached max number of elements.' ; %// Reason for terminating path
path_terminated = true ;
continue
end
%// choose one neighbour randomly among the available ones
set(hcube( path_visited(ptIndex) ) ,'Visible','on','FaceColor','r','FaceAlpha',1) %// highlight new cube
set(hcube( path_visited(1:ptIndex-1) ) ,'Visible','on','FaceColor','g','FaceAlpha',.2) %// shade old cubes
pause(0.05) %// just for intermediate display, you can comment these 2 lines
drawnow %// just for intermediate display, you can comment these 2 lines
end
disp(msgTerm)
The code above is working well. Hoki provided a great help, thanks a lot Hoki.
Thank You.
A:
Here's a way to implement the random path. I've explicited the exit conditions. You can add more exit conditions if you want or regroup them, but the mechanism is roughly the same. An extract of the important steps:
while ~path_terminated
available_next = getNeighbourIndex( path_visited(ptIndex) ) ; %// get all the neighbours
[~,~,ib] = intersect(path_visited,available_next) ; %// check if we already went through some
if ~isempty(ib)
available_next(ib) = [] ; %// remove visited cube from "available" list
end
ptIndex = ptIndex+1 ;
path_visited(ptIndex) = available_next( randi([1 nAvail],1) ) ;
Then you add the checking for exit conditions and the coloring of the cubes the way you want.
The basic logic to advance the path:
Get the list of neighbours. available_next = getNeighbourIndex( path_visited(ptIndex) ) ;
check if some of them were already visited. [~,~,ib]=intersect(path_visited,available_next);
remove already visited from the "Available" list. available_next(ib) = [] ;
choose (randomly) one of the remaining available. path_visited(ptIndex) = available_next( randi([1 nAvail],1) ) ;
The logic for exit conditions:
Max number of path element has been reached (if you decide to set a maximum length of path). if ptIndex >= maxPathLength
No more "Available" neighbour (i.e. all available neighbour have already been visited). if numel(available_next) == 0
Full code (after all the cube generation):
%% // Random path
rng(1) %// set that if you want reproducible results, otherwise comment it
set(hcube,'Visible','off')
startCubeIndex = randi([1 numel(hcube)],1) ; %// random starting cube
%// startCubeIndex = 1 ; %// or fixed one
maxPathLength = 100 ; %// maximum length of path
path_terminated = false ; %// condition to get out of loop
path_visited = [] ; %// store the generated path (visited cubes)
ptIndex = 1 ;
path_visited(1) = startCubeIndex ;
set(hcube( path_visited(ptIndex) ) ,'Visible','on','FaceColor','r','FaceAlpha',1)
while ~path_terminated
available_next = getNeighbourIndex( path_visited(ptIndex) ) ; %// get all the neighbours
[~,~,ib] = intersect(path_visited,available_next) ; %// check if we already went through some
if ~isempty(ib)
available_next(ib) = [] ; %// remove visited cube from "available" list
end
nAvail = numel(available_next) ; %// number of actually available neighbour
if nAvail == 0 %// Exit loop if no neighbour available
msgTerm = 'Path blocked. No other neighbour available.' ; %// Reason for terminating path
path_terminated = true ;
continue
end
if ptIndex >= maxPathLength %// exit loop if we reached the max number of elements
msgTerm = 'Path terminated. Reached max number of elements.' ; %// Reason for terminating path
path_terminated = true ;
continue
end
%// choose one neighbour randomly among the available ones
ptIndex = ptIndex+1 ;
path_visited(ptIndex) = available_next( randi([1 nAvail],1) ) ;
set(hcube( path_visited(ptIndex) ) ,'Visible','on','FaceColor','r','FaceAlpha',1) %// highlight new cube
set(hcube( path_visited(1:ptIndex-1) ) ,'Visible','on','FaceColor','g','FaceAlpha',.2) %// shade old cubes
pause(0.05) %// just for intermediate display, you can comment these 2 lines
drawnow %// just for intermediate display, you can comment these 2 lines
end
disp(msgTerm)
On a cube with 8 elements on the side (so 512 cubes total), if you set maxPathLength to 100, the path visits 100 elements without stopping:
If you do not set the max length (or just set it to the max number of cube or even more), then the path generation goes on until the cube get "stuck" (e.g. until it arrives in a place where all the neighbours have already been visited):
EDIT:
A variation of the logic which allow you to choose the path generation mode between 3 options:
open : No constraint, a cube can be revisited anytime (path terminates only when max number of element is reached).
stuck : A cube may only be revisited if no other free path can be found
never : A cube cannot be revisited (the path terminates if stuck).
The code is not that different from the initial one but instead of just modifying I prefer to give the full modified code below, so you can see how the different functionalities are implemented.
%% // Set options
cube_revisit_options = {'open','stuck','never'} ;
%// "open" : No constraint, a cube can be revisited anytime (path
%// terminates only when max number of element is reached).
%// "stuck" : A cube may only be revisited if no other free path can be found
%// "never" : A cube cannot be revisited (the path terminates if stuck).
cube_revisit_mode = 'stuck' ;
cube_path_history = true ; %// set to false to display ALL path history, otherwise only "nHist" points displayed
nHist = 30 ; %// number of cubes in the history "trail"
alphatrail = linspace(0.1,0.9,nHist) ; %// decreasing transparency values for the trail
cmaptrail = cool(nHist) ; %// colormap for the trail
% cmaptrail = winter(nHist) ; %// other nice colormaps you can try
% cmaptrail = flipud(hot(nHist)) ;
%% // go for it
set(hcube,'Visible','off')
rng(2) %// set that if you want reproducible results, otherwise comment it
startCubeIndex = randi([1 numel(hcube)],1) ; %// random starting cube
%// startCubeIndex = 1 ; %// or fixed one
maxPathLength = 1000 ; %// maximum length of path
path_terminated = false ; %// condition to get out of loop
path_visited = [] ; %// store the generated path (visited cubes)
ptIndex = 1 ;
path_visited(1) = startCubeIndex ;
set(hcube( path_visited(ptIndex) ) ,'Visible','on','FaceColor','r','FaceAlpha',1)
while ~path_terminated
%// exit loop if we reached the max number of elements
if ptIndex >= maxPathLength
msgTerm = 'Path terminated. Reached max number of elements.' ; %// Reason for terminating path
path_terminated = true ;
continue
end
all_neighbours = getNeighbourIndex( path_visited(ptIndex) ) ; %// get all the neighbours
available_next = setdiff(all_neighbours,path_visited,'stable') ; %// find only "unvisited" cubes
nAvail = numel(available_next) ; %// number of actually available neighbour
switch cube_revisit_mode
case 'open'
%// any neighbour can be selected
available_next = all_neighbours ;
case 'stuck'
%// visited neighbour can only be selected if no other choice
if nAvail == 0
fprintf(2,'Got stuck cube %d at iteration %d. Escaping ...\n',path_visited(ptIndex),ptIndex);
available_next = all_neighbours ;
end
case 'never'
%// visited neighbour CANNOT be selected - Exit loop if no neighbour available
if nAvail == 0
msgTerm = 'Path blocked. No other neighbour available.' ; %// Reason for terminating path
path_terminated = true ;
continue
end
end
nAvail = numel(available_next) ; %// recalculate in case we just changed it above
%// choose one neighbour randomly among the available ones
ptIndex = ptIndex+1 ;
path_visited(ptIndex) = available_next( randi([1 nAvail],1) ) ;
%// recolor
if cube_path_history
%// draw only "N" history cube, in a different color and with decreasing transparency
idxTrace = max(1,size(path_visited,2)-nHist):size(path_visited,2)-1 ;
set(hcube( path_visited(1:max(idxTrace(1)-1,1) ) ) ,'Visible','off') %// disable very old cubes
for ic=1:length(idxTrace)
set(hcube( path_visited(idxTrace(ic)) ) ,'Visible','on','FaceColor',cmaptrail(ic,:),'FaceAlpha',alphatrail(ic)) %// shade old cubes
end
else
%// draw ALL history cube, same color and transparency
set(hcube( path_visited(1:ptIndex-1) ) ,'Visible','on','FaceColor','g','FaceAlpha',.1) %// shade old cubes uniformly
end
set(hcube( path_visited(ptIndex) ) ,'Visible','on','FaceColor','r','FaceAlpha',1) %// highlight new cube
drawnow %// just for intermediate display, you can comment these 2 lines
pause(0.010) %// just for intermediate display, you can comment these 2 lines
end
disp(msgTerm)
An example for 10 cubes/side with maxPathLength=1000:
|
Capnocytophaga species: a cause of amniotic fluid infection and preterm labour.
Subclinical amniotic fluid infection and subsequent preterm labour may occur with intact membranes. We report two cases of subclinical amniotic fluid infection with intact membranes presenting in preterm labour. Capnocytophaga species, fastidious Gram-negative bacilli normally found in oral flora, were isolated in pure culture from amniotic fluid obtained by transabdominal amniocentesis. The distinctive microbiological features and spectrum of infections associated with Capnocytophaga species, and the importance of recognition of subclinical amniotic fluid infection as a cause of preterm labour, are discussed. |
Is it necessary to postpone pregnancy after bariatric surgery: a national cohort study.
The optimal interval between bariatric surgery (BS) and pregnancy remains clearly undefined. The aim of this study was to assess pregnancy outcomes according to the interval from BS to conception. The nationwide study cohort consisted of 130 women with previous BS and postoperative singleton delivery during 2005-2015 in Lithuania. Women who conceived within the first 12 months after BS were included in the early conception (EC) group (n = 30); who became pregnant after 1 year were included in the late conception (LC) group (n = 100). Mean surgery-to-conception time in the EC group was 6.9 ± 3.5 months; in the LC group was 41.4 ± 21.6 months. Anaemia was diagnosed significantly more frequently in women who conceived after 12 months compared with the EC group (56.0% versus 33.3%, p = .04). No significant differences were found between the EC and the LC group regarding gestational diabetes, preeclampsia, caesarean section rate, and adverse neonatal outcomes. Impact statement What is already known on the subject? Bariatric surgery is recognized as a safe and highly effective approach to obesity treatment. Optimal interval between bariatric surgery and conception remains undefined, however most bariatric surgeons advise patients to delay pregnancy for 12-18 months. What do the results of this study add? The results of our study did not show significant differences in pregnancy complications and neonatal outcomes in women who conceived within the first 12 postoperative months and in women who conceived later. Women who become pregnant within the first year after surgery, should be reassured that obstetric complication rates generally are low. What are the implications of these findings for clinical practice and/or further research? Patients with prior BS should be provided with multidisciplinary prenatal care and screening for nutritional deficiencies during pregnancy. Further studies are needed to determine the optimal interval after BS and to assess the influence this interval has on perinatal outcomes. |
Dangling modifier
A misplaced modifier is a type of ambiguous grammatical construct whereby a grammatical modifier could be misinterpreted as being associated with a word other than the one intended. A dangling modifier is one that has no subject at all. For example, a writer may have meant to modify the subject, but word order used means that the modifier appears to modify an object instead. Such ambiguities can lead to unintentional humor, or, in formal contexts, difficulty in comprehension.
Take, for example, the sentence Turning the corner, a handsome school building appeared. The modifying clause Turning the corner is clearly supposed to describe the behavior of the narrator (or other observer), but grammatically it appears to apply either to nothing in particular, or to the "handsome school building".
Similarly, in the sentence At the age of eight, my family finally bought a dog, the modifier At the age of eight "dangles": it is not attached to the subject of the main clause, and could imply that it was the family that was eight years old when it bought the dog, or even that the dog was eight when it was bought, rather than the intended meaning of giving the narrator's age at the time the family "finally bought a dog".
Dangling-modifier clauses
As an adjunct, a modifier clause is normally at the beginning or the end of a sentence, and usually attached to the subject of the main clause, as in "Walking down the street (clause), the man (subject) saw the beautiful trees (object)." However, when the subject is missing or the clause attaches itself to another object in a sentence, the clause is seemingly "hanging" on nothing or on an entirely inappropriate noun. It thus "dangles", as in these sentences:
Walking down Main Street, the trees were beautiful.
Reaching the station, the sun came out.
In the first sentence, the adjunct clause may at first appear to modify "the trees", the subject of the sentence. However, it actually modifies the speaker of the sentence, who is not explicitly mentioned.
In the second sentence, the adjunct may at first appear to modify "the sun", the subject of the sentence. Presumably, there is another, human subject who did reach the station and observed the sun coming out, but since this subject is not mentioned in the text, the intended meaning is obscured, and therefore this kind of sentence is incorrect in standard English.
Strunk and White's The Elements of Style provides another kind of example, a misplaced modifier (another participle):
I saw the trailer peeking through the window.
Presumably, this means the speaker was peeking through the window, but the placement of the clause "peeking through the window" makes it sound as though the trailer were doing so. The sentence can be recast as, "Peeking through the window, I saw the trailer."
Similarly, in "She left the room fuming", it is conceivably the room, rather than "she", that was fuming, though it is unlikely that anybody besides a fumigator would interpret it this way.
Strunk and White describe as "ludicrous" another of their examples (an "unclear on the concept" stab at the ablative absolute – see note below): "Being in a dilapidated condition, I was able to buy the house very cheap." The author obviously meant the house was dilapidated, but the construction suggests that he (the speaker or writer, identified as "I") was dilapidated.
Bernstein offers another ludicrous example: "Roaring down the track at seventy miles an hour, the stalled car was smashed by the train." The adjunct is meant to modify "train": it is the train that is roaring down the track. But the subject of the main clause is "the stalled car". The writer is suggesting that the stalled car, which really isn't moving at all, is roaring down the track. The sentence could be rewritten more felicitously: "Roaring down the track at seventy miles an hour, the train smashed the stalled car." Or: "The stalled car was smashed by the train, roaring down the track at seventy miles an hour."
Follett provides yet another ludicrous example: "Leaping to the saddle, his horse bolted." But who leapt? Presumably the horseman – certainly not the horse, which was wearing the saddle. In this example, the noun or pronoun intended to be modified isn't even in the sentence. Unproblematic: "Leaping to the saddle, he made his horse bolt forward", or "As he leapt into the saddle, his horse bolted." (In the latter, the non-finite adjunct clause is replaced by a finite subordinate clause.)
These examples illustrate a writing principle that dangling participles violate. Follett states the principle: "A participle at the head of a sentence automatically affixes itself to the subject of the following verb – in effect a requirement that the writer either make his [grammatical] subject consistent with the participle or discard the participle for some other construction." Strunk and White put it this way: "A participle phrase at the beginning of a sentence must refer to the grammatical subject."
Dangling participles should not be confused with clauses in absolute constructions, which are considered grammatical. Because the participle phrase in an absolute construction is not semantically attached to any single element in the sentence, it is easily confused with a dangling participle. The difference is that a participle phrase is intended to modify a particular noun or pronoun, but is instead erroneously attached to a different noun, whereas an absolute clause is not intended to modify any noun at all. An example of an absolute construction is:
The weather being beautiful, we plan to go to the beach today.
Non-participial modifiers
Non-participial modifiers that dangle can also be troublesome:
After years of being lost under a pile of dust, Walter P. Stanley, III, left, found all the old records of the Bangor Lions Club.
The above sentence, from a newspaper article, suggests that it is the subject of the sentence, Walter Stanley, who was buried under a pile of dust, and not the records. It is the prepositional phrase "after years of being lost under a pile of dust" which dangles.
In the film Mary Poppins, Mr. Dawes Sr. dies of laughter after hearing the following joke:
"I know a man with a wooden leg called Smith."
"What was the name of his other leg?"
In the case of this joke, the placement of the phrase "called Smith" implies that it is the leg that is named Smith, rather than the man.
Another famous example of this humorous effect is by Groucho Marx as Captain Jeffrey T. Spaulding in the 1930 film Animal Crackers:
Though under the most plausible interpretation of the first sentence, Captain Spaulding would have been wearing the pajamas, the line plays on the grammatical possibility that the elephant was instead.
Strunk and White offer this example: "As a mother of five, and with another on the way, my ironing board is always up." Is the ironing board (grammatical subject) really the mother of five? Less ambiguous: "As the mother of five, and with another on the way, I always keep my ironing board up." Or: "My ironing board is always up, because I am a mother of five, with another on the way."
Modifiers reflecting the mood or attitude of the speaker
Participial modifiers can sometimes be intended to describe the attitude or mood of the speaker, even when the speaker is not part of the sentence. Some such modifiers are standard and are not considered dangling modifiers: "Speaking of [topic]", and "Trusting that this will put things into perspective", for example, are commonly used to transition from one topic to a related one or for adding a conclusion to a speech.
Usage of "hopefully"
Since about the 1960s, controversy has arisen over the proper usage of the adverb hopefully. Some grammarians object to constructions such as "Hopefully, the sun will be shining tomorrow." Their complaint is that the term "hopefully" ought to be understood as the manner in which the sun will shine. In order to modify the whole sentence to convey the attitude of the speaker, they say, the "hopefully" should be moved to the end: "the sun will be shining tomorrow, hopefully."
"Hopefully" used in this way is a disjunct (cf. "admittedly", "mercifully", "oddly"). Disjuncts (also called sentence adverbs) are useful in colloquial speech for the concision they permit.
No other word in English expresses that thought. In a single word we can say it is regrettable that (regrettably) or it is fortunate that (fortunately) or it is lucky that (luckily), and it would be comforting if there were such a word as hopably or, as suggested by Follett, hopingly, but there isn't. [...] In this instance nothing is to be lost – the word would not be destroyed in its primary meaning – and a useful, nay necessary term is to be gained.
What had been expressed in lengthy adverbial constructions, such as "it is regrettable that ..." or "it is fortunate that ...", had of course always been shortened to the adverbs "regrettably" or "fortunately". Bill Bryson says, "those writers who scrupulously avoid 'hopefully' in such constructions do not hesitate to use at least a dozen other words – 'apparently', 'presumably', 'happily', 'sadly', 'mercifully', 'thankfully', and so on – in precisely the same way."
Merriam-Webster gives a usage note on its entry for "hopefully"; the editors point out that the disjunct sense of the word dates to the early 18th century and has been in widespread use since at least the 1930s. Objection to this sense of the word, they state, became widespread only in the 1960s. The editors maintain that this usage is "entirely standard".
Yet the choice of "regrettably" above as a counterexample points out an additional problem. At the time that objection to "hopefully" became publicized, grammar books relentlessly pointed out the distinction between "regrettably" and "regretfully". The latter is not to be used as a sentence adverb, they state; it must refer to the subject of the sentence. The misuse of "regretfully" produces worse undesired results than "hopefully", possibly contributing to disdain for the latter. The counterpart hopably was never added to the language.
See also
Double entendre
Garden-path sentence
Syntactic ambiguity
References
External links
Hopefully fails to modify sentence elements. Originally citing Bryson's Dictionary of Troublesome Words
Category:Disputes in English grammar
Category:Syntactic entities |
Lokmat Samachar to launch Jalgaon edition
The Hindi daily from the stable of Lokmat Media is all set to launch its Jalgaon edition to beef up its presence prior to Divya Marathi's launch in the city.
The Lokmat Media Group is all set to launch its Hindi daily Lokmat Samachar from Jalgaon around May 14. According to sources, the daily will launch with an initial print run of 10,000 copies.
In all likelihood, the daily will bear a cover price of Re 1, of which, the hawker commission will be 60 paise -- a raise of 30 per cent per copy. Usually, the hawker commission for the dailies in that region is around 30 per cent.
Officials at Lokmat Media were not willing to divulge any details about the new edition. But, according to sources, Lokmat Media is taking this step to strengthen its position in the area and brace itself before Divya Marathi, the Marathi daily from Dainik Bhaskar is launched. Divya Marathi is being launched from Jalgaon, following the Aurangabad and Nasik editions.
Lokmat Media group, in all probability, will launch combo offers for both advertisers, as well as the readers.
Lokmat was, until now, catering to the Hindi reading population of the city through its Aurangabad edition. With the launch of its latest edition, Lokmat will become the first Hindi daily to have a Jalgaon edition. The new entrant will face competition from Nava Bharat's Aurangabad edition, available in Jalgaon.
In Aurangabad, the Lokmat Group, in its response to the competition, launched an OOH campaign on similar lines of Divya Marathi, with a similar backdrop. The hoardings displayed across the city by Lokmat has its copy written in Marathi -- 'Now your preferences will be given prime importance', while that by Divya Marathi read 'Coming soon to know your preference', Divya Marathi by Dainik Bhaskar Group.
For the record, Lokmat Samachar was launched in 1989 and is a Hindi language newspaper available in Maharashtra. It is published from Nagpur, Aurangabad, Akola and Kolhapur. It has nine sub editions. Apart from Maharashtra, the daily is available in parts of Madhya Pradesh as well. |
Let $G \leq {\rm S}_n$ be a finite permutation group, and let
$S = \{g_1, \dots, g_k\}$ be a generating set for $G$ which is closed
under inversion and which does not contain the identity.
The growth function of $G$ with respect to $S$ is the sequence
$(a_0, a_1, a_2, \dots)$, where $a_r$ is the number of elements of $G$
which can be written as products of $r$, but no fewer, generators $g_i$.
The diameter of $G$ with respect to $S$ is the largest $r$ such that
$a_r > 0$.
Question: How hard is it to compute the diameter and the
growth function of a given permutation group $G$ of degree $n$?
Or more specifically: using current computer technology, is it feasible
to do this for any given group $G$ of degree $n \leq 100$ and any given
sufficiently small generating set $S$?
The motivation for this question is that while the Schreier-Sims algorithm
allows e.g. to compute the order of such groups and to perform element tests
instantaneously, even only computing the diameter of the Rubik's Cube Group
with respect to its natural generating set was a major effort --
and its growth function is apparently not known in full so far.
My feeling goes in the direction that one can do essentially better,
i.e. that it should be possible to find an algorithm for computing
diameter and growth function which is by orders of magnitude more
efficient than enumerating group elements by brute force.
However maybe I am wrong, and somebody can point out reasons why
these problems cannot be solved efficiently?
Thanks for the reference. -- Though I don't see that the paper answers the question. The author derives bounds on the diameter of certain Cayley graphs, shows that they are sharp and says that the naive way to evaluate the bounds takes $n!$ times a polynomial operations. Though I have not read everything in full.
–
Stefan KohlAug 15 '13 at 9:11 |
Subsequent to the drilling of an underground oil or gas well, if such a well is located within or on a platform, a drilling ship or the like, the well is completed by the introduction of a tubular pipe, which is referred often to as the “casing”. The casing is welded in place as part of the finishing operation.
Before or after the introduction of one or more sections of pipes that form the casing in the underground well, or the like, it may be required to perform several welding operations in one or more ends of the casing for the connection, for example, a leak preventer, heads, valves or other desirable components. It may be desired to fasten sections of each pipe of the casing. In many cases, such a component is fixed to the pipe members of the casing through welding operations by means well known in the industry.
As a result of the discharge of the flame from a welding plant, during the welding operation, sparks, slag and other inconveniences can be expected to be expelled in the air around the welding operation resulting in a serious risk during the welding operation. Slag and sparks could cause a fire or even worse, an explosion, as the casing is inserted often onto “live” wells, which sometimes could become uncontrollable at any time as a result of a breakdown or boiling of flammable liquids, such as natural gas or the like.
To address this danger, there is desired an enclosure that prevents or treats this problem by providing a habitat for welding in underground wells, which not only captures the slag and sparks during the welding procedure in an area which is isolated from the wellbore fluids, but the environment provides for controlled dissemination of slag and spark through habitat and away from the welding operation in a safe and controllable manner.
In the state of the art relative to that described above, there exists the following published documents: U.S. Pat. No. 2,872,933; U.S. Pat. No. 3,837,171; U.S. Pat. No. 3,946,571, U.S. Pat. No. 4,257,720; U.S. Pat. No. 5,018,321, Mexican Utility Model No. 1624 and Mexican Patent Application No. MX 308,953.
However, all these published documents have certain disadvantages and deficiencies that are accentuated when performing the welding process. As a result, it is desirable to make structural changes to these existing structures in order to provide greater benefits to workers and higher security to facilities where these activities are performed.
U.S. Pat. No. 2,872,933 relates to the construction of an air inflated ring cover which is used to cover drilling sites in oil wells, regardless of weather conditions. The cover is hanged by its top over the drilling site.
U.S. Pat. No. 3,837,171 relates to an underwater inflatable structure, which provides an artificial environment around a work area, for example, in a submarine base of an offshore oil platform, allowing for welding and the like to be performed. The structure comprises an integral sheet of material for a custom work or a number of selected sheets attached to the structural support elements. The material includes rack sections so that the material can be placed over and around the structural members in order to ensure a substantially airtight system. Neck sealing means are included on the structural members at their intersection with the sheet material and sealing means within the rack sections although the system could be used on land, it is particularly applicable to subsea situations.
U.S. Pat. No. 3,946,571 relates to an insulated module for use in environments with hostile temperatures that are uncomfortable for humans. This service module is lowered and put into service by the top of the module.
U.S. Pat. No. 4,257,720 relates to a capsule for works in the deep sea, allowing personnel access for maintenance work.
U.S. Pat. No. 5,018,321 discloses a flexible habitat for welding in underground wells to trap slag, sparks and the like. The habitat generally includes an air hanged external arched dome, which is mountable on an entry point of an underground well. The entry point of the underground well receives a pipe member which is extensible in the well and on which a process is carried out by welding. A fire resistant protective element is disposed about at least a bottom of the dome. Means are provided for selectively introducing air to hang the dome on the entry point. The means includes an air inductor motor, a fan, or the like. Means extend through the upper portion of the dome and away from the entry point to communicate with the inside of the dome to allow discharge of smoke including particulate matter, a result of welding procedure that is discharged from inside the dome. The means for introducing air and the means extending through an upper portion of the dome are aligned whereby the air supply forms a carrier stream for transmitting the smoke and particulate matter at least to the means extending through an upper portion of the dome, and preferably to transmit to and through the outside of the dome without the aid of any other means. The habitat also includes a fire resistant skirt which is available around the highest outermost portion of the pipe member. The guard is extended to ensure that the slag and the spark are not discharged downward around the outside of the casing or pipe member of transmission of fluid through the well. However, it has seen that in overworked hours, smoke and particulate waste is relatively excessive, tending to occlude the expulsion means of the habitat. This causes the worker to suffer significant health risks, and in the other hand, considerable costs are generated by the excessive change of filters which are arranged in the discharge means of the habitat.
Mexican Utility Model No. 1624 discloses a flexible habitat for welding in underground wells to trap slag, sparks and the like. The habitat generally includes an air hanged external arched dome which is mountable on an entry point of the underground well, which includes a ventilation system which is comprised basically of a structure porous sublayer arranged throughout the area comprising the dome of the habitat. The sublayer is releasably secured by conventional means, which serves as a filter.
However, upon conditions of use; particularly for U.S. Pat. No. 5,018,321 and Mexican Utility Model No. 1624, are not very favorable, as the degree of difficulty of assembling the structure in a work area is considerably high and dangerous, so the habitat of these two references are not suitable under the habitat occurs in one piece and resulting inconvenient to carry various habitat elements of different sizes. This causes the work schedules to be extended while the cost per hour/man rises considerably.
Mexican Patent No. 308953 and the state of the art cited, display wide shortcomings in their modularity to form the modular habitat and therefore reflect these deficiencies in the safety management to users and infrastructure where the modular habitat is used for working. These shortcomings are reflected in the management of tasks performed as the welding of tube. That is, in this reference, certain disadvantages are identified when performing the assembly process and adaptation in the workplace of the device for welding work, so the present invention overcomes these shortcomings by introducing structural changes in this habitat's modularity in order to provide greater benefits to the worker and the best development of the activities for which Flexible modular habitat was designed, while increasing the safety of workers and therefore infrastructure where the flexible modular habitat is installed.
In Mexican Patent No. 308,953, there is disclosed a flexible and inflatable habitat for welding in underground wells to trap slag, sparks and the like, by a module based structure and/or assembly. The structure allows different applications to fit different hot work applications without having to stop production. However, it has shortcomings by not hermetically sealing the contact of modular habitat with the element to be developed in works, so that security to the users and facilities is poor, and wherein it does not have security elements such as the emergency door.
A further advantage of the present invention over the art cited is the non-use of racks, stanchions or mechanical closures raised from “hard” devices or continuous use. Such lack of racks, stanchions or mechanical closures makes the current invention less susceptible to malfunction in assembly and disassembly of each the modules that form the flexible modular habitat. Thereby, the current invention increases the security provided within the modular habitat, by preventing the modules from separating or opening. |
Warning: spoilers follow for The Last Jedi. Jump into hyperspace and away from this article if you haven’t seen the film yet.
In many ways, The Last Jedi was about saying goodbye to what we know about the Star Wars universe, or at least, letting go of the way things have always been. But in between the beats that say it’s time to move on, there are nods to the past. John Williams‘ themes and character motifs provide a strong connection to the original trilogy, underscoring emotional scenes. And little moments tie the saga together, like Luke Skywalker pulling down the gold dice from the Millennium Falcon cockpit. The spaceship accessory has been part of the hunk of junk since the original trilogy.
Look closely at the middle top of the above photo from A New Hope. The dice are hanging there. They’re not often seen in the films. In fact, they only appear clearly in the above scene and less obviously at a couple of other points in Episode IV; then they’re off-screen until The Last Jedi. But they’re enough a part of the Falcon that J.J. Abrams had them included in The Force Awakens. Reportedly, they went to eBay to find a pair for Episode VII. And Disney Cruise Line made sure to include them in their Millennium Falcon play area. The Force Awakens Visual Dictionary explains the dice were “used in the ‘Corellian Spike’ game of sabacc in which he won the Millennium Falcon from Lando Calrissian.”
They were important to the ship and to Han, so Luke bringing them to Leia as part of his Force projection on Crait is special. And given that we’ve been reminded of their existence, maybe we’ll see Han proudly hang them in the cockpit when Solo is released in five months.
Did you cry when Luke handed the dice to Leia? Do you need a pair of gold fuzzy dice to hang in your Millennium Falcon, a.k.a. your car?
Images: Lucasfilm/Disney
Amy Ratcliffe is an Associate Editor for Nerdist. She likes Star Wars a little. Follow her on Twitter. |
Vitrectomy methods in anterior segment surgery.
We have used vitrectomy instrumentation and techniques to treat a variety of conditions affecting the anterior segment, including: 1) an occluded or inadequate pupillary space, 2) complications of vitreous in the anterior chamber, 3) epithelial ingrowth, 4) complicated lens surgery, and 5) total hyphema. The vitrectomy methods provided controlled excision of intraocular tissues under optimum visualization using a closed-eye system with normal intraocular pressure and the ability to use techniques such as intraocular diathermy. Our experience has been favorable in this series of 117 cases. Of these, 104 cases (89%) were anatomically successful, 70 eyes (60%) had a significant postoperative improvement in vision. The detailed results of vitrectomy surgery for anterior segment disorders are presented for each indication. |
<?xml version="1.0" ?><xliff version="1.1" xmlns="urn:oasis:names:tc:xliff:document:1.2" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="urn:oasis:names:tc:xliff:document:1.2 http://docs.oasis-open.org/xliff/v1.2/cs02/xliff-core-1.2-strict.xsd">
<file datatype="plaintext" original="system/modules/isotope/languages/en/tl_iso_baseprice.xlf" source-language="en" target-language="fa">
<body>
<trans-unit id="tl_iso_baseprice.name.0">
<source>Name</source>
<target>نام</target>
</trans-unit>
<trans-unit id="tl_iso_baseprice.name.1">
<source>Enter a name for this base price.</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.amount.0">
<source>Base amount</source>
<target>مقدار پایه</target>
</trans-unit>
<trans-unit id="tl_iso_baseprice.amount.1">
<source>Enter the base amount (e.g. "100").</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.label.0">
<source>Label</source>
<target>برچسب</target>
</trans-unit>
<trans-unit id="tl_iso_baseprice.label.1">
<source>Enter a label for this base price (e.g. "%s per 100g".)</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.new.0">
<source>New base price</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.new.1">
<source>Create a new base price</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.edit.0">
<source>Edit base price</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.edit.1">
<source>Edit base price ID %s</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.copy.0">
<source>Duplicate base price</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.copy.1">
<source>Duplicate base price ID %s</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.delete.0">
<source>Delete base price</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.delete.1">
<source>Delete base price ID %s</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.show.0">
<source>Base price details</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.show.1">
<source>Show details of base price ID %s</source>
</trans-unit>
<trans-unit id="tl_iso_baseprice.name_legend">
<source>Base price</source>
</trans-unit>
</body>
</file>
</xliff> |
Q:
Improper Numerical integral
I am self teaching myself python and computational physics via Mark Newmans book Computational Physics the exercise is 5.17 of Computational Physics. I have to shift the limits of integration for an improper integral after a change of variables so that Gaussian quadrature method gives a more accurate result. I am suppose to approximate the Gamma function $\Gamma(a)$
The relevant equation is here:
This is the question:
When I isolate for $x$ I get $x = \frac{zc}{1-x}$. But when $z = \frac{1}{2}$ I get $x = c$ but this makes no sense because this implies z is a constant which it's not. I know in order to shift a function $f(x)$ to the left you $f(x + c)$ but how would I do this with an integrand?
A:
The task in this problem is to apply the variable transformation
$$z=\frac{x}{c+x} \Leftrightarrow x=\frac{zc}{1-z}\,,\quad \textrm{d}x=\frac{c}{(1-z)^2}\textrm{d}z$$
to the integral
$$\int\limits_0^\infty f(x)\textrm{d}x\,,\quad f(x)=x^{a-1}e^{-x}\,,$$
which yields
$$\int\limits_0^1 \tilde{f}(z)\textrm{d}z\,,\quad \tilde{f}(z)=\left(\frac{zc}{1-z}\right)^{a-1}\exp\left(-\frac{zc}{1-z}\right)\frac{c}{(1-z)^2}\,,$$
and chose the parameter $c$ such that $\tilde{f}(z)$ takes its maximum at $z=\frac{1}{2}$.
How do we do that?
You have already completed the first part of the question: $z$ takes the value $\frac{1}{2}$ when $x=c$.
The second part asks which is the correct $c$. We tackle this by computing the derivative of $\tilde{f}(z=\frac{1}{2})$ with respect to the unknown parameter $c$ and set this to zero:
$$\left.\frac{\partial \tilde{f}}{\partial c}\right\vert_{z=\frac{1}{2}} = \frac{1}{4}c^{a-1}e^{-c}\left(a-c\right)=0\,.$$
Thus, we find $c=a$.
|
How to Prepare 16 Healthy Meals in 40-Minutes
When you hear the word “meal prep” what comes to mind? I don’t know about you, but I automatically go to a dark, scary place – I think of stacks of Tupperware with carefully rationed portions. I think about giant amounts of bland chicken breasts, huge vats of brown rice, and tons of steamed broccoli. “The horror, the horror!”
For just a second, let’s suspend the perception of meal prep as the Tupperware-carrying physique competitor that you see at the gym gulping his protein shake. Instead, picture a much simpler, more realistic version.
Here’s a quick summary of my meal prep strategy:
You cook extra servings of various proteins and chop a bunch of core veggies to use in multiple dishes. This creates the base for most of your meals. To this, you can add a few select pre-made items (sliced turkey breast, bag of prepared greens, etc.) and boom – you have 80% of your meals for the week.
Now that doesn’t sound so hard, does it?
Meal Prep Made Easy
I’ve got some good news – I’m going to completely change your whole meal prep perspective. You’re going to learn some things that might surprise you. For example, it’s OK to use fat. In fact, fat is healthy, and it tastes great. Both cheese and avocado (examples of fat) are excellent ways way to make food delicious. Also, spices are your best friend, and don’t be afraid to use salt. As far as spices go, these 5 should definitely be in your kitchen arsenal.
The main point is that cooking healthy meals doesn’t have to be difficult. I know for some of you cooking is an overwhelming task and you might have no idea where to start.
That’s totally OK.
I’m no all-star chef, but I’ve mastered a few quick, simple, and healthy meals that also support my lean, active lifestyle.
You’re about to learn an easy way to prepare 16 meals in 40-minutes. Yes, you heard that right – 40-minutes of focused time in the kitchen will give you 16 healthy meals that are high in protein and loaded with tasty vegetables.
Here’s something that’s hard to argue with – the more meals you eat at home, the healthier and leaner you will probably be. There are of course exceptions to the rule, but for the vast majority of us, eating home-cooked meals often leads to improved body composition.
A time-crunched schedule is no excuse either.
All you need to do is prep once a week for 40-minutes and you’ll set yourself up to be a fat-burning machine.
The Ultimate Grocery-Shopping List
First things first, you’ll need to do some grocery shopping to pick up all the ingredients. Here’s your shopping list:
Basic Cooking Supplies
Meal Prep Instructions
Set up a timer for 40 minutes. Remove all of your groceries from your fridge and cabinets. Prepare yourself to make tuna salad, egg salad, baked marinated chicken, parmesan roasted veggies, and a roasted turkey salad.
Step 1: Pre-heat the oven to 400 degrees, and heat a medium pot of water.
Step 2: Place the chicken breast in a large Ziploc bag. Add 2 tbsp of oil olive, 2 tbsp soy sauce, 2 tbsp Worcestershire sauce, and 2 tbsp Greek yogurt. Mix well so every breast is well coated in the marinade. Set aside for 10 minutes.
Step 3: Carefully place 8 eggs into the pot of (almost) boiling water. Simmer the eggs for about 8 minutes. Cooking tip: Placing eggs into hot water will make the peeling process much easier down the road.
Step 5: Transfer chicken from Ziploc bag into baking dish. Place chicken, broccoli and cauliflower into the oven. Set the oven timer to 20 minutes.
Step 6: Dice peppers, onions, cucumber, celery and carrots and set aside in separate small bowls.
Step 7: Place tuna into large bowl and add half the chopped onions and celery. Add 2 tbsp of Greek Yogurt. Add salt, garlic powder, black pepper, cumin, and cayenne powder. Mix well and place in fridge. Your tuna salad is done.
Step 8: Mix large bag of greens in a large bowl with chopped peppers, carrots, onions, and cucumbers. Chop turkey breast slices into 1-inch pieces and toss into salad. Set aside. Your roasted turkey salad is done.
Step 9: Remove the pot with eggs from the heat and run under cold water for 30-60 seconds.
Step 10: Peel eggs and mash them in a large bowl with the rest of the chopped onions and celery. Add 2 tbsp of Greek yogurt. Add salt, garlic powder, cumin, and cayenne powder, and mix until well-blended. Your egg salad is done.
Instructions: • Pick your protein. 1) Chicken breast, 2) Egg salad, 3) Tuna salad, or 4) Turkey breast • Prep a large plate with the pre-mixed salad (from step 8 above). Place 6-8 ounces of protein on top of salad. Add ¼ of a large avocado. • Quick and easy dressing: Mix 1 TBSP olive oil with a splash of balsamic vinegar. Add the juice from a fresh lime or lemon and mix well. You can also spice up your salad with the following easy add-ons: Sunflower seeds, Feta cheese, Sliced almonds, Peanuts, Olives, Diced apple
Nutrition Information for Big-Ass Salad with Egg Salad
Calories
475 calories
Fat
30 grams
Protein
30 grams
Carbs
20 grams
Mix and Match For Different Meals
The best part about meal prep mastery is that once you have a solid foundation of the proteins and veggies, you can mix-and-match to find a winning combo that you love.
Maybe you’re feeling a sandwich, so you grab a fresh slice of bread to throw your protein on?
Maybe you want to add some tortilla chips to your salad?
Maybe you want some extra carbs, so you bake a huge potato to go with your pre-made protein and veggies?
The options are really endless.
As long as you’re eating protein and veggies with each meal, you’ll have a solid foundation to live a fit, lean lifestyle. This one rule alone will have a dramatic effect on how you feel, how you look, and how you think.
Let me know how this works out for you. Drop me a message in the comments below.
35Comments
Debbiesays:
June 20, 2016 at 2:39 pm
I love this and I am heading to the grocery store this evening. However, after its all prepped, what is a serving size of the tuna and egg salads? 1 cup?
Great article. I bet some whole lettuce leaves for tuna salad lettuce wraps would be great with this recipe.
A few additional tips I've picked up over time, may be helpful to a few others. -To save on vegetable prep, microwave bags are fairly quick also, they steam in about 3 minutes. -Conversely, you could also head to a local store (such as a chinese restaurant) and ask for an order of steamed veggies. You can get a large portion for a low price and portion out accordingly. - For carbs, the micrwaveable rice cups (brown rice) are an alternative (be mindful of contents). They're already portioned out to a cup so no measuring and in 60 seconds in the microwave you've got a source of complex carbs. Hope those small tips help someone the way they helped me.
Cancel reply
Nicksays:
June 27, 2016 at 3:44 pm
Thanks Anthony, good tips - especially the one about ordering large portion of steamed veggies as take-out, that's a great move!
Cancel reply
Chadsays:
June 24, 2016 at 12:45 am
I just did this! Followed every step and now my fridge is full, and I am exhausted. Took me 2 hours though, not 40 minutes, what with cleaning and chopping the veggies. I am a little meticulous in the kitchen, so that could have increased the time a bit. Still not bad for 16 meals :) Thank you for this idea!
Cancel reply
Nicksays:
June 27, 2016 at 4:01 pm
Hey Chad, full fridge with real food is always a good thing. Glad you enjoyed. Yeah, I think buying some of the foods pre-chopped and pre-washed might help cut down on the time. I bet the the next time around you'll shave off a bunch of time off..keep me posted!
Cancel reply
Chadsays:
June 24, 2016 at 2:13 am
Just did this this evening. Everything is delicious! The marinating on the chicken is something I rarely do, but even marinating for the short amount of time is very effective. Thanks for these tips!
Cancel reply
Arielsays:
June 27, 2016 at 3:14 pm
did this last night but took me quite a bit longer than 40 minutes... double that i think. still totally 100% worth it though! i think if i do this routine every week it will start going more quickly for me. i couldn't NOT take this meal prep advice though! the first paragraph had me rollin! i felt that exact same way! thanks for showing me that it's not so bad! =D i honestly feel that a big reason i still haven't reached my fat loss goal is due to not prepping healthy meals beforehand - so i'm very excited to have completed this not-so-bad task this week! tip: if it's hot in your house (summer time!) do not heat up your oven until you're actually ready to throw the chicken & veggies in! by the time my oven preheated i was still madly chopping away at the broccoli and cauliflower, and my chicken had only been marinating like 3 minutes. everything tastes so good! i especially love the spices in the egg salad and the simplicity of having the pre-prepared green salad! i usually don't want green salad unless it's loaded with tons of goodies.. and who has time to always be chopping a million different things every time you want a big ass salad? not me! spending an hour or so one day per week getting everything chopped and tossed into the leaves and back into a bag is so simple and easy! very excited about all of this! thank you for keeping it so simple!! love it.
Cancel reply
Nicksays:
July 1, 2016 at 9:44 am
Thanks for the comment Ariel! Yeah, it can take longer than 40 the first few times you do it, but it's well worth it for sure. I hope this helps you get closer to your fat loss goals.
Cancel reply
Mikesays:
July 4, 2016 at 6:57 am
Thanks for this meal prep tip tried it and everything came out great my question is now what are your meal break down for the day I hear everyone say you should eat 4 to 5 small meal per day.
Cancel reply
Nicksays:
July 6, 2016 at 5:47 pm
You bet Mike, glad it worked out well for you. I wouldn't worry too much eating 4 to 5 meals per day, unless than works well for your schedule. The whole mantra of eating small meals throughout the day came from old studies that showed you could burn more calories but doing so (using the thermic effect of eating). Most of these studies have been debunked and there is plenty of research that supports eating as little as 1 meal per day. Check out Intermittent Fasting if you want to learn more about that. It really doesn't matter in my opinion. Personally, it depends on the day for me. Most days, I'll eat 2 full meals. Maybe on a really active day, I'll bump it up to 3 or 4. Hope that helps you Mike.
Cancel reply
Michellesays:
July 5, 2016 at 5:43 am
When you have the calorie content - is that for all 4 meals? eg chicken tacos says 650 cals, 20 gms fat etc is that for the full 4 meals - ie divide the mixture by 4 to get the macro counts? Great idea - can't wait to try it out this weekend. Cheers
Cancel reply
Nicksays:
July 6, 2016 at 5:58 pm
Hey Michelle, no the 650 calorie count is for 3 chicken tacos. That of course includes the shredded cheese and 1/2 an avocado. You could reduce the cals by eliminating the cheese or avo, that could be a good lower cal option. I would say without the cheese and avo, you're looking at around 400 cals. Enjoy!
Cancel reply
Debra Gartlandsays:
July 11, 2016 at 8:14 pm
Great prep outline. Thanks. I did this tonight and it worked out great
Cancel reply
Aleeshasays:
October 17, 2016 at 4:04 am
This was a life saver and super awesome! I am newly trying to get into shape, eat right, and change my lifestyle overall. Hopefully you make more instructionals like this! You have a solid follower with me. Thanks!
Cancel reply
Marksays:
October 24, 2016 at 5:25 pm
This all looks great and i'm eager to try it out, however i am unable to eat chicken/turkey as i have Eosinophilic esophagitis. What would you recommend instead? |
Q:
jQuery/js separating 2 drop down values
I'm using Eric Hynds jQuery MultiSelect Widget. I'm actually using 2 separate widgets that when checked, creates a dynamic checkbox w/ value attached to a corresponding 'Main' checkbox if 'Main' checkbox is checked. Please see my fiddle with comments inside to illustrate my problem:http://jsfiddle.net/3u7Xj/52/
How to separate the 2 widgets to show in corresponding sections and still only allow the user to choose 2 combined from either?
$(document).ready(function() {
$(".multiselect").multiselect({
header: "Choose up to 5 areas total",
click: function (event, ui) {
if (ui.checked && $(".multiselect").children(":checked").length >= 2) {
return false;
}
var lbl = ui.value;
if(ui.checked){
var ctrl = '<input type="checkbox" name="chk" checked="checked" class="chk" id="'+lbl+'">';
$("[id^=Main]:checked").each(function(){
$(this).nextAll('.holder:first').append('<div>'+ctrl+lbl+'</div>');
});
}
else {
$("[id^=Main]:checked").each(function(){
$(this).nextAll('.holder:first').find('div input[id="'+lbl+'"]').parent().remove();
});
}
},
selectedList:5
});
});
A:
So I modified the condition and it works as it should, I hope that it will suit you.
var number1=$("#dropdown1").children(":checked").length,
number2=$("#dropdown2").children(":checked").length;
if (ui.checked && ((number1 + number2 >=4) || $(this).children(":checked").length >= 2)){
return false;
}
Demo here
If you want to only two from both selects and modify the condition as follows:
var number1=$("#dropdown1").children(":checked").length,
number2=$("#dropdown2").children(":checked").length;
if (ui.checked && ((number1 + number2 >=2) || $(this).children(":checked").length >= 2)){
return false;
}
Demo here
Adapted to the requirements in the comment
individual segments inserted into the div. Adjusted control function click
to:
$(this).parent("div").find("[id^=Main]:checked").each(function(){
$(this).nextAll('.holder:first').append('<div>'+ctrl+lbl+'</div>');
});
Demo here
|
DURHAM, N.C. --- In a cramped room, North Carolina head coach Larry Fedora walked in to face a large collection of reporters late Saturday afternoon. UNC had just lost 42-35 to Duke. It was Carolina's sixth straight loss of the season, dropping the Tar Heels to 1-8 on the year. This followed a disastrous 3-9 season in 2017.
Three straight losses to East Carolina. Three straight losses to Duke. Two straight losses to N.C. State -- and potentially a third in two weeks.
Since Nov. 10, 2016, North Carolina is 5-20 overall and 2-15 in the ACC. In a game that throughout the 1990s and 2000s was an assumed victory on the schedule for UNC, the Tar Heel defense gave up 629 yards of total offense to the Blue Devils and allowed quarterback Daniel Jones to throw for 361 yards and run for 207, including two runs of 61 and 68 yards.
Saturday, Nov. 10 seemed as close to rock bottom for the North Carolina football program as it has been under head coach Larry Fedora.
UNC head coach Larry Fedora on Saturday vs. Duke.
As the postgame press conference neared its end, big-picture questions were asked. It wasn't just about this season, it was about the future, the fan base, and the health of the UNC program.
'When you take a step back and look at it from a program-level, how do you turn things around?'
The seventh-year Tar Heel head coach hesitated and then took a dramatic pause before answering. "You keep doing the things you are doing," Fedora said. "You keep putting the kids in the best positions you think you can put them in. You sleep at night because you know you are not going to get outworked. And you are going to work as hard as anybody there is and these kids are going to continue to work hard and it'll happen. I truly believe that."
What UNC and Fedora have been doing of late has not worked. Over the course of the last two grueling and disappointing seasons, it seems everything that could go wrong for Carolina football has gone wrong. It's not just the injuries and the last-minute losses in games the Tar Heels should have won, but the disappointment has extended off the field, such as with 13 players suspended for selling team-issued shoes.
There is nothing left to play for this season but pride and each other. Western Carolina and N.C. State remain on the schedule, but the fan turnout for those two final home contests is sure to be lackluster. Losing leads first to fan frustration, and then fan apathy. And there has been a lot of losing the last two seasons in Chapel Hill.
Fedora was then asked, at 1-8 after a 3-9 season, what he tells the fans and supporters of this North Carolina program.
"If they are fans and supporters then they know to stick with them," Fedora said." I shouldn't have to talk you into it. It's the Tar Heels and if you are a fan of the Tar Heels and you are a supporter of the Tar Heels and your blood is blue there is no question about what you do --- you keep supporting. These guys haven't given up. So I don't expect anybody to give up on them."
Indeed, the team hasn't given up. The Tar Heels have been competitive in almost every game. The broken-record line of being 'one play away' was applicable after the Virginia Tech and Syracuse losses, but doesn't work for the whole season. Yet UNC continues to practice and play hard, which is a credit to the coaching staff and the players leading in the locker room.
"I am not worried about their morale," Fedora said. "I am not worried about what they are made up of. They have already shown that for us through this entire year. They could have shut it down a long time ago. They could have shut it down when y'all started talking about 'They don't have a bowl game, so why are they playing.' They are not going to. That is not who they are. They take great pride in who they are and they are going to play hard."
Still, the outlook for UNC football right now appears bleak. It is hard to rebound from a 5-20 overall stretch and a 2-15 run in the ACC.
To make matters worse, North Carolina has the No. 60-ranked recruiting class in the nation (No. 12 in the ACC) right now and the December signing day is just over a month away. UNC's 2019 class trails such programs as Duke, Wake Forest, Vanderbilt, SMU, Memphis, East Carolina, North Texas, and Western Michigan in the 247 Sports rankings.
The 2018 season falls in line with what happened in 2017 --- a team that plays hard but compiles a disastrous season. This team hasn't given up, yet it's fair to consider how many more losses it can endure before it reaches an unhealthy breaking point. |
"(Sydney) The first time I learned of Prophet Five." "my fiance was gunned down in front of me." "Turns out he wasn't the first." "They killed anyone who got too close." "They'd infiltrated the highest levels of governments and the inner sanctums of intelligence agencies." "They appeared to control entire sectors of technology. finance. defense." "We believed they were run by a group of 1 2 whose power was everywhere and nowhere." "because no one knew who they were... until now." "I've lived with secrets all my life." "and I'm done." " Don't believe I've seen you here before." " A vodka martini, please." "Dry." " Got visual conformation." " Copy that, I'm standing by." " Got it." " Understood." "Good work." "Mr. Kheel, Ms. McMullen, of course." "Your party is waiting." "Right this way." " This is Phoenix, do you read?" " Go ahead." "Kheel and McMullen, I remember those names." " They're in the Prophet Five archive." " Pulling it up now." "McMullen and Kheel." "You're right." "They're members of Prophet Five." " They're here." " Can you get their picture?" " I think so." "I'll have to improvise." " Don't risk blowing your cover." "I won't." "(Jack) Outrigger. what's your status?" " I'm in position." " Copy." "Any sign of your target?" "Standing by." "Come on." "Turn around." "Target acquired." "I'm done here." "I got a nasty skin condition." "You do not want to see me without my shirt." "It's not a..." "It's not a pretty sight." "Ooh!" "Time flies in the old steam room." "Has it really been six minutes?" "It feels like... two." "I'm gonna run." "Nice talking with you." "Sorry." "Son of a bitch!" "Why do I always get the assignments that involve hypothermia?" "'Cause you're late to briefings." "Dammit." "(horn)" "Visuals acquired." "Oh, I am really sorry, Debbie." " (Jack) Phoenix. do you copy?" " Phoenix here." "I'm signing off." "Can you handle this?" " I'm on it." "Good luck." "Dad." " Likewise." "Would you mind?" "It's for my granddaughter." " Sure." " Try to get the Capitol in the back." "(woman) Smile!" "Excuse me." "What do you think you're doing?" "Oh, hey, I'm covering for Debbie." "She said she cleared it, didn't she?" " No." " OK, well, she said she did." "She had some kind of family emergency." "Her sister was sick." "The gross kind." " It's good of you to fill in." " I need the tips." "It's expensive down under." "(phone rings)" "Mate, we got a situation down here." "Excuse me." "How did you say you knew Debbie?" "(man) Hey!" "Now we know who we're fighting." "(Jack) Now that we know who the 1 2 are, we've filled in details, none of which are reassuring." "Between them, these people wield enormous power." "Their global reach is... well, global." "We know who they are." "Why don't we just take them in?" "Unfortunately, it's not that simple." "We need to make the right move." "We need to arrest them simultaneously." "We need a program to track their movements." "Input the visuals and data we have on the 1 2 and cross-reference everything." "OK." "That should just take me a lifetime." "That's really..." " No problem, I'll get right on that." " What about Sloane?" "We're operating under the assumption that he's working for the 1 2." "We take them down - we get to him." "The 1 2 have been searching for this for a long time." " Since before you were born." " Don't get too attached." "They're expecting it to be turned over." "I should get going." "Have you ever considered what would happen if you did that?" "Once Prophet Five has the amulet, their use for you - for all of us - would be limited." "Unless we find a way of solidifying our position." "Making ourselves less expendable." "That's a very bold move, Arvin." "Trying to cut a side deal with one of their top assets?" "I'm well aware that you can tell them what I'm proposing." "It might curry you some favor." "Save your life... temporarily." "But you're like me." "You have good instincts for self-preservation." "Perhaps the fact that you'll be compensated for your efforts." "So does he come with the package?" " I assume that means you're interested?" " What do you have in mind?" " Hey." " Oh, hey." "Isabelle's gonna be up in two hours." "I can't sleep." "I can see why." "This stuff would give anyone nightmares." "The man that gave me the amulet told me that what was inside was the end of nature." "And that stars would fall from the sky." "No matter what I did, I couldn't stop it." "Well, consider the source." "A prisoner in a maximum security prison." "He recognized me." "He knew who I was." "Weird, yeah." "Not conclusive." " What if he's right?" " He's not." "How can you say that?" "With everything we've seen." ""This woman without pretense..." That would be you." ""... will have her effect, never seeing the beauty of my sky behind Mount Subasio."" "Wordy and wrong." "All this talk about prophecy and fate - you disproved it." "You climbed Mount Subasio and saw the sky." " It's not just that." " Sloane?" "I keep thinking about all the people he's killed." "Including his own daughter." "I know what it's like to grow up without a mom." "I don't want that for Isabelle, she needs me." "Which is why we won't let that happen." " You promise?" " I promise." "Hey." "Mm." "Your hair smells like fruit." "Mm." "Mitchell threw apple sauce at my head this afternoon." " I didn't get a chance to wash it out." " Don't worry." "I find it very attractive." " You do realize I'm half asleep, right?" " Perhaps I can inspire you to wake up." "(child) Daddy!" "Or perhaps you could go check on Mitchell." "Right." "I'll be back." " Turn off the light." " Got it." "(knocking)" " Tom." " I'm sorry, I didn't realize how late it was." "No, that's OK." "I was up, working." "What's going on?" "Just in the neighborhood." "I thought I'd see if you were awake." "Which is ridiculous, because it's not true." " I wanted to talk to you." " Come on in." "Please." " Do you want something to drink?" " What do you got?" "Coffee." "You're not gonna give me some lecture about drinking on a school night, are you?" "Not yet." "You're thinking about her, aren't you?" "I wish I had done things differently." "Could have saved her." "But I didn't." "What happened to your wife - it was a crime." "Korman pulled the trigger, not you." "Then why do I feel like I'm to blame?" "Because you're a good man." " Um..." "Rachel, I'm sorry." " No, it's OK." " That's not why I came here." " No, I know." "I know." " It's not a big deal at all, I mean..." " No, I should go." "No." "Stay, and we'll talk." "Please." " I'm gonna get us that coffee." " OK." "What's taking you guys so long?" "Marshall?" "About what hap... (knocking)" " Where did you go?" " It's been a while, hasn't it?" "(screams)" "Where's Mitchell?" "Where's my wife?" "Your family's fine." "They're safe at home." "Although, I imagine they're sick with worry." " What do you want from me?" " Rambaldi described a cavern." "He gave a very precise description of the stone formation inside." " I want you to locate it for me." " What?" "You're familiar with the US government's ground-penetrating satellite network." " I need you to access the system." " You're tasking me?" " What?" "You think you're still my boss?" " Marshall..." "What you're doing is bad." "I know that." "It's, like, end-of-the-world bad." "This is not a request." "I will not help you." "Let me know when you persuade him." "What are you doing?" "What is that?" "What is that?" "Hey, hey." "Take it easy." "OK, let's talk about this." "No!" "Ow!" "Please!" "Thank you for coming." "I'm so glad you're here." " How are you holding up?" " I sent Mitchell to my mother's." "I mean, he wouldn't just leave." "You know him, right?" "He wouldn't do that." " No, he wouldn't." " It makes no sense." "He's a game designer - why would somebody abduct him?" " There's something you need to know." " (phone rings)" "Excuse me." "Marshall doesn't work for a video game designer." " Bristow." " I'm at Rachel's place." "I got worried when she didn't check in." "Door was open." "Wallet, keys, phone are still here." "It can't be a coincidence." "Get back to APO." "Alert the team." "We'll meet you there." "I'm on my way." "But I worked for the ClA, the NSA - why would he need to lie?" "You have to understand, Carrie, he was ordered not to tell you." "We all were." " He was trying to protect you." " We need to get back." " There's another situation." " I wanna go with you." " That's not possible." " I can't watch from the sidelines." "Without Marshall your technical support is compromised." "I can help." " Please." " OK." "Grab your coat." "Thought a lot about you since the last time we saw each other." "Was hoping we'd meet again." "Of course, in my mind it was..." "under much different circumstances." "Rachel, don't make me do this." "Is now when you tell me this will hurt you a lot more than it hurts me?" "I wish that were true." "(screams)" "Sloane did this." "He knows where we live, where we work, how we work." " The question remains - why?" " To disable our technical capabilities." " To distract us." " Perhaps he needs something from them." "And Marshall and Rachel - you know he won't hesitate to kill them once he gets what he needs." "I know." "You were right about him." "After Irina was extracted I was taken into custody." "I had to designate a guardian for Sydney." "I chose Sloane." "In spite of everything he's done," "I believed that some part of him was still the friend I once trusted with my daughter." "Clearly, I was wrong." "Oh, my God..." "Vaughn." "I thought you were..." "I thought..." "OK." "I guess that was a lie, too." "Right?" "It's complicated." " Anyway, what can I do?" " Marshall had a program to track the 1 2, and I ran it through decryption, but he's got so many security protocols." " Can I?" " Yeah, sure." "(computer beeps)" " You're in." " What was it?" " "Moonglum of Elwher."" " That was my next guess." "He's rereading all his favorite books to get ready for when Mitchell reads." "Anyway, so what else can I do?" "Aaargh!" "Peyton, would you mind giving us a moment alone?" "You want to see your family again, don't you?" "Don't be difficult." "Think about your son." "No, Marshall, you're not cut out for this." "I never liked you." "I tolerated you, because I had to." "Because you were my superior, and I was afraid of you." "Then I saw how twisted you were." "But now I see you for who you really are." "You are a weak, pathetic man." "You know what?" "You're right." "I'm not cut out for this." "But I am thinking about my son." "I want Mitchell to look up to me." "To be proud of his dad." "Which is why no matter what you do to me," "I will never help you." "You know, I got a hangnail, right there on my thumb." "You mind working on that one next?" "(Nadia) Marshall's right about you." " I'm doing what needs to be done." " Does that help you sleep at night?" "Eventually, Marshall and Rachel will do what I ask." "No, they won't." " Why not?" " They have something you don't." " What?" " Love." "Family." "Honor." "Take your pick." " That's why you'll never break them." " You're right." "I need to find another way." " What about airports?" " We've notified the FAA." "I assume Sloane would have other means." "I'm taking Isabelle to the sitter's." "I'll be back as soon as I can." "If you try anything, be advised it will end badly." "What do you want?" "Talk to Marshall, he'll listen to you." "They didn't do what you wanted." "You have an opportunity to save their lives." "I suggest you take it." " Syd!" " Marshall." "Find Carrie and Mitchell - make sure they're OK." " They're fine." "Nothing will..." " If anything happens to me, tell Mitchell I was strong, so he's proud of his old man." "Tell Carrie to move on and find someone else." "Marshall, listen to me." "Whatever Sloane is asking, I want you to do it." "What?" "Syd, no, I can't." "Marshall, whatever he asks." "Your life is more important." "Now, before I hang up, is there anything you want me to tell Carrie?" "Yeah, actually, I want you to tell Carrie that I love her." "And that I'll finish reading Littlest Fish to Mitchell when I get..." "You did the right thing." "Why are we here?" "I told you I wouldn't help you." "Yes, but he agreed to." "And he needs your help." " Marshall..." " Rachel?" "...I know this is bad, but we cannot do this." "We have to." "I spoke to Sydney, she understands." "Listen, Rachel, I'm gonna do this, OK?" "Unless you help me leapfrog the system, it won't work." " Leapfrog." " We have to make sure we're not detected." "Or else it'll shut us out." "We'll need to open a bunch of ports." "Don't stay in more than 1 5 seconds each." "That's right." "1 5 seconds is a good idea." " She's very bright." " Terrific." "Get to it." "That was Sydney." "She was on the phone with Marshall." " What?" " He's fine." "He passed a message - he'll finish reading Mitchell The Littlest Fish when he gets home." " We haven't read that book in a year." " What's it about?" "It's about a goldfish, and some boy who's his friend." "His name is Niles." "No, Noah." "NOAA." "National Oceanic and Atmospheric Administration." " They monitor weather, eco-systems." " Using a state-of-the-art satellite." "Maybe Sloane wants them to hack in." "I can set up some wires to monitor the hack." "If I can detect them," "I can pinpoint their location." " It's happening now." " I'll be fast." " Any progress?" " They're close." "The firewall's flagging network activity." "Someone's sending out signatures." "It's Marshall." "He's intentionally triggering the network security protocols." "Can you trace the location?" "That's it." " Where is it?" " Central Italy." "Zoom out." "I should have known." " What happens now?" " Good work... as usual." "I'm narrowing it down." "Mexico." " They're in Ixtapa." " I'll assemble a rescue team immediately." "I've convened the 1 2." "They're eagerly anticipating our arrival." "The jet's waiting, we should get going." "We should reconsider our plans for the prisoners." "Don't tell me you're getting sentimental." " Or do you just have a thing for blondes?" " It simply seems unnecessary, that's all." "This isn't open for discussion." "Eliminate them." "Where are they?" "You think they just left?" "Rachel, what's wrong?" "Are you having a heart attack?" " Exposure to electricity?" "Rachel?" " No, not a heart attack." "What are you doing?" " What is that?" "You carry a garrote?" " It's an underwire." "Sometimes it pays to be a girl." "Um, Rachel..." "Hey!" "Listen, I have a family, OK?" "And a child." "I want another one." "Maybe even a girl." "Oh, my God." "That was the coolest thing I've ever seen." "Seriously, that was Empire Strikes Back cool." "Let's get out of here." " Hey!" " Get down!" "Oh, my God." "Syd!" "Thank you." "Thank you!" "Thank you!" "Thank you!" " How did you find us?" " Your wife, Marshall." "Carrie found you." " Any sign of Sloane?" " We checked the entire facility." "He's not here." "I think you should see this." "Marshall's program to track the 1 2 was designed to notify him should anything significant happen." " It's pretty significant, if you ask me." " They're gathering." "(phone rings)" " Bristow." " Hey, Dad." "Marshall and Rachel are good." " They got to them." "Marshall's safe." " Thank God." "But Sloane, Sark, Peyton - they're gone." "The 1 2 are meeting in Zurich." "Sloane's presenting the information Marshall and Rachel acquired." "This is what we've been waiting for." "We can bring them all down." "I know." "I'll alert our contacts, have them assemble in Zurich." "Sydney, it's almost over." "Then I told him to move to my hangnail." "He didn't think Flinkman had it in him." " He's such a jerk." " I could think of some other words." "You were mapping caves in Italy." "Do you have the coordinates?" " Yeah." " That's the other thing." "We spent hours hacking into the system." "When he gets it, he's all cryptic." ""l should have known." What was that?" " He should've known?" " That's what he said." " Where in Italy?" "What region?" " Umbria." "Mount Subasio." "Dad's team will take care of the 1 2 in Zurich." "If they're going to Mount Subasio, I'll beat them to it." " Sydney." " You were right, Vaughn." "I can't give in to this idea that I'm powerless." " I can bring them down." " I know." "I was gonna say I'll go with you." "(helicopter)" "Vaughn!" "Vaughn!" "Over here!" "You'll have to lower me." " You sure about this?" " Yeah, I am." "I'll be tracking you." "(beeps)" "(beeps)" "(rumbling)" "Sydney." "You came." "Oh, I wouldn't do that." "The sound of one shot will trigger a cave-in." "You're coming with me." "Remember when you were a little girl and you came to live with Emily and me?" " I try not to dwell on it." " Sydney, you were so withdrawn." "We understood." "You lost your mother and your father was taken into custody." "Remember?" "We tried to reach out, but there was a time when that was impossible." "So we lined the shelves of your room - all of them - with stuffed animals... hoping that that would comfort you." "Every morning I would come into your room to wake you up." "There they were, buried underneath your blanket." "You said there was a storm in the middle of the night and it knocked them over." "They were drowning." "So one by one you rescued them." "Even then, I wondered when you would learn." "You can't rescue everyone." "I received word from Zurich." "The team's outside the building." " We're getting visuals soon." " We got a problem." "This is from Sloane's safe house." "Look at this." " A schematic of the L.A. subway system." " Data engineering analysis." "He's mapping architectural weaknesses of the tunnels around our facility." " Sloane's targeting APO." " Clear the building." "Tom, Dixon - organize a search team." "Sweep the tunnels." "Marshall, Rachel" " I want all civilians evacuated from the subway." " How do we do that?" " Call in a bomb threat." "(Sloane) I know Marshall gave you a message." "But it didn't matter because I accounted for everyone." "What do you mean, everyone?" "(Sloane) Prophet Five." "APO." "I had to remove those obstacles." " If you touch anyone else I love..." " The time for threats has passed." "Besides, even if I wanted to I couldn't stop it now." "Mr. Sloane couldn't make it, he sent me instead." "I'm making sure that this is going to happen." "That I'll see this through." "You, above all, should understand that." " There's no shying away from fate." " I don't believe in fate." "Be that as it may, I'm very glad you're here, Sydney." "I wouldn't want you to be there when it happens." "What have you done?" "(beeping)" "I found it." "It's big." "I never wanted you to suffer the way you did when you were a child." "The way you suffered when you lost Danny." "When you lost Vaughn." " How much longer till we're evacuated?" " They need five more minutes." " Can you disable it?" " Not without triggering the fail-safe." "The timer is a quartz oscillator." "I can slow it down, buy them the time." " Are you sure?" " I've got liquid nitrogen." " I can freeze the mechanism." " lt'll only buy you 20 seconds." " Not if I stay here and keep hitting it." " All right, do what you can." "But the second that timer dips below a minute, get the hell out." "Will do." " I'm assuming you have the amulet?" " Of course." "Sydney, I'm offering you a chance... to walk." " You know I can't do that." " You can only rescue yourself." "(sirens)" " Jack, what's the status on the evac?" " The civilians just made it out." " Good." " Don't lose your window." "Get up top now!" "OK." "Will do." "Hey, listen." " Patch me through to Rachel?" " Copy." " Tom, you need to get out." " Yeah." "Hey, Rachel..." "I wish there were more time." "I would've asked you out." "I would have said yes." "Hm." "A sky." "I'm sorry, Sydney, this isn't my choice." "You're not allowed to see this." "(children) Bad robot!" |
const path = require('path');
module.exports = {
entry: {
index: [path.resolve(__dirname, 'app.js')],
},
mode: 'development',
output: {
filename: 'output.js',
},
};
module.exports.serve = {
content: [__dirname],
add: (app, middleware, options) => {
// we need to manually call the webpack middleware since we're manipulating
// the static content middleware afterward. This preserves the typically
// correct ordering.
middleware.webpack().then(() =>
// pass desired options here. eg.
middleware.content({
index: 'index.aspx',
// see: https://github.com/koajs/static#options
})
);
},
};
|
John Bacon
USA TODAY
Development of a U.S. counterattack for cyberterrorism that could do more harm than good was one of the final events that drove Edward Snowden to leak government secrets, the former National Security Agency contractor tells Wired magazine.
Snowden, photographed for the story clutching an American flag, said the MonsterMind program was designed to detect a foreign cyberattack and keep it from entering the country. But it also would automatically fire back. The problem, he said, is malware can be routed through an innocent third-party country.
"These attacks can be spoofed," he told Wired. "You could have someone sitting in China, for example, making it appear that one of these attacks is originating in Russia. And then we end up shooting back at a Russian hospital. What happens next?"
Snowden, 31, also told the magazine he hopes to return to the U.S. someday.
"I told the government I'd volunteer for prison, as long as it served the right purpose," he said. "I care more about the country than what happens to me. But we can't allow the law to become a political weapon or agree to scare people away from standing up for their rights, no matter how good the deal. I'm not going to be part of that."
Snowden was a contractor for Booz Allen Hamilton when he leaked details of U.S. surveillance programs to The Guardian and The Washington Post. The first reports were published in June 2013, setting off an immediate global firestorm. Snowden, who was in hiding in Hong Kong at the time, fled to Moscow where he still lives.
His impact had staying power.
President Obama promised to scale back surveillance of American citizens. Germany ordered the CIA station chief out of the country. The Guardian and Post won the Pulitzer prize for public service for their coverage.
Snowden previously expressed interest in returning to the United States, but said he feared an unjust trial on charges of espionage and theft of government property could result in a lengthy prison sentence. He remains adamant that what he did was for the good of the country.
MonsterMind for example, he told Wired, could accidentally start a war. And it's the ultimate threat to privacy because it requires the NSA to gain access to virtually all private communications coming in from overseas.
"The argument is that the only way we can identify these malicious traffic flows and respond to them is if we're analyzing all traffic flows," he said. "And if we're analyzing all traffic flows, that means we have to be intercepting all traffic flows. That means violating the Fourth Amendment, seizing private communications without a warrant, without probable cause or even a suspicion of wrongdoing. For everyone, all the time."
It's an example of the breadth of NSA surveillance, he said. And everybody forgot about or simple ignored the rules.
"You get exposed to a little bit of evil, a little bit of rule-breaking, a little bit of dishonesty, a little bit of deceptiveness, a little bit of disservice to the public interest, and you can brush it off, you can come to justify it," Snowden told Wired. "But if you do that, it creates a slippery slope that just increases over time. And by the time you've been in 15 years, 20 years, 25 years, you've seen it all and it doesn't shock you. And so you see it as normal." |
Who will win the 2017 GTBL championship
Team Links
Jersey #: 77 Position(s): P Bats: R Throws: R Hometown: Toronto Profile: Jeff was outstanding again in 2016 for the Bulldogs. He earned a second team all star selection after going 3-1 and striking out 61 in just 31 innings. 2017 should be more of the same, as Jeff has been pretty dominating over a three year period. |
The Enemy At The Gates Has A New Weapon And Indian Army Needs To Wake Up
Over the last one month, there have been a number of reports of our security forces suffering casualties from sniper fire in Jammu and Kashmir (J&K). While sniping has been an ongoing feature of fighting on the Line of Control (LoC), alleged terrorist snipers have struck for the first time in the Valley and seem to have caught the security forces by surprise.
Intelligence reports indicate that two sniper pairs of Jaish-e-Mohammed have infiltrated into the Valley. Since September 2018, three kills in Kashmir’s interior have been attributed to terrorist snipers.
This has generated a lot of public interest, particularly in light of earlier reports about our troops suffering casualties from sniper fire on the LoC.
Making every shot count :
Sniping is one of the most cost-effective tactics in an insurgency, both for the security forces as well as the terrorists.
Based on intelligence, reconnaissance and observation, kills can be achieved at very long range. The world record is held by a Canadian sniper, who achieved an astounding 3,540-metre ‘kill’ in Iraq last year. Snipers are also used to shoot terrorists mingling with crowds in hostage situations, and during a firefight where the sniper is in an over-watch position.
Since snipers are highly skilled, they make every shot count. In Jammu and Kashmir, approximately 5,000 rounds are used to kill one terrorist. Snipers, on the other hand, take only 1.3 rounds to achieve a kill.
A sniper has to be physically fit, mentally robust, skilled at field-craft, and an exceptional marksman. He must be a master of camouflage, have the guile to bait the enemy and develop infinite patience to get the “sure shot”. The sniping duel in Stalingrad between Vasily Zaytsev (Russian Army) and Major Erwin König (German Army), immortalised in the movie Enemy at the Gates, is a classic example of the stuff snipers are made of.
A sniper must have the scientific temper to understand the external ballistics of the bullet at long range, which is influenced by a host of factors that include gravity, wind speed and direction, altitude, temperature, humidity, barometric pressure and centrifugal force. At long range, even a mild crosswind requires a significant “off set” of the aiming point away from the target, which has to be accurately calculated.
The prolonged specialised training and the relatively high cost of equipment deters terrorist organisations from training and using snipers. Short training capsules in field-craft, and skills to effectively use a weapon like the AK-47 at short range meet the requirements of terrorist outfits.
New dimension :
The reason for the likely change of tactics by the terrorists in Jammu and Kashmir is due to their diminishing numbers and inability to counter the effective security grid.
In my view, they are unlikely to use high-end sniper rifles with long range. What is more likely is the induction of “sharpshooters” who use a modern standard rifle like the US Army M4 rifle fitted with day and night vision telescopic sights to engage targets up to 500 metres. This would be a cost-effective alternative as, till now, terrorist attacks that involve the use of AK-47 are restricted to ranges of 20-50 metres.
A few personnel of the Special Service Group of the Pakistan Army, with sophisticated sniper rifles, could also be inducted. The use of “sharpshooters” and some snipers can be a game changer in the ongoing proxy war. The security forces would have to take additional preventive security measures for the “off set” threat.
This new dimension is a wake-up call for the Indian Army to field its own snipers, which are the best countermeasure against the enemy “sharpshooters”/ snipers, in a more effective manner. To the best of my knowledge, we have never killed a terrorist using a sniper. The situation at the LoC is no different.
We have nearly 5,000 Dragunov sniper rifles with an effective range of 1300 metres inour inventory at the scale of 10 per Infantry/ Special Forces/Assam Rifles/ Rashtriya Rifles Battalion. Reports have surfaced recently about the Indian Army starting the process of importing 5,000-6,000 modern sniper rifles for Rs 982 crore to replace the Dragunov sniper rifle. It is surprising that there seems to be no plan to induct specialist sniper rifles for ranges beyond 1500 metres.
Yawning gap :
Where then are our snipers? Why are we not effectively using them? The answer lies in the proverbial statement – it is not the gun but the man behind the gun that makes the difference. We have not been able to develop the requisite skills in our snipers. They are no more than “sharpshooters”, a little better than the average soldier but certainly not skilled snipers.
There is no specialist trade of “sniper”, but any above-average soldier after limited training wields the sniper rifle. Snipers lack specialised clothing and gear. Simulators are not available and training ammunition is inadequate.
The sniper course conducted at the Infantry School lacks quality. Very few of our snipers can pass the universal test of a sniper, which is to score a first round “head shot” at 600 metres and a first round “body shot” at 1,000 metres. If a sniper cannot pass this test, he cannot be called a sniper and remains a marksman or a sharpshooter.
What is the solution?
In my view, radical changes need to be made in our approach towards training of snipers. A specialised trade of “sniper” must be created. A core group of 100 snipers, after a selection based on international standards, must be trained in the sniper schools of western armies to create a pool of sniper instructors.
A sniper training school must be established and all snipers must be trained there. Refresher training must be organised at Corps Battle schools under sniper instructors. In addition to the standard sniper rifles, we must import specialised long-range sniper rifles for “super snipers”. We must also kit our snipers up with gear of international standards.
Unless these reforms are carried out, no matter what rifles are imported, we will continue to produce only “sharpshooters” and not snipers, and remain at the receiving end in the changed scenario in Jammu and Kashmir. |
Because ransomware attacks in the region are surging, India's Computer Emergency Response Team, or CERT-In, has issued an advisory offering tips on preventing ransomware infections and responding to attacks.
For example, CERT-In urges adoption of high-end encryption to protect backed-up data. It also says organizations should never pay a ransom because this doesn't guarantee release of the files, and it stresses the importance of reporting attacks immediately to law enforcement agencies.
Too many organizations still lack a proactive approach to complete recommended patches, adhere to alerts and take other steps to prevent an incident.
Ransomware attacks are affecting financial institutions, other businesses and academic institutions throughout India.
The most prevalent and destructive ransomware in India includes cryptolocker, TeslaCrypt, Locky and Cerber. Many attacks involve encrypting data and demanding a ransom, often in bitcoin, to decrypt it.
Among the recent ransomware attacks:
The Cosmos Bank website was attacked by Cerber ransomware. Quick Heal discovered the infection while analyzing telemetry information collected from its own users, and found the website was compromised by RIG Exploit Kit used as a carrier of Cerber ransomware.
The website of India's state-owned oil and gas company, HPCL, was compromised by a series of attacks by the pseudo-Darkleech campaign, which exposes users to Nemucod malware that, in turn, downloads Cerber ransomware onto their machines.
Kaspersky Lab reports that from March to May 2016 alone, 11,674 Indian individuals were attacked by TeslaCrypt ransomware and 564 by Locky ransomware.
Last year, three banks in India and a pharmaceutical company were victims of ransomware, with attackers demanding ransom in bitcoins for decryption keys.
A chartered accountant's office server was targeted by Cerber and the vector for attack was peer-to-peer software. C.N. Shashidhar, CEO at SecureIT, says ransomware infections on servers through peer-to-peer software are becoming widespread.
Steps to Take
CERT-In lists some remedial actions:
Perform regular backups of critical information to limit the impact of data or systems loss;
Check content of backup files of databases for any unauthorized encrypted contents of data records or external elements, such as backdoors/malicious scripts is critical;
Ensure integrity of codes/scripts used in database, authentication and sensitive systems;
Separate the administrative network from business processes with physical controls and virtual local area networks
In addition, many practitioners recommend investing in layered security that can help protect, detect and block ransomware attacks.
But do organizations take CERT-In advisories seriously? Do they really trigger preventive action?
Unfortunately, the impact of the advisories appears to be minimal. Too many organizations still lack a proactive approach to complete recommended patches, adhere to alerts and take other steps to prevent an incident. They just assume they will not fall victim.
About the Author
Nandikotkur is an award-winning journalist with over 20 years' experience in newspapers, audio-visual media, magazines and research. She has an understanding of technology and business journalism, and has moderated several roundtables and conferences, in addition to leading mentoring programs for the IT community. Prior to joining ISMG, Nandikotkur worked for 9.9 Media as a Group Editor for CIO & Leader, IT Next and CSO Forum. |
[Cognitive-behavioral group treatment of panic attacks disorder: a description of the results obtained in a public mental health service].
This article describes the short-term and at 6 months follow-up results of an intensive cognitive-behavioural group treatment on subjects affected by Panic Disorder with or without Agoraphobia (DSM IV criteria). We studied a group of 22 subjects treated in the public Centro Psico Sociale of Zogno (Bergamo) and valuated them with self-rated instruments inherent the life satisfaction (SF/36) and symptoms andament (PAAAS; MSPS, STAI-X1, STAI-X2). The results indicate significant improvements at the end of treatment and at a 6 months follow up. We are studying the long-term results with others follow up valuations. The most important results, anyway, is the demonstration that also in an Italian public mental health centre, as in many foreign countries, is possible to treat patients affected by Anxiety Disorders with effectual and relatively low cost techniques and that is possible to introduce objective results indicators in the routinary clinical activity. |
New Foreign Hero Emerges In Times Square Car Bomb Case
Forget about the street vendors who first contacted the NYPD during the attempted SUV bombing in Times Square—including the immigrant from Senegal not worthy of a phone call from President Obama—America has a new hero: Emirates Airlines. CBS News correspondent Bob Orr reports how the airline was instrumental in helping authorities apprehend Faisal Shahzad by contacting Homeland Security to alert them about a passenger who purchased a “last minute” one way ticket to Dubai in cash. UPDATE: Or maybe not. |
Q:
how to get a user confirmation in the middle of a transaction?
I've been working on a transactional services which is used as a part of core banking project. In many services, before inserting any records in my database, I should run several validation on the records. It is also true for editing the records which are already exist in the database.
But sometimes in order to update a record in an specified table, we should change records in other tables which are related to the specified table. Consequently, we need a user confirmation to change records on other tables. But the problem is I don't know how could I get a user confirmation in client while I run a transaction in the server. Is it possible to tackle this problem using sending message between client and server through rabbitMq?
I will be appreciate if any one explain any solution using clear sample.
A:
When I would need to implement this, I would do it in an other way (I do not know if this works for your scenario).
I would first let the user input his data,
then I would do a try run and check which additional confirmations are needed I would also save (in the user session) all relevant constraints that are determined while the try run
then I would ask the user for the additional confirmations determined while the try run
then I would do the real-run, and use the saved constraint checks to be save that nothing relevant has been changed meanwhile.
(If there is a relevant change in the data between try- and real-rung detected, I would apologise and start the process with step 2 again)
but this only works if you do not have so many "meanwhile changes"
|
China and the U.S., the world’s two largest economies, have been quarreling over trade for months, engaging in a tit-for-tat tariff battle and intermittently frightening investors with the prospect of a full-blown trade war. But the macroeconomic fallout from a worsening of trade relations might not be as severe as feared, according to Capital Economics.
In the most recent tit-for-tat developments between Beijing and Washington, President Donald Trump could proceed with import tariffs on some $200 billion more Chinese goods that could be announced as early as this week. China has meanwhile said it wouldn’t negotiate under threat, according to The Wall Street Journal. Last week, reports said China would seek permission from the World Trade Organization to impose sanctions on the U.S. as part of a separate dispute.
And while investors are worrying about the possible fallout that could hit companies, whole sectors, such as electronics or agriculture, and other countries caught in the crossfire, the macroeconomic implications for the U.S. and China appear limited, according to chief global economist Andrew Kenningham.
He offers five reasons why.
First, as long as “fiscal policy is not tightened, tariffs do not necessarily reduce aggregate demand,” wrote Kenningham, adding that it might redirect trade flows to other countries in response to the tariffs rather than eliminate the demand.
Second, global trade volumes would likely not just drop off either.
“The elasticity of demand for most Chinese exports is quite low, and many U.S. exports to China could be redirected,” Kenningham said. On top of that, a sizable chunk of U.S. sanctions on Chinese imports have been offset, at least in part, by a weaker Chinese yuan USDCNY, +0.15% USDCNH, +0.02% against the U.S. dollar DXY, +0.04% . Indeed the dollar-yuan pair is up around 5.5% in 2018 so far, and almost 5% over the past 12 months, according to FactSet.
Read:Case for dollar bulls intact ahead of central bank meetings
Third, exports don’t account for that much of gross domestic product for either country.
Although both the U.S. and China rely on trade, they are “fairly closed economies,” as Kenningham calls it. Exports accounted for roughly 20% of China’s GDP last year, down from 36% in 2006, he cites.
For the U.S., this share is even lower, as shown in the chart below, with exports only accounting for 12% of GDP.
Capital Economics
Fourth, bilateral trade between the two countries contributes an even smaller amount to GDP. For China, U.S. trade contributes some 2.5% to GDP, while it is only 1% for the U.S. in reverse.
“If this trade fell by 20% — which is more than we expect — the direct hit to their GDP would be 0.5% or 0.2%, respectively,” Kenningham argued. Hardly a reason for panic.
Fifth, neither U.S. nor Chinese inflation should be impacted much by all of the above. And as consumer prices are a key metric for central bankers, it means that monetary policy would also be less likely to be impacted by a trade war.
“It may seem counterintuitive that a trade conflict between the world’s two largest trading economies would have only a small impact on the global economy,” Kenningham said. “But while China and the U.S. account for a combined 22% of world exports, bilateral trade between them accounts for just 3.2%,” he said, adding that protectionism would have to spread far beyond just U.S.-China trade to impact global GDP growth.
Capital Economics
That might explain why at least U.S. investors, despite the occasional knee-jerk reaction to trade-related headlines or presidential tweets, have largely kept trade fears on the back burner. The S&P SPX, -2.37% moved back into record territory in August and is up more than 8.7% in the year to date, while the Dow industrials DJIA, -1.92% are up 5.8%.
Chinese stocks, however, have suffered, along with other emerging markets and global stocks outside the U.S. in general. Hong Kong’s Hang Seng Index HSI, -1.96% , of which 50 components are mainland Chinese companies, fell into a bear market last week Tuesday, ending more than 20% down from its Jan. 26 high and meeting the common definition of a bear market.
Read:The new fear for stock investors is an emerging-market meltdown
The Shanghai Composite SHCOMP, -1.65% fell into bear territory in June, while the MSCI emerging-markets index, tracked by the iShares MSCI Emerging Markets ETF EEM, -1.55% dropped into bear territory two week ago.
See:Here’s how dramatically U.S. stocks are dominating emerging markets this year |
Verizon reported quarterly earnings on Tuesday that missed expectations, but revenue that topped estimates.
"Verizon will announce later today how employees will further share in the company's success, and the company will also be increasing contributions to the Verizon Foundation by $200 million to $300 million over the next two years," the company said in a statement. "These two initiatives have a projected EPS impact of 5 to 6 cents for each of the next two years."
Verizon also hinted that an employment announcement is on the way.
That means that Verizon's earnings are about flat, but sales are up slightly from last year. A year ago, Verizon reported adjusted earnings of 86 cents per share on revenue of $32.3 billion.
Like many American companies, Verizon is dissecting the recent U.S. tax overhaul. Scotiabank analyst Jeff Fan pointed to tax reform as a potential positive for the company on Monday.
The company expanded on that on Tuesday, revealing that it expected savings from tax reform will add $3.5 billion to $4 billion to its operating cash flow this year, boosting earnings by 55 to 65 cents a share for the full year. That's on top of a previously announced one-time increase of about $16.8 billion under the new tax scheme.
But it comes as the company is expecting low single-digit percentage growth in adjusted earnings in 2018, after a slew of acquisitions and divestitures aimed at transforming the company. Verizon, like its rivals, is grappling with how to transform its phone-based service into a data-and-internet focused product.
Verizon added a net of 47,000 Fios Internet connections but lost a net of 29,000 Fios Video customers as streaming offerings like Netflix gain popularity.
More consumers are moving away from contracts and hopping providers based on the latest mobile phone offerings. Eighty percent of Verizon's main phone base is now on unsubsidized plans, compared with about 67 percent in the year-ago period.
This holiday shopping season was unusual in that regard, since Apple released its flagship phone later than usual, but telecom providers have wooed customers with perks such as international data.
Nonetheless, CEO Lowell McAdam emphasized his customers' loyalty, noting that the company has managed to hang on to many of its customers over the past 11 quarters. Verizon said on Tuesday it expects to hit year-over-year wireless service revenue growth, on an adjusted basis, by the middle part of 2018.
Wall Street has cast Verizon as a potential merger candidate amid a flurry of dealmaking and consolidation in the industry, including tie-ups at Time Warner and Disney and off-and-on talks between Sprint and T-Mobile. But McAdam reaffirmed on Tuesday that Verizon will not be seeking a large media merger.
While "it's nice to be loved," McAdam said on an earnings conference call with analysts, "there is nothing going on" with Verizon as far as media acquisitions.
The company now has Oath, a digital content and advertising arm that includes Yahoo and AOL, and is planning to roll out 5G broadband this year. The 5G rollout will be part of $17 billion to $17.8 billion in capital expenditures planned for the year.
Earlier this month, Verizon announced the acquisition of Niddel, a cybersecurity company. The new company will join Verizon after disclosures of breaches at Yahoo that affected billions of customers over the past few years.
Oath revenues were $2.2 billion during the quarter.
Disclosure: CNBC has a content-sharing agreement with Yahoo Finance.
— CNBC's Kevin Breuninger contributed to this report. |
Q:
Mixed Base Conversion
Background
Most people on here should be familiar with several base systems: decimal, binary, hexadecimal, octal. E.g. in the hexadecimal system, the number 1234516 would represent
1*16^4 + 2*16^3 + 3*16^2 + 4*16^1 + 5*16^0
Note that we're usually not expecting the base (here, 16) to change from digit to digit.
A generalisation of these usual positional systems allows you to use a different numerical base for each digit. E.g. if we were alternating between decimal and binary system (starting with base 10 in the least significant digit), the number 190315[2,10] would represent
1*10*2*10*2*10 + 9*2*10*2*10 + 0*10*2*10 + 3*2*10 + 1*10 + 5 = 7675
We denote this base as [2,10]. The right-most base corresponds to the least significant digit. Then you go through the bases (to the left) as you go through the digits (to the left), wrapping around if there are more digits than bases.
For further reading, see Wikipedia.
The Challenge
Write a program or function which, given a list of digits D an input base I and an output base O, converts the integer represented by D from base I to base O. You may take input via STDIN, ARGV or function argument and either return the result or print it to STDOUT.
You may assume:
that the numbers in I and O are all greater than 1.
the I and O are non-empty.
that the input number is valid in the given base (i.e., no digit larger than its base).
D could be empty (representing 0) or could have leading zeroes. Your output should not contain leading zeroes. In particular, a result representing 0 should be returned as an empty list.
You must not use any built-in or 3rd-party base conversion functions.
This is code golf, the shortest answer (in bytes) wins.
Examples
D I O Result
[1,0,0] [10] [2] [1,1,0,0,1,0,0]
[1,0,0] [2] [10] [4]
[1,9,0,3,1,5] [2,10] [10] [7,6,7,5]
[1,9,0,3,1,5] [2,10] [4,3,2] [2,0,1,1,0,1,3,0,1]
[52,0,0,0,0] [100,7,24,60,60] [10] [3,1,4,4,9,6,0,0]
[0,2,10] [2,4,8,16] [42] [1,0]
[] [123,456] [13] []
[0,0] [123,456] [13] []
A:
CJam, 45
q~_,@m>0@{@(:T+@T*@+}/\;La{\)_@+@@md@@j@+}jp;
Finally I found a good use of j.
How it works
Long ArrayList Block j executes the block which takes an integer as the parameter, and Long j will call this block recursively in the block. It will also store the values returned by the block in an internal array, which is initialized by the array parameter. It will not execute the block if the input is already in the array, and the value in the array is returned instead.
So if I initialize it with an array of an empty array, the empty array will be returned for input 0, and the block will be executed for any other input.
q~_,@m>0@{@(:T+@T*@+}/\; " See below. Stack: O decoded-D ";
La " Initialized the value with input 0 as empty list. ";
{
\)_@+@@md@@ " See below. Stack: remainder O quotient ";
j " Call this block recursively except when the same quotient has
appeared before, which is impossible except the 0.
Stack: remainder O returned_list ";
@+ " Append the remainder to the list. ";
}j
p; " Format and output, and discard O. ";
CJam, 49 48
q~_,@m>0@{@(:T+@T*@+}/\;{\)_@+@@md@@}h;;_{}?]W%`
Input should be O I D.
Examples:
$ while read; do <<<$REPLY ./cjam-0.6.2.jar <(echo 'q~_,@m>0@{@(:T+@T*@+}/\;{\)_@+@@md@@}h;;_{}?]W%`');echo; done
[2] [10] [1 0 0]
[10] [2] [1 0 0]
[10] [2 10] [1 9 0 3 1 5]
[4 3 2] [2 10] [1 9 0 3 1 5]
[10] [100 7 24 60 60] [52 0 0 0 0]
[42] [2 4 8 16] [0 2 10]
[13] [123 456] []
[13] [123 456] [0 0]
[1 1 0 0 1 0 0]
[4]
[7 6 7 5]
[2 0 1 1 0 1 3 0 1]
[3 1 4 4 9 6 0 0]
[1 0]
""
""
How it works
q~ “ Read the input and evaluate. ";
_,@m> " Rotate I to the right by the length of D. ";
0@{ " For each item in D, with the result initialized to 0: ";
@(:T+ " Rotate I to the left, and set the original first item to T. ";
@T*@+ " Calculate result * T + current. ";
}/
\; " Discard I. ";
{ " Do: ";
\)_@+ " Rotate O to the right, and get a copy of the original last item. ";
@@md " Calculate divmod. ";
@@ " Move O and the quotient to the top of the stack. ";
}h " ...while the quotient is not 0. ";
;; " Discard O and the last 0. ";
_{}? " If the last item is still 0, discard it. ";
]W% " Collect into an array and reverse. ";
` " Turn the array into its string representation. ";
A:
CJam, 62 61 59 57 bytes
q~Wf%~UX@{1$*@+\@(+_W=@*@\}/;\;{\(+_W=@\md@@}h;;]W%_0=!>p
Reads the input arrays as [O I D] from STDIN. Try it online.
How it works
q~ " Read from STDIN and evaluate the input. Result: [O I D] ";
Wf%~ " Reverse each of the three arrays and dump them on the stack. ";
UX@ " Push U (0) and X (1); rotate D on top of both. ";
{ " For each N in D: ";
1$* " N *= X ";
@+ " U += N ";
\@(+ " I := I[1:] + I[:1] ";
_W=@* " X *= I[-1] ";
@\ " ( U I X ) ↦ ( I U X ) ";
}/ " ";
;\; " Discard I and X. ";
{ " R := []; Do: ";
\(+ " O := O[1:] + O[:1] ";
_W=@\md " R += [U / O[-1]], U %= O[-1] ";
@@ " ( O U R[-1] ) ↦ ( R[-1] O U ) ";
}/ " While U ";
;;] " Discard U and O. ";
W% " Reverse R. ";
_0=!> " Execute R := R[!R[0]:] to remove a potential leading zero. ";
p " Print a string presentation of R. ";
Test cases
$ cjam mixed-base.cjam <<< '[ [2] [10] [1 0 0] ]'
[1 1 0 0 1 0 0]
$ cjam mixed-base.cjam <<< '[ [10] [2] [1 0 0] ]'
[4]
$ cjam mixed-base.cjam <<< '[ [10] [2 10] [1 9 0 3 1 5] ]'
[7 6 7 5]
$ cjam mixed-base.cjam <<< '[ [4 3 2] [2 10] [1 9 0 3 1 5] ]'
[2 0 1 1 0 1 3 0 1]
$ cjam mixed-base.cjam <<< '[ [10] [100 7 24 60 60] [52 0 0 0 0] ]'
[3 1 4 4 9 6 0 0]
$ cjam mixed-base.cjam <<< '[ [42] [2 4 8 16] [0 2 10] ]'
[1 0]
$ cjam mixed-base.cjam <<< '[ [13] [123 456] [] ]'
""
$ cjam mixed-base.cjam <<< '[ [13] [123 456] [0 0] ]'
""
Note that empty strings and empty arrays are indistinguishable to CJam, so []p prints "".
|
kid friendly floors – linoleum flooring
Linoleum Flooring
Linoleum floors are not only durable and allergy resistant (hypoallergenic), they are also environmentally friendly.
Linoleum floors are made from natural resources that are
recyclable and sustainable*. Start your kids out on a lifetime of green living by choosing linoleum floors for your home.
*Sustainability refers to products made from renewable and nearly inexhaustible resources.
Pros
Durable, hard surface resists most scratching
Most spills are easy to wipe up
Hypoallergenic qualities make linoleum a good choice for kids with allergies
Antimicrobial (resistant to mold, fungi and bacterial growth)
Environmentally friendly
Can be relatively warm underfoot
Antistatic
Offers a wide range of design options to suit a variety of living
spaces
Cons
Linoleum flooring can't be refinished, only replaced
A smooth finish may make for a slippery surface
Although durable, can still be scratched or gouged
Kid–Safe Flooring Tips – Linoleum Flooring
Immediately clean up all spills, dirt, and debris
If installing click–and–lock linoleum flooring, protect the subfloor with a moisture barrier or underlayment
such as cork or foam rubber |
Q:
Couchbase : querying with Nickel using indexes, but the indexes do not get updated immediatel
I am facing a problem here I am querying Couchbase using Nickel and my query is
SELECT *
FROM `user`
USE INDEX (ord_ts_new_idx USING GSI)
WHERE META(`user`).id LIKE 'ord::27::%'
ORDER BY ts DESC
OFFSET 0 LIMIT 5;
But here the value that I am getting is not updated, But If I make the same request after sometime It gives me the desired output.
The query that I have used for making the INDEX is
CREATE INDEX ord_ts_new_idx ON `user-account`(`ts`) USING GSI;
where ts is the TimeStamp.
So could you please tell me if there is a way in which, I can get the updated data always?
Thanks in advance. Any type of help is appreciated.
A:
You do not mention which SDK you are using, but client SDK are you using? N1QL provides a scan_consistency parameter, so it's a matter of making sure your client SDK uses this. So go here and find your language of choice. For example, here is the Java SDK section, look under "read your own write."
Just be forewarned that by doing this for everything, you could very well take a performance penalty as the index will need to be refreshed before serving your results. So make sure you test this please.
|
Happy Halloween – Spooky Squash Recipe Selection
Squashes and pumpkins are part of the same family, along with the lesser known gourds. In general a pumpkin is something you carve, a squash is something you cook and a gourd is a bit of an ornament. But it’s not that simple, there’s also squash-type pumpkins and pumpkin-squashes – so ‘scuse us while we use the names interchangeably in our writing, speech and cooking!!
If your Jack O Lantern looks decent enough – not too stringy and watery inside – then make good use of that veg and cook it up to avoid waste. We love pumpkin in curries and soups but it’s natural sweetness also lends itself nicely to puddings and pies. Don’t have a decent pumpkin to hand? Use our favourite squash, the versatile butternut, instead – easier to get into with a sharp knife and vegetable peeler – steam it, roast, it mash it, or enjoy it au natural, no cooking required… |
2019: Thanksgiving Recipe Thread
Wheatie’s pies reminded us it is time for the annual Thanksgiving Recipe Thread. Please add your favorites and drop a few stories in from your favorite holiday get-togethers.
My Mother’s mother had a saying, “May I always have more guests, than I do dining room chairs.” Remember those who have no family and please, make room at your table.
The stories which come out of the family holidays are wonderful. Here’s a few from our house.
Story #1
I was a teenager. Dad was dating my soon-to-be stepmother and it was obvious the two would marry. We lived in New Orleans. We had been to her parents for weekends (Pensacola) and she had been to my grandparents for weekends (northern Mississippi), but the two sets of potential in-laws had not met. Thanksgiving at Grandma’s was the first meeting of the clans.
The Florida contingent arrived on Wednesday, scheduled to leave Friday morning, apprehensive, best to plan a short trip. On Wednesday, everyone was on their best behavior, no one drank too much, no one swore. My step-mother turns into an infant around her mother, different speech patterns, annoying. Lots of tension in the air. My grandmother was nervous and doing her best to make a good impression. I was cast out to sleep on the couch in the living room.
All the way through Thursday the tension grew. After a day of football, hors d’oeuvres, and afternoon drinks, it all came to a head as we were ready to serve dinner. Everyone was in the kitchen, trying to help Grandmother pull casseroles, ice in the glasses, pour the wine, and find serving pieces. She was trying to use the best china and insisted Grandpa carve, then place, the turkey onto a beautiful antique china platter. A bit of a scuffle ensued as we all organized dishes to the buffet.
Grandpa needed a bigger platter for the turkey. Grandma wanted to use the pretty platter. Finally, as they negotiated, Grandpa became frustrated, pointed his electric knife at my Grandmother and said, “It’s not big enough for a fuckin’ quail.”
The electric knife we only used once a year.
Silence. Grandpa dropped the F bomb. Time stood still. My eyes went wide as I looked around the room to gauge reaction. Grandma was clubbing Grandpa with a wooden spoon, using a distressed voice, “Ea—rl”, always two syllables for Earl. Ray, my step-grandfather was a former Chief Petty Officer in the Navy. He had a highball glass in his hand and spit out his bourbon all over the microwave. Tension broken. Everyone laughed. Grandpa and Ray became fast friends.
Story #2
Grandpa Ray, the Chief Petty Officer, lit up my world. I loved him. He took me everywhere and didn’t treat me like a kid. His wife was spoiled, nouveau riche, and spent money like water. Ray would give her envelopes filled with $100 bills so she and my step-mother could go shopping. I didn’t like it – seemed wrong. Ray had accumulated several little houses which he rented out to sailors. Ray drove a little pickup truck with a cab filled with house parts. He was the landlord and always fixing something. One Wednesday before Thanksgiving, he let me tag along on a housecall. Probably a leaky faucet, or so I thought.
First, we stopped at the grocery store. He insisted I grab a cart, and he had one, too. No explanation. We moved quietly through the aisles, tomato soup, boxed mac and cheese, saltines, canned vegetables, loaves of bread, hams, turkeys, ground meat, …… and then diapers, and baby formula….. and even dog food and cases of Budweiser beer. We had no babies or dogs. What was he up to? He paid the bill at checkout, over $400. I could barely swing my laden cart.
At the truck, he divided up what we bought, and we were ready to go. Back in the truck, he asked me to open the glove box. He had a stash of white envelopes there, the same white envelopes he gave his wife. He pulled a wad of bills out of his chest pocket. Each envelope was to contain 4-$20 bills and 20-$1 bills. He winked at me, “Sometimes, it’s hard to break a $20.” I nodded, “Yes, Sir.”
We were off again. Twelve stops, to “his men”. He whistled along the way. He was happy. At the first stop, I got out of the car and headed up the walkway to ring the bell. He stopped me, “Nonono, we’ll go around back.” I paused and waited for him. Each “delivery” was made to the back door, quietly, privately, as not to embarrass another man. He tucked the cash envelope into the screen door. Never said a word to the people who lived there. After the first delivery, I sat in the car and looked at him… differently, with tears in my eyes. He winked at me. He was having fun, “Gotta take care of your men.”
By the 3rd-4th visit, we were met at the backdoor by a guy with a gun. It was one of “his men”. He apologized profusely, broke into thanks and finally, tears. He hugged Ray tightly, and I could feel the tears sting my eyes. $100 was a lot of money back in the 70’s. Later on, we ran into another wife, three little ones at her knees, who immediately broke into tears. As we returned home, my step-mother and his wife returned from their shopping. They showed us all their new clothes, modeling for Ray. He nodded like nothing ever happened. I took my cue from him. Our trip was our secret.
Funny, that year, I don’t even remember what we ate for Thanksgiving Dinner.
Today, we don’t use as much cash, but every now and then, a $100 bill will cross my path, and I think of Ray. As a nod to Ray, when Gunner was little, in his Christmas stocking, I would roll up 20-$1bills with a little ribbon around each one. As a kid, he felt rich. When he was about 12yrs old, he asked me why I didn’t just use a $20 bill. He was annoyed with all the tiny ribbons. I explained the story of Ray and added, “Sometimes, it’s hard to break a $20.” Lesson learned. Be thankful, appreciative, humble, and “Gotta take care of your men”.
My children are not fond of the traditional turkey and dressing, baked ham, sweet potatoes, green bean casserole, pumpkin pie, etc. meal for Thanksgiving or Christmas…and now it’s usually just Sally and me – so I usually go with seafood.
Here is one of her favorites:
Cajun Eggplant Shrimp Boats
Can also add crab meat, which makes it doubly delicious!
“The French call eggplants “Aubergines”, but Cajuns call them “Brahams”
OPTIONAL – If you want to make this spectacular, dip the eggplant shells in egg and breading mix and deep fry before filling like one Athens GA restaurant did. I never do because of not having a deep fat fryer now.
We used to soak the eggplant in salt with a weighted dish until we discovered if you buy “male” eggplant, they are sweeter with less seeds and no bitter taste. To tell the difference the male has a round indention on the bottom and the female has an elongated indention on the bottom. I never buy females anymore. If you grow your own don’t pull off all of the female flowers or it won’t grow fruits.
I keep looking at this… it looks yummy. I might try it with a giant zucchini next year as hubby doesn’t care much for eggplant. It seems like there’s ALWAYS a zucchini or two that magically turns into a giant over night!
Reminder —- Thanksgiving season is suitcase season!
Let me tell you why.
Years ago, girlfriend of mine named Ginger showed up one morning while I was finishing breakfast for guests. She was catching up, and I hadn’t seen her since she took a job with Child Protective Services. She was standing in my kitchen, smoking up a storm, when she asked me for a favor.
Ginger: Hey Daughn, do you have some old suitcases you’re not using, that I can have?
Me: With my back to her, still washing pots, “OOoo, where are you going? What do you need my suitcases for?”
Ginger: “Oh, it’s not for me. Sometimes, we have to pick up kids and remove them from a home. I had to do one last night and it’s tough. We have to accumulate some of their clothes and maybe a few toys, and we usually have to put them in trash bags…………. I just don’t want them to feel like ………… trash.”
Weight of her words washed over me.
Gunner was still little at the time.
Me: Still at the sink, grabbed the edge of the sink and then sunk to my elbows with the realization. I could feel the tears stinging my eyes. I turned around slowly to Ginger, “What did you say?”
She sat down on the stool to explain, and I dried my hands. She told me about what happened last night with this specific child. It was awful.
Well, off we went to the attic and I found 8 suitcases in various shapes and sizes. We loaded her minivan and she was off. As she hugged me good-bye, she thanked me and said, “This is great….. this should get us through the week………….” She shut the door and left me dumbfounded.
What? There were about 8 kids a week? To Ginger, it had become typical. I was mortified.
I climbed the back steps slowly, thinking, trying to wrap my head around the idea that there were 8 kids a week taken out of their homes in my own community. What to do?
I sat down and wrote out a letter, and blasted (by fax back then) a few of the local banks. It went: “Hey, this is Daughn, I need your help. Ginger in the kitch……explained the situation. Appeal for broader help…… and since this is Thanksgiving Season, and many of us are traveling, while your packing your suitcases, please take your old ones to ……. address. Closed with thanks for our healthy and happy homes…. because many of us are not so fortunate.” It was a nice letter straight from my heart.
Well, the letter went from the banks to the churches, and within 48 hours, Ginger had over 400 suitcases. She called me to tell me “Stop, we don’t have enough space to put them.”
Local paper did a small write up and a funny thing happened. Six other counties adopted the same plan. It was simple part of an enormously complex problem. Suitcases.
So now, every Thanksgiving season, we have a suitcase drive. God Bless our simple homes, and may we all be forever grateful for what we have.
One of my careers, (the bad one), was with a State “Human Services” agency. I didn’t take the kiddos but worked in the department next to theirs. Yes, it’s hard for a kid-person to fit their things into one suitcase.
Let me tell you, it’s a lot worse when you’re lugging everything in a black 30-gallon trash bag, with or without the drawstring tie.
The suitcase is much better, by an order of magnitude. I know. Thanks for writing Daughn, from my thanksgiving heart.
Daughn – thank you for all your beeee-you-tea-full stories – full of you, your wonderful family and wisdom and humor as Southern and proper as a tall glass of sweet tea with mint and lemon the way my Georgia and Louisiana Grandmothers served it!!!
Place the gelatin, sugar, eggs, salt and water in a small saucepan, and beat until smooth. Cook, stirring constantly, over moderately low heat until the sugar and gelatin dissolve and the mixture thickens slightly, about 5 minutes. Do not boil or the mixture may curdle. Remove from the heat and set in a large pan of cold water. Let the gelatin mixture cool to lukewarm, stirring occasionally. Beat in the pumpkin, then the cinnamon, ginger, nutmeg and allspice. Refrigerate, uncovered, for 15 minutes, then fold in the dessert topping. Spoon into a large serving bowl or into 6 to 8 individual dessert dishes. Cover with plastic food wrap and refrigerate for 4 hours or overnight. Serves 6 to 8.
1. Preheat oven to 325 degrees F. Butter two 9-inch round cake pans, line with parchment or waxed paper, and butter and flour the paper, shaking out the excess.
2. In a bowl, sift the flour, baking soda, and salt.
3. In a bowl with an electric mixer, beat the butter until combined, add the sugar, a little at a time, and beat the mixture until light and fluffy. Beat in the eggs, orange zest, and vanilla. Beat in 1/3 of the dry ingredients alternately with 1/2 of the buttermilk until combined well. Add half the remaining dry ingredients and the remaining buttermilk and beat until combined well. Finally, beat in the remaining dry ingredients until mixture is smooth.
4. Evenly divide the batter between the pans, smooth the surface, rap each pan on the counter to expel any air pockets or bubbles, then transfer to the oven. Bake for 45 minutes or until a cake tester inserted in the center comes out clean. Transfer to racks and cool in the pans for 20 minutes.
To Make the Orange Syrup:
5. Meanwhile, make the orange syrup: In a bowl, stir together the orange juice and sugar until sugar is dissolved.
6. With a toothpick or wooden skewer, poke holes at 1/2-inch intervals in the cake layers and spoon the syrup over each layer, allowing the syrup to be completely absorbed before adding the remaining. Let layers cool completely.
To Make the Filling:
7. In a small saucepan set over moderate heat, heat the marmalade until just melted. Let cool 5 minutes.
To Make the Frosting:
8. In a bowl, whisk the heavy cream with the sugar until it forms firm peaks. Add the sour cream, a little at a time, and whisk until of spreading consistency.
To Assemble the Cake:
9. Arrange one of the layers on a cake plate, carefully peel off the waxed paper, then spread 2/3 of the marmalade over the top, smoothing it into an even layer. Invert the remaining layer onto the top of the first layer, peel off the waxed paper and spoon the remaining marmalade onto the center of it, leaving a 1 1/4-inch border around the edge. Frost the sides and top of the border with the frosting, leaving the marmalade on top of the cake exposed. Or if you prefer, frost the entire cake, adding the marmalade as a garnish on top. Chill for at least 2 hours before serving.
1988 – I was sitting in my apartment in Miami, not able to go home for Thanksgiving. Depressed and missing the idea of Turkey, I flipped on a Martha Stewart Thanksgiving Special on PBS. It changed my world. She went through the steps on how to properly cook a turkey. I watched closely. Wanting to try out the idea, I invited workmates to Thanksgiving dinner at my little apartment……. and we haven’t had a dry turkey since 1988.
Here’s what you do.
Guaranteed win, impossible to fail.
Defrosted turkey, remove livers and neck and wash thoroughly in a CLEAN sink.
Place in a roasting pan, breast side up.
With your fingertips, work your fingers between the meat of the turkey breast and the skin. Tip the turkey up and pour in about 1/4 bottle of a good white wine, into each side, 1/2 bottle in total.
Mix up the herbs/salt/pepper, grab a handful and smear the turkey breast between the skin and meat. Both sides.
Cut up ONE stick of butter into about 12 pats. Slice up the oranges and lemons. Between the skin and breast meat, alternate a pat of butter with lemon or orange slice, butter, citrus slice. Keep going until both sides are filled and stuffed.
Place the quartered onion, apple, and any extra citrus, into the gut of the turkey.
Take the extra salt/pepper/herbs and smear all over the top and legs of the Turkey, then PAM the crap out of the bird. Only use PAM (others have alcohol) and you will get that golden brown color from magazines. I cook at about 300-325 for about 4 hours and use a meat thermometer………. but even if you forget about the turkey, you can’t screw this one up.
When it’s done, remove from oven and let it sit for about 15 minutes before slicing. Important to stabilize the juices. It’s fabulous.
Footnote: Over the years, we’ve stuffed turkeys in the same way with various combinations. Champagne and cranberries is particularly good but makes the turkey meat pinkish. We’ve tried beer and Cajun mixes. Nothing, however, is as good as regular roasted Turkey.
Reminds me of a thing from Ralph Brennan’s Jazz Kitchen at Disneyland — clean up a chicken breast, do an egg wash, wrap it in prosciutto, do another egg wash, and coat with seasoned bread crumbs. Makes every dish with “another breaded chicken breast” into something special.
If you have a home with any land, you should have a potager with edible herbs.
Soon afterward, you will discover that most common garden herbs are, in fact, weeds — and grow like the dickens. [I was once listening to a radio program where biologists were poking around Central Asia looking for ancestral apple trees. As they were hiking from one tree to another, one said, “y’know, this groundcover seems strangely familiar……” The other laconically replied, “it’s arugula.”] All modern herbs once grew naturally someplace, and have merely been coopted into travelling with us.
Anyone with a couple of rosemary plants can have a “spring trim” which provides for a number of spring and summer barbecues and smokers……and a “fall trim” which goes to Thanksgiving. Same goes for sage. Over the years I’ve generally stuffed the bird’s cavity with herb trimmings, as well as using some in the pan.
There is generally a call for some dressing to serve with the bird. I’m lazy, so I generally just start with a box of Stove-Top Stuffing — not that I would serve that to anyone if merely prepared per the instructions. I add dried savory, dill, parsley, minced-onion, rubbed sage, and powdered garlic, as well as anything else that strikes my fancy (especially if echoing other dishes). Then, on the liquid side, they say to add water……what they really mean is to add that amount of fluid…..which consists of 30% white wine, 50% chicken stock, and 20% water. Do not increase the amount of fluid to rehydrate the herbs — if anything, reduce the fluid if you’re using fresh herbs.
Forgot to note — for the outside of the bird, I generally have herbs and garlic in melted butter cut with olive oil that I brush on. But having the inside of the bird packed with herb trimmings is the best part. And I second the motion to start your gravy by having butter and white wine in the pan. Once you fish out the cooked herbs, and strain the pan drippings, you’ll be well on your way……
No Fail Mashed Potatoes for a crowd.
Ingredients: 5lbs peeled and skinned white potatoes, the cheaper ones. Nothing special, buy in a bag.
2 sticks of butter (I use Unsalted butter all the time – if you have salted butter decrease the added salt)
about 12ounces of sour cream
2tsp of salt
1/2 tsp of pepper
(NO MILK – forget the milk.)
Peel potatoes and place in a stock pot covered with water, boil until fork tender. My stove takes 20 minutes. Drain in a colander. Place potatoes in a mixer.
Add ONE stick butter, quartered to melt faster, sour cream, salt and pepper.
Go slowly, mix but don’t kill it, overmix, and turn to soup.
Dump all the mashed potatoes into a “PAMMED” (“to Pam” is a verb in our house) casserole dish. Cut up the other stick of butter and use about 6TBSP to dot the top.
Stick the whole thing in a microwave – UNCOVERED. (If you cover the potatoes, the steam condenses and comes back to the potatoes, making them soupy – I’ve killed my fair share of potatoes)
When you’re ready to serve, microwave the mashed potatoes for 4 minutes on high, blend in pan. Steamy hot mashed potatoes, every single time, and no worries about one dish being ready way before others are ready. Makes it easy on the cook.
Garnish with Chives if you have them, but your husband will eat these mashed potatoes out of a shoe.
I was thinking about the gravy when I said it. Husband says he would eat his shoe with that gravy on it. About 10yrs ago, I found a recipe for Crawfish Gravy. Have not dug out the recipe yet but I will share. We make a 4X’s batch the the guys hide their extra portions in the fridge/freezer like it is a great treasure. It probably the best recipe I’ve ever come across. It’s almost a meal by itself.
Daughn – I am going to give this a shot as well. I have always put sour cream in my instant potatoes as well. Makes them seem a bit more “real”. I am going authentic with your recipe, however. Thank You!
Killer Carrots – So good, my kids eat the leftovers, cold, on a vegetable platter.
Ingredients:
5lbs of carrots, peeled and sliced.
1/2 cup of Brown sugar
6TBSP of butter
1tsp of ginger
I use an 8 quart stock pot for 5lbs of carrots. Cover carrots, just barely, with REAL orange juice, not condensed and reconstituted.
Boil on med-high, until al dente, about 17 minutes on my stove.
Make this the LAST dish to place on the buffet, because they will cool off faster than other casseroles.
They are outstanding and taste like “healthy” candy, even when they’re cold.
Carrots are generally very fibrous, so they need to be cooked to soften. OTOH, what isn’t fiber is generally water, and you can easily end up with dehydrated fiber chews if you just roast them. So they need to be cooked in a liquid, and they need to be sweetened. Honey or brown sugar can take care of the sweetening, and bourbon or brandy can be part of the liquid. Butter is de rigeur…..
Ginger or cinnamon can be part of the mix — you don’t want to try to go savory. It may be worth experimenting with tarragon, cloves, or cumin, if they would tie into other dishes.
Spoon a couple heaping scoops of horseradish in a bowl with the cream cheese and mash together. Add more horseradish for a hotter taste and more post nasal drip. Spread mixture a little on the thin side on the slices of salami, and roll up. VIOLA! Serve with toothpicks holding the rolls intact.
You make a crust of shredded cheddar cheese, flour, salt and pepper and maybe one other ingredient like butter. I need the exact proportions from my sister. Will see her tomorrow, hopefully. You basically mash it all together to make a dough, encapsulate an olive in it and bake at 350 for 10-12 minutes. Pro tip, let them cool a little before biting into them.
This year will be my first without a homemade dinner. Was invited to dine at a very formal, stuffy restaurant on the lake. I said yes and have been annoyed about it ever since. Will be interesting though to see who goes to these things and what the food is like. And then I am never doing it again. 🙂
Holley – enjoy it! I have had some great Thanksgiving dinners outside my own kitchen. I think it is fun to see what the chef prepares that I cannot or have not. Just cook yourself a nice little turkey to have later at home for leftovers. They are the best thing about T-dinner anyway!
Chop artchoke hearts and mix well with other ingredients. Spread in a 9″ pan (a shallow pie plate works well) and bake at 350 until bubbly (about 20 minutes). Serve with crackers, pita chips, or any other flat bread.
DP….hosted a bridge group last night and used some of the recipes in this thread. The artichoke hot dip was a success but be prepared…it makes a lot! Sent small containers home with a couple…with suggestion to use on top of baked potatoes.
Also made the tortilla pinwheels…same thing…makes a lot! Took some to a vegetarian friend this afternoon, to her delight. I didn’t use all of it in tortillas…plan to cook frozen peas, add some diced water chestnuts and then blend in a generous scoop of the filling as one of our side dishes for Thanksgiving. Could do the same with corn and diced celery.
Also made some tiny dessert pies with the mincemeat and Cool Whip on top. They were a success with the ladies, many said they hadn’t tasted mincemeat in years. Not knowing how the idea of mincemeat would go over, I used some things I had on hand to make another type of “pie.” I put a layer of ricotta cheese and a second layer of lemon curd and topped with a tiny spoonful of cranberry orange relish. Winner!
Finally, here’s my kitchen tip…one I have used for years. I keep a supply of the really cheap paper plates (Aldi’s) and the large paper coffee filters in the kitchen. I do a lot of pre-cooking prep…chopping, slicing, mincing, pre-measuring of dry ingredients, etc. so that when I start cooking it’s all right there. (Chinese cooking school habit) I use the paper plates for things like veggies, sliced meats for stir fry,…sometimes together if I’m sautéing together, or on separate plates if I add at different times. For spices and light weight items, I use the coffee filters. (I also use both over items I’m microwaving). When finished…I simply discard and it really cuts down on cleanup very significantly.
Daughn’s Dip – I’ve made the mortgage payment selling this dip.
Started out as an accident, turned into a generational winner.
Note: Look for a sour cream with an expiration date in January. Mix up several batches and the dip will last all the way through the holidays. GREAT time saver for drop in guests. We’ll make 5lbs at a time and sell by the pint.
Recipe for a 16oz container of Sour Cream (one batch).
16ounces of real sour cream, do NOT buy low fat, it has too much water in it. Open container and pour off any liquid on top.
1 package of Ranch Dip Mix (but it’s too much, only use 2/3-3/4 of the package.)
Stuffed Handful of fresh grated Parmesan cheese, about 1 1/2 cups (smooshed), be generous.
8-12 drops of Hot sauce, anything will do, I use LA Avery Island. (for a double batch, I shake bottle hard, three times, and call it a day)
1/2—3/4tsp of pepper
Mix and let it sit overnight.
Cover and refrigerate. Mix again in the morning.
Great for any chip or vegetable. Husband uses it as a substitute for mayonnaise for leftover grilled chicken sandwich.
Mix all ingredients except tortillas and salsa. Spread a thin layer of mixture on a tortilla. Roll up and tightly wrap in plastic wrap. Refrigerate. Before serving, cut into 3/4 inch slices, which will resemble pinwheels. Serve with the salsa for dipping.
all your recipes sound wonderful…but my tastes are simple and bland in comparison…so I will share instead our Thanksgiving plans this year: My son and his fiancee are taking over HER mother’s kitchen and cooking dinner for all of us! My son knows how to make a moist turkey–it was the first phone call I got from college from him–hey mom, I wanna make a turkey for my dorm floor–how do I do it? lol
Now, he’s a great cook–but a MESSY one…and his future mother in law seems mighty particular…so we’ll see how this goes!
I like simple and basic as well. I will miss my traditional meal, followed by a walk in the woods, then back for some pie and coffee. And a fridge full of leftovers!! I am really sad about it not happening this year. Cooking in someone else’s kitchen can be a challenge. Hope it all goes well!!
I’m counting on a lot of stories afterward…lol…they rent a small house–much too small to have both families there for dinner, but they are insisting…LOL…I plan on making a small turkey breast for hubby and me later that weekend…cuz you gotta have leftovers!!!!!!!!
The last time I was at Costco, they were sampling a maple syrup aged in bourbon barrels paired with a pancake mix. I’d been eyeing it, but being a little pricey, I didn’t want to shell out for it not knowing exactly how much flavor it would pick up. OMG, the syrup was divine! I’ve been thinking how to utilize it over the holidays. Think I just might pair it with:
MMMM I am saving this recipe! Big waffle fan. The Amish down the road are selling coffee infused maple syrup. There are actual coffee beans floating around in the bottle. It’s really good. The coffee takes some of the sweetness out of the syrup.
here’s the thing:
When i was almost out of high school and going steady with an older guy, I always baked for him. And he loved pumpkin pies especially. So one fall, I bought pumpkins, cooked them, pureed them and baked homemade from scratch crusts, used my cooked and pureed pumpkin and whipped up cream for the topping…
no one and I mean NO ONE thought they were any better than the easy to make above version. work smarter not harder…
if it makes no difference in the taste? RELAX and enjoy your holiday too…
I started making pumpkin pies from fresh pumpkin when my kids were small. I looked at all the pieces cut out from the Jack ‘O Lanterns, and thought, well I might as well cook them up and make pie with them. So after that I would pare a little extra from the inside as well as all the other pieces, simmer the pumpkin, then put it in the freezer for later.
I’ve used both; the carving pumpkins are a little more stringy, but I would put the cooked pumpkin in a blender. That being said, some of the “fancy” carving pumpkins are gourds or gourd crosses. I didn’t start using pie pumpkins until the children were grown!
I used to do that and a whole lot of other “Mother Earth” things and loved it at the time…made my own bread, pasta, stocks, etc…. but I’m kind of past that stage and decided I want to spend time doing more outside the kitchen. And, now we have such good ready to cook or eat take out places that can do it as well as I can. So, gradually I’ve been gifting many of my formerly vast cookbook library, going through an entire filing cabinet of recipe files and tossing, etc. and even finding homes for my speciality appliances and equipment, if I can.
In October, we always create a “pumpkin patch” among the trees in front of our house along with other seasonal decorations. It goes from a Halloween theme to a Thanksgiving one, but the pumpkins stay until Thanksgiving. Then they are put down by the street for trash pickup…however, within a day or two most are gone. Hopefully, someone is using them for the kitchen.
Dollars to donuts they are!! I did a lot of “mother earth” too for a while when I was a stay at home mom, before we went back to running our business. I still enjoy cooking, but the cooking has changed as we’ve gotten older.
Put the mixing bowl in the freezer for 20-30 minutes.
Take it out and pour heavy whipping cream into it. Attach to mixer with the whisk beater. Turn on to 4-6, gradually add powdered sugar and vanilla. Turn mixer up to 10 (or 11 if your mixer has that option). When peaks that stand alone form, it’s done.
Every Thanksgiving and most Christmases, my Grandma would make Sweet Potato Pone. There are as many recipes for Sweet Potato Pone as there are native born senior citizen women in the South.
All the recipes begin with: “Get some pretty sweet potatoes peel and grind them in a meat grinder or grate or chop coarsely.” (They mean by hand – but I use a food processor.) Followed by, “Cook at medium heat.” (350 degrees)
Some make their pone in an old iron skillet, some in a baking pan. Grandma used a big enamel baking pan with deep sides. I have a deep aluminum roasting pan that I use for big crowds. Otherwise a well greased (Pam is just fine) pyrex dish will do.
Here is my Grandma’s approximate recipe (she didn’t measure – she used the never fail method – went by the way it felt, looked, etc.):
NOTES – Except Grandma made lots more than this…triple the recipe at least for a crowd. Grandma also added more milk than 2 c. milk to 4 c. sweet potatoes. She wanted it to start off soupy, then she stirred her ‘pone’ periodically from the bottom, smoothing it back down each time, throughout the baking. I guess she didn’t want a hard crust since she and Grandpa had dentures.
It’s done when the sweet potatoes are tender and the eggs are ‘set’.
I want to try it someday with a crust, because I like crispy foods. If you decide on the crust option – keep a close watch and if the crust starts to get too brown, cut the heat to 300-325 and cover with foil.
PS – If you are going to have homemade bread, rolls or good bagels, english muffins or biscuits for your holiday company or want to give a great gift basket – go look at these amazing preserves, jams and jellies – https://www.jamsnjelly.com/category-s/1825.htm They are fabulous!
I made so much jam the year before last (because of the freezer in my fridge going out) that I swore I wouldn’t make any jam this year. Well, that didn’t happen. I just had to try a lemon lime – zucchini marmalade, fortunately it was a small sized batch. Then since my wild plums and figs ripened at the same time, had to try that combo out. Lastly, I made a batch of blue huckleberries and another of huckleberries and blackberries together which is similar to black berries and blueberries which I have done before. Huckleberries were courtesy of my brother – he and his wife had picked a bunch and traded berries for finished product.
Hi Jamcooker…I made a double batch of the minced meat filling recipe you shared. Tastes good but I find it very “runny” and not really suitable for a pie filling…I even added some thickener. Now,,,I actually don’t plan to use it in a pie crust for our purpose, but has thought of making jars to gift for that purpose. Can you give me suggestions on what I can do differently?
BTW, I didn’t have sorghum on hand but was delighted to use up the blackstrap molasses in the pantry. My husband has been on a PB and jam kick lately so and I’m trying to decrease sugared items on hand, so my jelly choices were slim. It was between orange marmalade and grape jelly…used the grape but now think the orange would have been better.
I’m hosting bridge on Monday night and have copied a couple of the appetizer recipes to put out…always looking for something new to offer. These ladies (8 of us) aren’t a bit shy about eating and drinking lots of wine…very unlike my bridge friends in Florida.. LOL
Thanksgiving dinner this year will just be the two of us…first time in several years. But, even though we usually are guests and have no leftovers, I always cooked at least a turkey breast and a few of “the fixings” to savor the rest of the weekend. It’s a good thing Thanksgiving is always on Thursday so we can enjoy the leftovers , in many creative ways, throughout the weekend
I’m thinking ahead to have several in for a buffet in the dead period between Xmas and New Years…already have a filet in the freezer and a spiral ham in the storage fridge. As I see the various recipes, I’m earmarking…thinking those killer carrots might a colorful, delicious addition to the table, for example. Hmmmm, wonder if I can get hubby to peel 5 lb of carrots.
Thanks to all for inspiring and sharing!
I find that making mincemeat is kind of a cooking by the seat of your pants thing. Some people use only suet in their mincemeat, some use only apples and raisins, but I found that I like to make it with some meat. If your hamburger let off a lot of liquid, it might have taken longer to cook it down to the desired consistency. I even have a recipe that uses green tomatoes which is pretty good, but as I recall, it needs to cook longer because the tomatoes have a lot of liquid in them. And yes, I too have a very few times, added a little cornstarch. But don’t be afraid to let it cook longer if necessary. It’ll be done when it looks right!
You could cook it down a little before adding the apples, and if you’re using a firm apple that helps too. Don’t be afraid to experiment! It just all depends on what you’re looking for! The other think you can do, is add a peeled, diced apple to the mincemeat just before you bake the pie. My mom usually used the dried in a box mincemeat and she would doctor it up to suit her taste and that usually included adding a fresh apple.
Preheat oven to 375º. Combine apples, rum, and cinnamon cider syrup in saucepan. Bring to boil then reduce heat to simmer. Simmer for 15 min. or until apples are tender when pierced with a fork. Spoon into a 9 inch pie pastry. Mix brown sugar, flour, cinnamon and nutmeg and sprinkle over apple filling, dot with butter. Top with remaining pastry and cut vents. Bake pie at 375º for 1 hour or until the filling is bubbly and crust golden. Serve with ice cream and hot Cinnamon Cider Rum Sauce (Click Here).
I made 2 of these for the 1st grade feast today. Cake instead of crust. They baked up looking like slab pumpkin pie. Ill know if they liked it pretty soon. The comments say flavor is great when cold. I added 1/2 tsp of allspice too.
PUMPKIN GOOEY BUTTER CAKE (PAULA DEEN)
INGREDIENTS
CAKE
1
(18 1/4 ounce) package yellow cake mix
1
egg
8
tablespoons butter, melted
FILLING
1
(8 ounce) package cream cheese, softened
1
(15 ounce) can pumpkin
3
eggs
1
teaspoon vanilla
8
tablespoons butter, melted
1
(16 ounce) box powdered sugar
1
teaspoon cinnamon
1
teaspoon nutmeg
DIRECTIONSPreheat oven to 350.To make the cake: Combine all of the ingredients and mix well.Pat batter into a lightly greased 13×9-inch baking pan with hands into an even layer.Prepare filling.To make the filling: In a large bowl, beat the cream cheese and pumpkin until smooth.Add the eggs, vanilla, and butter, and beat together.Next, add the powdered sugar, cinnamon, nutmeg, and mix well.Spread pumpkin mixture over cake batter and bake for 40 to 50 minutes.Make sure not to over bake as the center should be a little gooey.Serve with fresh whipped cream or cinnamon-flavored ice cream.
Passed down recipes, family favorites & a few new ideas for a wonderful Thanksgiving Feast!
Loved traditions make the day rich in history – both civic and family.
Remembered loved ones, new memories with those still with us, living life to the fullest while we can….Thanksgiving!
Celebrated every year with the ones that we are lucky enough to be able to bless and by whom we are blessed.
Written…decision time: Where to share the menu? 2nd thought, where it will be appreciated.
Temptations at the holidays when emotions run high – listen to wisdom and don’t aggravate and say things one might regret. Impetuousness could be a distraction from actual purpose. Sometimes let it go…even when irritating. Best to say less and focus on the mission…Always to MAGA + Have a Happy Thanksgiving where we are loved and appreciate as the people that we are. But do we do all at the same time. in the same place? Where we MAGA might not be where we celebrate family and friendship just as work is different than our church family and both are different that our nuclear family. Wonderful when they overlap but they don’t always or even often. Glad my family is also MAGA – real blessing to have that additional layer of fellowship and commonality.
WOW, what great recipes and stories!
I’ll add my funny Thanksgiving story (well, it’s funny in retrospect) later. But —
And Now for Something Completely Different!
We got out of the turkey thing for Thanksgiving about 10 years ago. Here’s what was substituted:
Spray the inside of a large (6 – 7 quart) crockpot. Put the chestnuts on the bottom of the pot. Stir the chopped pickle into the apple sauce and add the broth. Pour this mixture over the chestnuts. Put the hens in the pot, breast side up, and place 2 strips of bacon on each. Cover and cook on Low for 6 – 61/2 hours or until the hens are thoroughly cooked. Remove the hens and cut each in half; put the cut up hens on a warm platter. Mash the chestnuts with the other ingredients in the pot, then put this mixture in a saucepan to keep warm on the stove. Return the hens to the pot for about 15 minutes. Serve with the mashed chestnuts as a side dish.
Thank you all for the vicariously consumed calories. I think my blood glucose rises when I read these awesome recipes. No longer can I eat most of this in any reasonable quantity. Almost makes me want to go on diabetes pills – just to eat normal again…..well, maybe.
Seriously, all wonderful sounding recipes. Will continue to read either later or tomorrow.
I love Thanksgiving it is pretty much my favorite Holiday! A long time ago I decided to NOT complain about all the work that goes into it, from the prepping to the clean up at the end. It was my gift to my family. We rarely go anywhere (since my husband works in retail, Black Friday has always been “all hands on deck” at the store) and since we live in the west and north, we don’t often get company. Every now and then we do, and it’s always a special time!
I always make a turkey (I use a roasting bag), herb stuffing, potato rolls, green bean casserole, sweet potatoes and regular mashed potatoes, turkey gravy, canned cranberry sauce (which I love, but no one else does) and typically a pumpkin and a pecan pie (this year we might do apple pie as well), with homemade whipped cream. Sometimes we have a cornbread casserole or a broccoli/cauliflower cheese casserole, or maybe a fancy macaroni/cheese bake.
I have three great kids (15, 18 and 20) each one helps with a dish that they particularly like or want to try. My youngest makes the pies, my middle one LOVES Green bean casserole and my oldest helps with odd jobs. I’m thinking this year he’ll learn how to make the turkey. I was about his age when I learned!
Of all these years my only tip that I would share with those of you who are lucky enough to put it all together is use BUTTER, real butter and plan to use LOTS of it. It’s amazing how much butter goes into Thanksgiving Dinner, but it’s worth it!
Oh and we also always drink Sparkling Cider or sparkling grape juice. Using the wine glasses just made everything seem a little more special.
After the feast and clean up is done, we’ll set up the Christmas tree and decorate the house. Ahhhhhh….. it’s work, but one I’m thankful to do every year. We are so blessed!
Right about the butter! The other day I went to Grocery Outlet, checked to dates real well and bought a ton of it for Thanksgiving and for Christmas treats.
Your day sounds like it will be fun and delicious.
One thing about butter…..when you have a good sale, grab a bunch and freeze it. The date on the package is only when you keep it in the fridge. If you freeze it, you can go much longer. But keep it wrapped, because even frozen it can absorb odors and off-tastes.
Cut bacon into 1/4inch slices, separate. Cook in bottom of huge stock pan, stirring frequently.
Cut up cabbage and onions into wedges. Add to stock pot. Add garlic and bullion cubes.
Add enough water to cover 1/3-1/2 pan Mix all ingredients. Put lid on pot. Turn on high to steam.
Check frequently and stir. Take off fire at desired tenderness. I like to leave cabbage with some crunch.
If it cooks too long it will be too soft. Use slotted spoon to transfer to serving dish. Enjoy!
When I’m trimming asparagus, I use a light paring knife and “flick” it into the stem. If it doesn’t go all the way through, the stem is too fibrous and won’t cook well, so flick again away from the base.
According to Robert Graves, “as quick as boiled asparagus” was a saying in Imperial Rome. It can go quickly into unappetizing mush.
Oh my, there’s a much easier way! No knife needed. It’s like snapping peas. Take the spear in left hand, work your fingers toward the bottom. With right fingers, start at the bottom. Start bending back and forth til you find where it will break. Basically you want to find the point where the bottom snaps off, leaving as much of the spear in tact. Snap off all the fribrous ends, rinse the rest real good and go! 🦋
One thing always on our family Christmas and Thanksgiving menus – fresh coconut cake and Ambrosia.
Coconuts were bought, punctured in their three eyes, drained over a glass, cracked, the meat separated from the hard shell, then the thin brown skin removed from the white meat….then the coconut was ground in a meat grinder using the coarse blade.
The cake was homemade yellow cake made with the coconut milk as part of the liquid, and the frosting was white meringue frosting in between and over the outside, both with lavish amounts of coconut.
The Ambrosia was made with navel oranges, peeled to just below the white skin, then the sections removed and the skin squeezed to remove the juice. If the oranges weren’t quite sweet enough, a bit of sugar was added. Grated coconut was added to the sections, then on the day it was to be served, chopped pecans.
Grease and flour 3 (9-inch) cake pans. Using an electric mixer, cream butter until fluffy. Add sugar and continue to cream well for 6 to 8 minutes. Add eggs, 1 at a time, beating well after each addition. Add flour and milk alternately to creamed mixture, beginning and ending with flour. Add vanilla and continue to beat until just mixed. Divide batter equally among prepared pans. Level batter in each pan by holding pan 3 or 4 inches above counter, then dropping it flat onto counter. Do this several times to release air bubbles and assure you of a more level cake. Bake for 25 to 30 minutes or until done. Cool in pans 5 to 10 minutes. Invert cakes onto cooling racks. Optional – brush with flavored syrup. Cool completely and spread cake layers with your favorite frosting to make a 3-layer cake.http://www.foodnetwork.com/recipes/paula-deen/basic-1-2-3-4-cake-recipe.html?oc=linkback
—
Miracle Frosting (this is fool proof!)
2 1/4 c. sugar
1/2 c. water
1/8 tsp. salt
3 egg whites, unbeaten
3/8 tsp. cream of tartar
1 1/2 tsp. vanilla
Boil sugar, water and salt for 3 minutes. Add slowly to unbeaten egg whites and cream of tartar beating all the while. Beat exactly 5 minutes. This makes enough for a large cake or 2 small ones. If any is left, can be put into jar in refrigerator. (can use leftover egg yolks to make shortbread cookies)
————————
Option I: Can make syrup and brush on top of warm layers to make cake extra moist. Recipe: 1 cup Coconut milk or water and 3/4 cup sugar – boil until becomes syrup. Can make syrup with orange and/or lemon juice or a dash of Grand Marnier, Cointreau, etc. if desired.
Assembling cake: Place cake layer on plate. Spread with frosting or lemon filling and top with coconut. Add another layer and repeat if three layers. If two layers, frost whole cake. Press coconut into top and sides.
Refrigerate until serving time in air-tight cake holder.
NOTE – Mama didn’t use a syrup, lemon filling or liqueurs and her cake was just wonderful! Sometimes a lily doesn’t need building. Coconut, freshly ground is a delight in itself.
Hello, everybody!
So here’s my “it’s-funny-in-retrospect” Thanksgiving story:
By the first Thanksgiving of my marriage, I was about 2 months’ pregnant. With all of the requisite morning sickness, etc. And I’d arranged for a brand-new double oven/stove to be installed in the kitchen. And I’d talked with my mother on the phone about just how to make a flawless turkey dinner.
On Thanksgiving Day, I did everything my mother and I talked about. The turkey (fresh, not frozen) was beautifully prepared. The stuffing was ready. I had the recipe for Aunt Mary’s Mashed Potatoes and Carrots.
I followed the instructions that came with the main oven and carefully preheated it. Then I put the turkey in.
Then I went to bed for a nap.
When I woke up, the turkey smelled just great. I announced to my husband that the feast would be ready at 8PM.
At 8PM, the mashed potatoes, the stuffing cooked on the stove, etc., all were ready. I got out the platter for the turkey.
Then I opened the door of the oven.
ONLY THE TOP OF THE TURKEY WAS COOKED.
Because I NEVER TOOK the oven off Preheat! It was on Preheat for over 4 hours!
To this day, I can see the entire scene. I was mortified. I was horrified. I started to cry. I felt awful.
But also to this day, I can see my husband taking me in his arms and telling me that everything was all right, it didn’t matter when we’d eat, we’d figure it out.
So I dried my tears and put the turkey in the main oven on BAKE at 400 degrees and kept the side dishes on Warm in the other oven.
We ate that Thanksgiving dinner at about MIDNIGHT And it was just fine.
jamcooker
You are correct. We would make jokes about my being “a Civil War bride”, lol.
What shut down the gossipers in the small town we lived in was the birth of our healthy son. My husband was 71 years old.
This is our family preferred dressing, but please use yours if more comfortable. The REAL KILLER is the Crawfish Gravy.
Here is the Dressing Recipe, first:
First do the grits, which are the cracker crumbs normal people use.
3 1/2 Cups of Chicken Broth + 1 Cup Water + 1 1/2 cups of quick grits
1/4tsp of red pepper or 1tsp of Zatarain’s Crab Boil
1 Cup (smooshed) High quality sharp Cheddar Cheese.
Bring the broth to a boil, add grits, cover, reduce heat, 7 minutes stirring a couple times. Add the cheese, crab boil, until cheese is melted.
Spoon into a 13″x9″ casserole, cover and chill overnight.
In the morning, loosen the edges, cut grits into 3/4″ pieces. Grease (Crisco) a jelly roll pan and place grits, single layer, into a 450 degree oven for about 20 minutes. Toss and turn the grits at this point. Bake another 10-12 minutes. Remove from oven.
Note: Keep the kids and husbands out of them, they taste like gourmet Fritos. Really good.
These will serve as your cracker crumbs for stuffing.
Next is the stuffing mix:
12 Ounces of Andouille Sausage, cook in a skillet about 5 minutes.
Add 6 Ounces of fresh shucked oysters (drained and quartered) Cook another 5 minutes until sausage is done and oyster liquid is gone and edges start to curl. Remove sausage/oysters from pan. Dab out excess grease but do NOT clean the pan.
Back the heat down to medium and add:
2 Celery Ribs – diced
1 Medium Onion – diced
1 Red Bell Pepper – diced
1tsp (heaping) minced garlic.
Saute until tender, deglazing the drippings from the pan.
Remove from heat and chop up,
1/4Cup fresh Parsley
In a large bowl, combine sauteed vegetables, Andouille sausage/Oysters, grits, parsley.
Crack and whip
2 Eggs whipped, and blend it all together.
Turn whole mixture into a “Pammed” casserole dish. Cook at 350 degrees. I do 20 minutes covered and 20 minutes uncovered.
KILLER CRAWFISH GRAVY
It’s supposed to be for the stuffing, but it can be a meal when ladled over mashed potatoes or leftover turkey.
(One Recipe makes 4 Cups, I usually do 4X’s recipe and make it the day ahead)
Ingredients for ONE recipe:
6TBSP of unsalted butter
1lb of peeled and cooked crawfish tails. (Do not chop them)
1 large shallot (I use a half of a small onion) pureed into thick soup texture
1 Celery Rib (puree with the onion)
2 Cloves garlic (about 1heaping tsp fresh minced – puree with the celery/onion)
1/4Cup of flour + a pinch (all purpose)
2 Cups of Chicken Broth
1/2 cup of Good White Wine (the kind you are serving, preferably)
1tsp of Zatarain’s Crab Boil
1 Bay leaf (I use 3-4)
1 1/2tsp of ground thyme
1/4tsp of fresh ground pepper.
Melt the butter on medium heat and saute the crawfish for 3-4 minutes (they will curl). Remove the crawfish but DO NOT CLEAN THE PAN. Add onion/celery/garlic for another 6-7 minutes until tender.
Now, we’re going to “Make a Roux” and you will never have lumpy gravy again. It sounds fancy, but it’s easy. Back down the heat to med – low, so we can go slowly.
Add the flour to the pan. With a strong wisk, mix the butter/onion/garlic with the flour. What we’re going to do is “cook” the flour to a slight tan. It will take about 10-12 minutes but constantly whisk and move the ingredients around the pan.
Add the 1/2 Cup of wine and with your whisk, incorporate the liquid into the solids.
You’re doing great!!
Now slowly add the chicken broth, Don’t DUMP, because it’s too hard to whisk, go slowly, and incorporate the liquid as you go.
Add the Crab boil, thyme, bay leaf, pepper.
Well done.
Now, bring the temperature back up to a medium, whisking fairly constantly, for about 7 minutes until it thickens, slightly.
Add the crawfish, turn over carefully, and you’re done.
Refrigerate asap.
Pick out the bay leaf in the morning.
Next day, I will usually warm it in a crockpot on low (saves a burner on the stove and keeps the gravy warm without fussing.) If you warm it in a pan on stovetop, you may need a little more chicken broth, or half glass of wine will work just fine.
Soften the butter. With your hands, or in a Cuisinart or something like it, mix flour butter and cheese until it makes a crumbly dough. Drain the olives, and be sure they are dry. Take about an acorn size lump and pat out into a flat surface. Put the olive in it and close the casket of the dough so that the whole thing is surrounded. Spread at least an inch apart on a cookie sheet, and bake at 375 for 10 minutes or so.
In mixing bowl, combine all ingredients at room temperature.
To prepare mushrooms, remove stems. Professional chefs will usually peel the mushrooms to make them very white, but “know your audience”…😉
Generously fill each mushroom. Generously coat the tops with additional Panko crumbs. Decorate with chives,
Bake 20 minutes at 350. Like with most rounded foods, I usually will make a very thin slice on the rounded edge, if necessary, so it will sit evenly on the baking sheet and serving dish.
Obviously the number it makes depends on the size of your mushrooms, but think bite-size finger food when choosing the mushrooms.
I ended up using two large dollops of bacon drippings in place of the butter. When finished it seemed quite sweet and a bit bland so added a teaspoon of dried thyme plus two tablespoons of cooking sherry. The thyme didn’t stand out but the sherry did something magical to the flavor!
Garnished with a thin swirl of heavy whipping cream, sprinkles of a very finely chopped piece of spicy beef jerky, fresh basil sprigs and 6-8 pistachios per bowl. A bit eclectic, but I like to use what I find at hand. We all seemed to want second helpings. 🙂
Wow!! So many great recipes to try – thank you all for sharing your culinary skills with me (and so many others). I am so thankful for this daily blog, I have learned so much in the last year or so. I’m very thankful for all of you!
We’re doing a big turkey this year, so Saturday seems like a good day to buy it and keep it in the fridge. What do you all do? Should I go with Butterball? I usually buy the off brand type since it’s typically cheaper they all seem to taste the same to me. I would love to try a real, fresh from the wild and shot with my own gun type of turkey some day, but I’m not a hunter (more of a gatherer). 🙂
“‘We enjoyed a hearty breakfast bake during a visit to an Amish inn,’ recalls Beth Notaro of Kokomo, Indiana. ‘When I asked for the recipe, one of the ladies told me the ingredients right off the top of her head. I modified it to create this version my family loves. Try breakfast sausage in place of bacon.'”
In a large skillet, cook bacon and onion until bacon is crisp; drain. In a bowl, combine the remaining ingredients; stir in bacon mixture. Transfer to a greased 13-in. x 9-in. x 2-in. baking dish.
Bake, uncovered, at 350 degrees F for 35-40 minutes or until set and bubbly. Let stand for 10 minutes before cutting. |
Q:
Null Pointer exception when trying to access the parent layout
I have a relative layout with three buttons in it and I am trying to change the background of the relative layout dynamically. Here's the xml
<?xml version="1.0" encoding="utf-8"?>
<RelativeLayout xmlns:android="http://schemas.android.com/apk/res/android"
android:orientation="horizontal"
android:layout_width="fill_parent"
android:layout_height="fill_parent"
android:background="@drawable/mbi2"
android:id="@+id/rlMain"
android:layout_centerHorizontal="true">
<Button android:text="Compose"
android:id="@+id/btnCompose"
android:layout_height="wrap_content"
android:layout_width="wrap_content"/>
<Button android:text="Messages"
android:id="@+id/btnMessages"
android:layout_height="wrap_content"
android:layout_width="wrap_content"
android:layout_toRightOf="@id/btnCompose"/>
<Button android:text="More >>"
android:id="@+id/btnMore"
android:layout_height="wrap_content"
android:layout_width="wrap_content"
android:layout_toRightOf="@id/btnMessages"/>
</RelativeLayout>
Here's the java code which is giving me an error
RelativeLayout llMain=null;
try {
llMain = (RelativeLayout) findViewById(R.id.rlMain);
Resources res = getResources();
Drawable drawMbi = res.getDrawable(drawBgId);
llMain.setBackgroundDrawable(drawMbi);
} catch (Exception e) {
e.printStackTrace();
}
The error is
06-29 23:56:41.099: WARN/System.err(8487): java.lang.NullPointerException
06-29 23:56:41.099: WARN/System.err(8487): at com.me2youmob.cwrap.ChickenWrapActivity.loadMBIIntoView(ChickenWrapActivity.java:65)
06-29 23:56:41.099: WARN/System.err(8487): at com.me2youmob.cwrap.ChickenWrapActivity.onCreate(ChickenWrapActivity.java:23)
06-29 23:56:41.099: WARN/System.err(8487): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1066)
06-29 23:56:41.099: WARN/System.err(8487): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2797)
06-29 23:56:41.108: WARN/System.err(8487): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:2854)
06-29 23:56:41.108: WARN/System.err(8487): at android.app.ActivityThread.access$2300(ActivityThread.java:136)
06-29 23:56:41.118: WARN/System.err(8487): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:2179)
06-29 23:56:41.118: WARN/System.err(8487): at android.os.Handler.dispatchMessage(Handler.java:99)
06-29 23:56:41.118: WARN/System.err(8487): at android.os.Looper.loop(Looper.java:143)
06-29 23:56:41.118: WARN/System.err(8487): at android.app.ActivityThread.main(ActivityThread.java:5068)
06-29 23:56:41.118: WARN/System.err(8487): at java.lang.reflect.Method.invokeNative(Native Method)
06-29 23:56:41.118: WARN/System.err(8487): at java.lang.reflect.Method.invoke(Method.java:521)
06-29 23:56:41.118: WARN/System.err(8487): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:858)
06-29 23:56:41.118: WARN/System.err(8487): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:616)
06-29 23:56:41.118: WARN/System.err(8487): at dalvik.system.NativeStart.main(Native Method)
Another thing in this issue is that earlier I had the buttons within a linear layout which was then within a Relative Layout. I thought it was not able to reach the relative layout and remove the linear layout section. It still gives me the same error.
Any idea what is going on here ?
NEW UPDATE:
@Override
public void onCreate(Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
setContentView(R.layout.main);
RelativeLayout rlM = (RelativeLayout) findViewById(R.id.rlMain);
if (rlM == null)
{
Log.d("NULL CHECK","Layout is null");
}
else
{
Log.d("NULL CHECK","Layout is not null");
}
//spPreferences = getSharedPreferences(PREFS_NAME, 0);
//loadMBIIntoView();
//handleButtonClicks();
}
A:
The View.findViewById() function will only find views that are children of the current view you are in.
In this case, you're trying to obtain the main view either within one of the children views, or you have not used setContentView() within the Activity class yet.
If you are trying to set your background, I would highly suggest doing so from the Activity.
|
Introduction {#s1}
============
The group of cellular proteins known as Interferons (IFNs) appeared to be expressed in infected cells as an early response to viral infection but, in addition to their antiviral activity, IFNs also have a profound effect on cell growth [@pone.0036909-Vannucchi1].
IFN-α2 was the first human protein shown to be effective for cancer treatment and the first economically viable clinical product developed from recombinant DNA technology in cancer therapy.
Antitumor activity of IFNs is probably exerted through direct and indirect mechanisms. It is conceivable that numerous direct effects play a central role in the overall antitumor response, such as down-regulation of oncogene expression, induction of differentiation, inhibition of cell cycle progression and induction of tumor suppressor genes, and programmed cell death [@pone.0036909-Bekisz1]. However, additional understanding of IFN antitumor action and mechanisms influencing tumor responsiveness or resistance appears necessary to aid further promising development of biomolecular strategies in IFN therapy of cancer.
The most extensively studied anticancer treatment-induced mechanism is apoptotic programmed cell death. Nevertheless, the correlation between the induction of apoptosis and drug response cannot explain the overall tumor cell sensitivity [@pone.0036909-Rebbaa1]. Numerous recent studies have shown that in cells where apoptosis is blocked, non-apoptotic cell death or irreversible cell growth arrest, namely senescence, can be activated as potential tumor-suppressor mechanisms [@pone.0036909-Kim1]. The concept of senescence is applied in general to the irreversible proliferative arrest of cells caused by various stresses [@pone.0036909-Chiantore1] including oxidative damage, telomere dysfunction, and DNA damage. One particularly relevant source of stress in tumor cells is derived from the aberrant proliferative signals of oncogenes which may trigger senescence through a process known as oncogene-induced senescence, functioning as a potential tumor suppressor mechanism.
Senescent cells are identified *in vitro* by distinctive morphological changes, such as large cell size, flat vacuolated morphology, the inability to synthesize DNA, the formation of domains of heterochromatin called Senescence-Associated Heterochromatin *Foci* (SAHF) and the expression of a Senescence-Associated β-galactosidase activity (SA-β-gal) [@pone.0036909-Campisi1], [@pone.0036909-Dimri1]. One of the earliest steps in the senescence programme is the translocation of histone chaperone HIRA (Histone Repression factor A) into promyelocytic leukemia (PML) nuclear bodies (NBs), but the role played by HIRA localization into PML bodies has not yet been identified. PML bodies are nuclear structures known to serve as sites of protein modification and the assembly of macromolecular regulatory complexes, and have been extensively implicated in the induction of senescence and apoptosis [@pone.0036909-Condemine1], [@pone.0036909-Geoffroy1].
Consistent with its role in tumor suppression, the critical senescence pathways converge on the two major tumor suppressor genes p53 and pRb, whose mutations or inactivation are most common in all cancers [@pone.0036909-Shay1].
Abrogation of senescence can be achieved by SV40 large T, a combination of HPV oncoproteins E6 and E7, E1A and MDM2 coexpression or small interfering RNA against pRb and p53 [@pone.0036909-Boehm1]. Tumors initiated by loss of p53 can be eliminated by senescence induced by p53 restoration, tumor regression being achieved through an innate immune response that leads to the clearance of senescent cells [@pone.0036909-Ventura1], [@pone.0036909-Xue1]. Cellular senescence results in altered gene expression including IFNs and their related genes [@pone.0036909-Yoon1]. PML is known to be regulated by the interferon pathway via the STAT transcription factors [@pone.0036909-Stadler1]. IFN also regulates many other components of PML nuclear bodies, suggesting that in conjunction they mediate the antiviral and antiproliferative activities of this cytokine [@pone.0036909-Geoffroy1]. Cellular senescence is induced in human fibroblasts by prolonged IFN-β treatment through DNA damage signaling and a p53-dependent pathway [@pone.0036909-Moiseeva1]. IFN-α also induces replicative senescence in endothelial cells after continuous stimulation [@pone.0036909-Pammer1]. Taken together, these studies suggest that signaling through the IFN pathway might play an important role in cellular senescence.
Human Papilloma Viruses (HPVs) are small DNA viruses involved in the development of both benign and malignant lesions localised in different anatomic districts, that are able to replicate exclusively in the stratified squamous cutaneous and mucosal epithelium. More than 100 different HPV types have been isolated so far, and they can be sub-grouped into cutaneous or mucosal according to their ability to infect the skin or the mucosa of the genital or upper-respiratory tracts [@pone.0036909-ZurHausen1]. To date, the causative association between mucosal high risk-HPV and cervical carcinoma has been clearly demonstrated. It is well known that the expression of E6 and E7 viral oncoproteins is a common feature of cervical cancer cells and is strongly implicated in the process of cancer development, E6 and E7 principally targeting and inhibiting p53 and pRb tumor suppressor proteins, respectively [@pone.0036909-Hebner1]. Emerging lines of evidence support the involvement of the cutaneous HPV types belonging to the beta genus in non melanoma skin cancer (NMSC). However, although the role of beta HPV types in NMSC in Epidermodysplasia verruciformis (EV) patients is well accepted, their involvement in skin carcinogenesis in the general population is not entirely proven. The transforming properties of the majority of cutaneous HPV types have been poorly investigated. Tommasino and co-workers [@pone.0036909-Caldeira1] have shown that HPV38 E7 appears to act similarly to HPV16 E7, by binding to pRB and promoting its degradation via the proteasome pathway. On the contrary, HPV38 E6 oncoprotein differs from mucosal high risk HPV E6 proteins in the mechanism by which it counteracts p53 activity. The expression of HPV38 E6 and E7 in human keratinocytes induces the stabilization of p53, which in turn selectively activates transcription of ΔNp73, a p53 inhibitor [@pone.0036909-Accardi1]. High ΔNp73 levels have been found in a number of human malignancies including cancers of the breast, prostate, liver, lung and thyroid [@pone.0036909-Buhlmann1]. Recently, it has been shown that IFN-α reduces ΔNp73 levels in Huh7 hepatoma cells, and this effect correlates to increased susceptibility to IFN-α triggered apoptosis [@pone.0036909-Testoni1].
Here, we show that prolonged treatment with IFN-β induces senescence in cutaneous HPV38-transformed keratinocytes. PML is essential in IFN-β induction of senescence in HPV38-transformed keratinocytes, and both p53 and p21 pathways contribute to the execution of the phenomenon. p53 colocalyzes with IFN-β-induced PML into PML Nuclear Bodies. By recruitment of p53 into NBs, IFN-β can modulate p53 post-translational modification at specific phosphorylation and acetylation sites and downregulate ΔNp73 expression, leading to the recovery of p53 transactivating activity of selected target genes involved in cell proliferation control.
Results {#s2}
=======
IFN-β Inhibits Cell Proliferation of K38 and K16 Cells {#s2a}
------------------------------------------------------
Keratinocytes expressing E6 and E7 proteins of HPV-38 and HPV-16, referred to as K38 and K16 respectively, were obtained as described [@pone.0036909-Caldeira1].
To test whether IFN-β could affect proliferation of both transformed keratinocytes, K-38 and K-16 cells were treated with IFN-β for several time points and the amounts of viable cells were revealed. As shown in [Fig. 1A](#pone-0036909-g001){ref-type="fig"}, proliferation of both cell lines was strongly affected by IFN-β.
{#pone-0036909-g001}
To exclude that the antiproliferative effect of IFN-β could be due to downregulation of E6/E7 expression, we checked HPV-38 and HPV-16 E6 and E7 mRNA levels by RT-PCR. No significant variations were observed in either E6 or E7 expression in K38 and K16 cells upon treatment with IFN-β for different time points (data not shown).
We previously demonstrated that IFN-β exerts its antiproliferative effect on high-risk HPV-positive cell lines by lengthening cell cycle S-phase progression [@pone.0036909-Vannucchi2]. We analyzed cell cycle distribution of K38 and K16 cells after treatment with IFN-β for several time points. Both cell lines showed a significant augment of S-phase cell amount starting from 48 h of treatment. Interestingly, in K16 cells S-phase cell accumulation increased with time whereas in K-38 cells the S-phase increase was followed by an augment of G1 population ([Fig.1B](#pone-0036909-g001){ref-type="fig"}).
K16 and K38 cells were pulse-labelled with BrdU for 5 h and analysed for BrdU incorporation. As with what was observed in SiHa and other mucosal high-risk HPV-positive cell lines [@pone.0036909-Vannucchi2], an increased number of BrdU-positive cells reflecting an S-phase cell accumulation was revealed in IFN-β treated K16 populations. On the contrary, in K-38 samples the number of cells incorporating BrdU upon IFN-β treatment appeared clearly reduced ([Fig. 1C](#pone-0036909-g001){ref-type="fig"}).
IFN-β Induces Cellular Senescence in K38 but Not in K16 Cells {#s2b}
-------------------------------------------------------------
To study apoptosis and senescence induction, specific assays were performed. Annexin-V externalization assay showed no significant increase of apoptosis in either cell types after IFN-β treatment (data not shown). Senescent cells were quantified by counting cells displaying β-galactosidase activity at pH 6.0 (SA-βgal). This lysosomal hydrolase is elevated in senescent cells as a result of lysosomal activity at suboptimal pH, which is detectable only in senescent cells due to an increase in lysosomal content. Interestingly, increasingly high percentages of senescent cells were observed exclusively in K38 cells transformed by E6 and E7 proteins of cutaneous HPV genotype, starting from 4 days of IFN-β treatment, compared to control keratinocytes (LXSN), K16 cells and mucosal high risk HPV-positive cell lines ([Fig. 2A, B, and C](#pone-0036909-g002){ref-type="fig"}).
{#pone-0036909-g002}
Involvement of PML, p53 and p21 in Cell Senescence Induced by IFN-β in K-38 Cells {#s2c}
---------------------------------------------------------------------------------
It is known that important senescence regulators are found in IFN-inducible genes. In addition, it has been reported that prolonged IFN-β stimulation can induce senescence in normal cells through the activation of a DNA damage response triggered by an ATM-chk2-p53 pathway [@pone.0036909-Moiseeva1]. We asked whether IFN-β could induce the senescence phenotype in K38 cells through the involvement of PML and the activation of p53, thus counteracting the inhibitory action exerted on p53 by HPV-38 E6/E7 expression. We analysed the protein levels of PML, p53 and p21, upon IFN-β treatment, and the respective involvement in senescence through RNA silencing (siRNA) technique. Three different siRNAs were used for PML, p53 and p21 genes. Upon IFN-β treatment, PML was up-regulated as well as p21 ([Fig. 3](#pone-0036909-g003){ref-type="fig"}). On the other hand in K16 cells, even if IFN-β treatment induces PML expression, it is not detectable any increase in p21 protein levels (data not shown).
{#pone-0036909-g003}
PML seems to be an essential component of senescence response in K38 cells, since, when PML expression is inhibited by specific siRNAs ([Fig. 4A](#pone-0036909-g004){ref-type="fig"}), IFN-β-induced senescence is strongly reduced ([Fig. 4D](#pone-0036909-g004){ref-type="fig"}). p21 silencing ([Fig. 4C](#pone-0036909-g004){ref-type="fig"}) partially affects IFN-β-induced senescence ([Fig. 4D](#pone-0036909-g004){ref-type="fig"}), while p53 silencing ([Fig. 4B](#pone-0036909-g004){ref-type="fig"}) appears much more effective ([Fig. 4D](#pone-0036909-g004){ref-type="fig"}), suggesting that different p53 targets may be involved in IFN-β-induced senescence in K38 cells and different pathways may cooperate towards this phenomenon.
{#pone-0036909-g004}
PML Target Proteins Colocalyze in PML Nuclear Bodies {#s2d}
----------------------------------------------------
It is known that PML recruits into NBs p53 and different proteins involved in p53 post-translational modifications that are critical for the activation of p53 and for the selection of target genes [@pone.0036909-Bourdeau1]. We studied colocalization of PML with p53 and ΔNp73 through confocal microscopy analyses of K38 cells treated with IFN-β for different time points. [Fig. 5](#pone-0036909-g005){ref-type="fig"} shows that p53 (A) and ΔNp73 (B) colocalyze with IFN-β-induced PML into PML NBs. On the other hand, colocalization is not detectable after PML silencing (data not shown).
{ref-type="sec"} and sample were analyzed using confocal microscope (Leica TCS SP5).](pone.0036909.g005){#pone-0036909-g005}
Post-translational Modification of p53 by IFN-β {#s2e}
-----------------------------------------------
The expression of HPV38 E6 and E7 in human keratinocytes induces the stabilization of p53, as shown by WB analysis of p53 in K38 cells compared with control keratinocytes (LXSN), K16 cells and high risk HPV-positive cell lines SiHA and ME-180 ([Fig. 6A](#pone-0036909-g006){ref-type="fig"}). This p53 stabilization can be related to increased phosphorylation [@pone.0036909-Accardi1] and acetylation ([Fig. 6C](#pone-0036909-g006){ref-type="fig"}).
{#pone-0036909-g006}
In this respect, we may hypothesize that IFN-β, through PML up-regulation, can lead to the recovery of p53 transactivating activity of target genes involved in cell proliferation control. Therefore p53 phosphorylation and acetylation status was analyzed in K38 cells treated with IFN-β. IFN-β modulates p53 phosphorylation status at different phosphorylation sites (Ser-6, Ser-15, Ser-46, Ser-392, [Fig. 6B](#pone-0036909-g006){ref-type="fig"} **)** while acetylation is mainly downregulated in Lys-320 ([Fig. 6C](#pone-0036909-g006){ref-type="fig"}). Ser-6, Ser-392, and Lys-320 seem to be the most important p53 post-translational modifications involved in IFN-β-induced senescence in K38 cells. In fact, when PML expression is silenced, IFN-β is not able to modulate p53 Ser-6, Ser-392, and Lys-320 status ([Fig. 6D](#pone-0036909-g006){ref-type="fig"}).
Accardi *et al*. [@pone.0036909-Accardi1] reported that p53 stabilization in K38 cells leads to transcriptional activation of ΔNp73, a p53 inhibitor, able to inhibit p53 transactivation of genes involved in cell growth suppression. It has been shown that IFN-α reduces ΔNp73 levels in Huh7 hepatoma cells and this effect correlates to increased susceptibility to IFN-α triggered apoptosis [@pone.0036909-Testoni1]. We observed that in K38 cells, IFN-β treatment downregulates ΔNp73 mRNA levels (data not shown). The ΔNp73 protein expression appears to be reduced upon IFN-β treatment ([Fig. 6E](#pone-0036909-g006){ref-type="fig"}), probably as a result of the p53 post-translational modifications induced by IFN-β. In fact, when PML expression is silenced, ΔNp73 protein levels are not downregulated by IFN-β ([Fig. 6D](#pone-0036909-g006){ref-type="fig"}).
Real time PCR array results indicate that some genes involved in senescence and growth control are IFN-β-upregulated ([Fig.6F](#pone-0036909-g006){ref-type="fig"}). In particular, the observed induction of p53 target genes Bax and Pig3 indicates that IFN-β treatment leads to the recovery of p53 transactivating activity of selected target genes involved in the control of cell proliferation. In fact, it has been reported that modification of specific p53 phosphorylation and acetylation sites may correlate to the transactivation of growth related genes, suggesting a tissue and promoter-specific p53 activity regulation [@pone.0036909-Dai1]. PML depletion reduces IFN-β induction of Bax and Pig3 in K-38 cells ([Fig.6F](#pone-0036909-g006){ref-type="fig"}), indicating the role of PML in the ability of IFN-β to recover p53 transactivation activity of specific target genes.
Discussion {#s3}
==========
IFNs were the first successful biological therapy for human malignancy and currently there are several approved IFN cancer therapies. Clinical effectiveness of different IFN subtypes in treatment of various forms of cancer has been extensively reviewed [@pone.0036909-Vannucchi1]. Better definition of therapeutic molecular targets appears to be critical to fully realize the potential of IFNs in oncology and further understand the mechanisms of antitumor action of the IFN family.
Senescence is a permanent cell cycle arrest that is resistant to growth factors and other signals that induce cell proliferation. It has been proposed that senescence prevents cancer in the early stages of its development [@pone.0036909-Campisi1]. Tumor suppressors such as p53, pRb and PML are critical regulators of senescent programme [@pone.0036909-Shay1], [@pone.0036909-Bourdeau1], and genes required for senescence are often found to be mutated in human cancers. Cellular senescence is induced in human fibroblasts by prolonged IFN-β treatment through DNA damage signaling and a p53-dependent pathway [@pone.0036909-Moiseeva1]. IFN-α also induces replicative senescence in endothelial cells after continuous stimulation [@pone.0036909-Pammer1], and treatment with IFN-γ induces cellular senescence in young human umbilical vascular endothelial cells [@pone.0036909-Kim2]. However, whether induction of senescence is sufficient to repress tumor *in vivo* is controversial. Recent reports showed that conditional restoration of p53 in mice with hepatocarcinomas, sarcoma or lymphoma is able to promote tumor regression [@pone.0036909-Xue1], [@pone.0036909-Ventura1]. In addition, it has been reported that HeLa cells cease proliferation and undergo senescence by introduction of the bovine papillomavirus E2 gene that inhibits the expression of the HPV18 E7 gene [@pone.0036909-Johung1]. Antisense sequences directed against HPV16 E6 and E7 genes transfected in SiHa cells contributed to apoptosis and senescence [@pone.0036909-Sima1].
In contrast to mucosal high-risk HPV types, the involvement of cutaneous HPV types in human carcinogenesis is still unclear. Cutaneous HPV types that belong to the beta genus of the HPV phylogenetic tree were first isolated in patients suffering from EV, a rare autosomal recessive cancer-prone genetic disorder, and are consistently detected in NMSC from EV, immunocompromised and normal individuals [@pone.0036909-Karagas1]. The transforming properties of the majority of the cutaneous HPV types have been poorly investigated. It has been reported that cutaneous HPV5 E6 protein targets and abrogates Bak function by promoting its proteolitic degradation both *in vitro* and in regenerated epithelium [@pone.0036909-Underbrink1]; however, regulation of Bax has also been reported [@pone.0036909-Struijk1]. The E6 protein of HPV5 compromises the repair of UV-induced thymine dimers [@pone.0036909-Giampieri1] and E6 of HPV7 forces keratinocytes into the S1-phase by inhibiting p53-activated, pro-apoptotic genes [@pone.0036909-Giampieri2]. HPV8 E6 is able to bind XCRR1 that functions in a single strand DNA repair [@pone.0036909-Iftner1] and it has been shown that UV-irradiated cutaneous HPV8 E2-transgenic mice develop invasive carcinomatous lesions more rapidly than non-irradiated counterparts [@pone.0036909-Pfefferle1]. Moreover, E6/E7 expression of HPV20 influences proliferation and differentiation of the skin of UV-irradiated transgenic mice [@pone.0036909-Michel1]. The anti-apoptotic activity and the delay of the DNA repair mechanism may lead to the persistence of UV-damaged keratinocytes, suggesting that cutaneous HPV types may be involved in the early stages of carcinogenesis.
A different mechanism behind the lack of cell cycle arrest in cutaneous HPV expressing cells is the up-regulation of ΔNp73 as a result of p53 accumulation observed in HPV38 E6 and E7 expressing human keratinocytes. ΔNp73 in turn inhibits the capacity of p53 to induce the transcription of genes involved in growth suppression [@pone.0036909-Caldeira1], [@pone.0036909-Accardi1]. This observation, together with the efficiency of pRb binding and degradation by HPV38 E7, the HPV38 E6/E7-induced suboptimal activation of telomerase and the HPV38 E6/E7 transforming properties *in vivo* [@pone.0036909-Gabet1], seems to indicate that HPV38 E6 and E7, differently from proteins of other cutaneous HPV types, may be involved in the maintenance of oncogenic transformation.
We have previously reported that type I IFNs inhibit cell proliferation in high risk mucosal HPV-positive Squamous Carcinoma Cell (SCC) lines by inducing a significant accumulation of cells in S-phase [@pone.0036909-Vannucchi2]. The S-phase deregulation triggers apoptotic cell death specifically mediated by the pro-apoptotic factor TRAIL [@pone.0036909-Vannucchi3].
The present study shows that IFN-β affects cell proliferation in keratinocytes expressing E6 and E7 proteins of cutaneous HPV-38 to a greater extent than in E6 and E7 mucosal HPV-16 transformed cells. In particular, K38 cells undergo senescence upon prolonged IFN-β treatment. IFN-β appears to induce senescence by up-regulating the expression of the tumor suppressor PML. Indeed, experiments of gene silencing via specific siRNAs have shown that PML is essential in the execution of senescence programme and that both p53 and p21 pathways are involved in senescence induction by IFN-β in K38 keratinocytes.
P53 and PML are critical mediators of senescence. PML is essential for the formation of discrete protein assemblages in the nucleus known as Nuclear Bodies (NBs) [@pone.0036909-Ishov1]. PML recruits into NBs p53 and proteins involved in p53 post-translational modifications that are essential for the activation of p53 and for the selection of target genes, such as the DNA damage responsive kinases ATM and ATR [@pone.0036909-Bourdeau1]. ATM kinase phosphorylates p53 at Ser-15, a senescence-inducible modification [@pone.0036909-Webley1], in IFN-β-induced cellular senescence in human fibroblasts [@pone.0036909-Moiseeva1]. Over-expression of PML is capable of inducing premature senescence by stabilizing p53 via p53 acetylation on Lys-382 and phosphorylation on Ser-15 and Ser-46 [@pone.0036909-Ferbeyre1]. In contrast, deacetylation of p53 antagonizes PML-induced premature senescence [@pone.0036909-Langley1].
It has been shown that PML interacts with CBP/p300 acetyltransferase and stabilizes p53 through Lys-382 acetylation [@pone.0036909-Ferbeyre1]. PML also recruits the tumor suppressor homeodomain-interacting protein kinase-2 (HIPK2) which induces p53Ser46 phosphorylation [@pone.0036909-Moller1]. It has been reported that HIPK2-mediated phosphorylation of p53Ser46 is required for the CBP-induced p53 acetylation at Lys-382 [@pone.0036909-Hofmann1]. PML has also been recently identified as a direct target of p53 revealing a regulatory positive feedback loop between p53 and PML [@pone.0036909-deStanchina1].
Our results indicate that in K38 cells p53 colocalyzes with IFN-β-induced PML into PML NBs. IFN-β can significantly modulate p53 phosphorylation at Ser-6,-15,-46, and -392 and acetylation status mainly at Lys-320. It has been also shown that p53 acetylation in Lys-320 is the first step in IFN-β-induced senescence in human fibroblasts [@pone.0036909-Moiseeva1].
DNA damage response is required for the activation of p53 in response to oncogenes. Oncogene induced senescence is accompained by DNA replicative stress, including prematurely terminated DNA replication forks and DNA double-strand breaks caused by hyper-DNA replication [@pone.0036909-DiMicco1]. Consistent with this, Ras-induced senescence is associated with activation of DNA damage response effectors, such as ATM/ATR and Chk2/Chk1, and inactivation of these DNA damage effectors by RNA interference attenuates oncogene induced senescence [@pone.0036909-Mallette1], [@pone.0036909-Toledo1]. We observed that the inhibition of ATM and ATR prevents IFN-β induction of senescence in K38 keratinocytes, suggesting that IFN-β might induce senescence through a p53-dependent DNA damage pathway (data not shown).
It has been reported that HPV16 E6 mediates resistance to IFN-induced senescence through inhibition of p53 acetylation by binding to CBP/p300. Conversely, treatment of HPV16 E7-expressing cells with IFN ultimately resulted in cellular senescence through a process that is dependent upon acetylation of p53 by CBP/P300 [@pone.0036909-Hebner2]. Moreover, HPV16 E7 up-regulates SIRT1, thus attenuating p53 activity via its deacetylation [@pone.0036909-Allison1]. It has been shown that HPV16 E6 can induce multiple site phosphorylation of p53 [@pone.0036909-Zhang1]. HPV38 E6 and E7 expression in human keratinocytes induces phosphorylation of p53, which leads to the up-regulation of ΔNp73 and the inhibition of p53 transcriptional induction of genes involved in growth suppression [@pone.0036909-Accardi1]. All together these observations indicate that p53 post-translational modifications are critical for p53 involvement in senescence programme induced by IFN-β and that modulation of p53 activity could be a common strategy utilized by both mucosal and cutaneous HPV to inhibit p53 function.
We report that by recruitment of p53 into NBs via PML induction, IFN-β may modulate p53 phosphorylation and acetylation status and downregulate ΔNp73 expression in K38 keratinocytes, leading to the recovery of p53 transactivating activity of selected target genes involved in cell proliferation control. Real time PCR array confirms that some genes involved in senescence and growth control are IFN-β-upregulated, in agreement with the reported observations [@pone.0036909-Bourdeau1] that modification of specific p53 phosphorylation and acetylation sites may correlate to the transactivation of growth related genes, suggesting a tissue and promoter-specific p53 activity regulation.
Our results contribute to one of the most interesting current research questions about the exact contribution of post-translational modification sites to the selectivity of the global transcriptional programme of p53. Other important questions remain to be answered to clarify the multitude and redundancy of p53 covalent post-translational modifications required for p53-dependent senescence. It is possible that no single specific post-translational modification leads to specific p53 gene transactivation activity, but each modification might help to regulate p53 function in a tissue and promoter-specific manner.
Materials and Methods {#s4}
=====================
Cell Cultures and Treatments {#s4a}
----------------------------
Primary human foreskin keratinocytes were transduced with empty retrovirus pLXSN (control), or with pLXSN38E6E7 or pLXSN16E6E7 as described by Caldeira et al., 2003 [@pone.0036909-Caldeira1] and were grown in KBM BulletKit (Lonza).
HPV16-positive cell line Caski and SiHa, HPV18-positive cell line HeLa, and HPV68-positive cell line ME180, obtained from the American Type culture Collection, were grown in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum.
Cells were maintained in a humidified atmosphere of 5.5% CO~2~ at 37°C.
Human recombinant IFN-β (Rebif; 3×10^8^ IU/mg of protein; Ares-Serono) was added to the medium at the concentration of 200 IU/ml.
Measurement of Cell Proliferation {#s4b}
---------------------------------
Transformed keratinocytes were seeded in triplicate at 10^5^ cells per 35 mm dish. After 24 h, IFN-β was added to the cultures for the indicated times. Adherent cells were detached with 0.05% trypsin-0.02% EDTA in PBS, suspended in growth medium, and counted in a hemocytometer. Viability was evaluated by trypan blue exclusion.
Flow Cytometry {#s4c}
--------------
For cell cycle analysis, cells were fixed in 70% ice-cold ethanol for at least 30 min. DNA staining was performed by incubating cells in PBS containing 0.18 mg/ml propidium iodide and 0.4 mg/ml DNase-free RNase. Cells were analysed on a FACScan flow cytometer (Becton and Dickinson).
BrdU Incorporation {#s4d}
------------------
To determine the number of S-phase nuclei, cells were plated in triplicate at 10^5^ cells per 35 mm dish, treated with IFN-β for different time points and incubated with 50 µM BrdU for the last 5 hours. Samples were fixed with 95% ethanol, 5% acetic acid, treated with 1.5 M HCl and stained with an anti-BrdU monoclonal antibody (Amersham) followed by a rhodamine conjugated goat anti-mouse antibody (Cappel).
Senescence-associated β-galactosidase Staining {#s4e}
----------------------------------------------
Cells were plated in 12 multi-well, 0,5×10^5^ cells per well, and treated with IFN-β at different time points. Senescent cells were quantified by counting cells displaying senescent-associated β-galactosidase activity at pH 6.0, assayed through Senescent Detection Kit (Calbiochem) following manufacturer's instruction.
Western Blot Analysis {#s4f}
---------------------
To analyse protein expression, control and IFN-β treated cells were lysed in SDS reducing sample buffer. Total cell extracts were clarified by centrifugation and boiled in the presence of 5% 2-Mercaptoethanol and 0.01% bromophenol blue. Protein concentration was determined (Bio-Rad Protein Assay) and 30 mg of total proteins were resolved on SDS-PAGE and transferred onto PVDF membrane (Amersham). The membranes were blocked with 5% skim milk dissolved in PBS-T and incubated with primary antibodies (mouse anti-p53; rabbit anti-p21 (Santa Cruz); rabbit anti-PML (Bethyl); rabbit anti-phospho-p53 Ser6, anti-phospho-p53 Ser15, anti-phospho-p53 Ser46, anti-phospho-p53 Ser392 (Cell Signaling); rabbit anti-acetyl-p53 Lys320, anti-acetyl-p53 Lys373/382 (Millipore), and anti-human β tubulin mouse IgG1 antibody (ICN), as an internal control. Immune complexes were detected with horseradish peroxidase-conjugated goat anti-rabbit and anti-mouse antiserums (ICN) followed by enhanced chemiluminescence reaction (Millipore).
PML, p53 and p21 silencing {#s4g}
--------------------------
Small interfering RNAs (siRNAs) targeted to PML, p53 and p21 were designed and validated by Qiagen and a non-silencing siRNA (Qiagen) served as control.
PML siRNAs were: 1) Sense:5′-CGUCUUUUUCGAGAGUCUGtt-3′;Antisense:5′-CAGACUCUCGAAAAAGACGtt-3′; 2)Sense:5′-CCCGCAAGACCAACAACAUtt-3′; Antisense: 5′-AUGUUGUUGGUCUUGCGGGtg-3′; 3)Sense:5′-GGGACCCUAUUGACGUUGAtt-3′; Antisense: 5′-UCAACGUCAAUAGGGUCCCtg-3′.
p53 siRNA were: 1) Sense:5′--GGAAAUUUGCGUGUGGAGUtt-3′; Antisense: 5′--CUCCACACGCAAAUUUCCtt-3′; 2) Sense: 5′-GCAUCUUAUCCGAGUGGAAtt-3′; Antisense: 5′-UUCCACUCGGAUAAGAUGCtg-3′; 3) Sense: 5′-GCAGUUAAGGGUUAGUUUAtt-3′; Antisense: 5′-UAAACUAACCCUUAACUGCaa-3′.
p21 siRNA (Dharmacon) was: Sense:5\'-GAUGGAACUUCGACUUUGUUU-3\': Antisense:5\'-PACAAAGUCGAAGUUCCAUCUU 3\'.
Shortly before transfection, 2×10^5^ cells per dish were seeded in 35 mm dishes in 1 ml of fully supplemented culture medium. siRNA was diluted in 50 µl culture medium without supplements to a final concentration of 10 nM. 3.5 µl of HiPerfect Transfection Reagent (Qiagen) were added to the diluted siRNA and mixed by vortexing. After an incubation of 10 min at room temperature, the transfection complex was added drop-wise onto the cells. 24 hrs post-transfection cells were treated with IFN-β for the indicated time points.
Immunofluorescence {#s4h}
------------------
Immunofluorescence staining of cells was performed on cells grown on Glass Bottom Culture Dishes 14 mm Microwell poly-d-lysine Coated from Mat Tek Corporation (Ashland, MA 01721 U.S.A.) and fixed with 4% formaldehyde, permeabilized with PBS/0.1% Triton-X, and stained using the following primary antibodies: anti-PML; ap53 (Santa Cruz), anti-ΔNp73 (Imgenex). Anti-mouse-Fitc (Cappel), anti-mouse-Alexa 546 (Molecular Probe \# A11030), and anti-rabbit-Alexa 610 (Molecular Probe \# A31551) were used as secondary antibodies. Sample were analyzed using confocal microscope (Leica TCS SP5). Software: LAS AF version 1.6.3 (Leica Microsystem).
Real-time PCR {#s4i}
-------------
Real-time PCR was carried out by using the MESA GREEN MasterMixes Plus, Low ROX (Eurogentec). The primer sequences are: Bax F: 5\' TTTGCT TCA GGG TTT CAT CC 3\', R: 5\' ATCCTC TGC AGC TCC ATG TT 3\'; Pig3 F: 5\' GCTTCA AAT GGC AGA AAA GC 3\', R: 5\' AACCCA TCG ACC ATC AAG AG 3\'.
We thank Roberto Gilardi for excellent editorial assistance.
**Competing Interests:**The authors have declared that no competing interests exist.
**Funding:**Research in our laboratory is currently funded in part by "Programmi di Ricerca Scientifica di Rilevante Interesse Nazionale (PRIN 2008) del Ministero dell'Istruzione, dell'Università e della Ricerca" and Progetti Ateneo, Sapienza University, 2009 and 2011. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
[^1]: Conceived and designed the experiments: MVC GF GR. Performed the experiments: MVC SV ZAP RA. Analyzed the data: MVC SV ZAP GV EA GF GR. Contributed reagents/materials/analysis tools: RA MT. Wrote the paper: MVC GF GR.
|
QuikTrip Founder Chester Cadieux Dies
Tuesday, March 15th 2016, 10:44 am
By: News On 6
Chester Cadieux, one of the two founders of QuikTrip convenience stores, has died.
The company says Cadieux died peacefully at his home in Tulsa Monday night. He was 84.
In a statement, the company said, "Chester's vision, keen wit, insistence on fairness, and marvelous ability to mentor people will never be forgotten."
The statement said Cadieux considered himself to be luckier than smart. He said his secret was to hire good people and promote from within.
Cadieux and Burt Holmes opened the first store in Tulsa in 1958. According to QuikTrip, Holmes came up with the idea of opening a small grocery store in Tulsa in 1957 after seeing successful 7-11 stores on a trip to Dallas. Holmes convinced his former classmate, Chester Cadieux, to invest in the store, calling it QuikTrip.
Chester's son Chet became president of QuikTrip in 2002. As of 2014, the company had 700 stores and was named to Fortune magazine's list of 100 Best Companies To Work For for the 12th straight year.
Tulsa Chamber of Commerce President Mike Neal issued the following statement on Cadieux's passing:
“Chester’s successful legacy as one of Tulsa’s most celebrated entrepreneurs is a testament to the stellar growth of the company he co-founded, QuikTrip, and its loyalty to its employees and commitment to its hometown.
We lost a true visionary business leader today, and our thoughts are with the Cadieux family and the entire QuikTrip organization.”
Learn More About Chester Cadieux's Story On John Erling's Voices Of Oklahoma |
Q:
How can I disconnect clients from MySQL?
I need an efficient way to disconnect all clients with a given username from MySQL. I thought about changing the users password but I think that is only checked when the connection is made.
Ideas?
A:
You could use "SQL to SQL" method below (just pass in extra connection options to mysql client as needed):
shell> mysql -NBe "SELECT CONCAT('KILL ', id, ';') FROM information_schema.processlist WHERE user = 'some_username';" | mysql -vv
Note: This works with MySQL 5.1 and 5.5. This would have to be implemented differently for older MySQL versions as information_schema does not have the processlist table.
Options used:
-N means that you do not want to get column names back.
-B puts it into batch mode, so that you do not get MySQL's table layout.
-e executes the following statement.
-v controls the verbosity, could be used up to three times.
Explanation of how it works:
First the KILL statements are generated along with IDs.
shell> mysql -NBe "SELECT CONCAT('KILL ', id, ';') FROM information_schema.processlist WHERE user = 'some_username';"
Sample output:
KILL 1061;
KILL 1059;
KILL 1057;
Then those statements are executed.
shell> mysql -NBe "SELECT CONCAT('KILL ', id, ';') FROM information_schema.processlist WHERE user = 'some_username';" | mysql -vv
Sample output:
--------------
KILL 1061
--------------
Query OK, 0 rows affected
--------------
KILL 1059
--------------
Query OK, 0 rows affected
--------------
KILL 1057
--------------
Query OK, 0 rows affected
|
F1 is developing several different onboard camera ideas and wants to introduce a shot that gives viewers a better view of what drivers can see from their crash helmets.
These developments are ongoing but include the possibility of two-time world champion Alonso, who is leaving F1 at the end of the season, trialling a new camera before the end of the season.
Alonso’s crash helmet supplier Bell has an option where the camera would be placed on the side of the helmet, level with the driver’s eyeline.
Discussions have already taken place about using Alonso to experiment with an onboard camera and Bell was keen to do something last weekend in the United States.
Fernando Alonso, McLaren Photo by: Steven Tee / LAT Images
However, it is understood that this was deemed too soon.
“We were thinking to test the camera together with Bell and FOM but at the end it didn’t happen this weekend,” said Alonso.
“I don’t know if it’s going to happen in the next weekends. It will be good to experiment.
“Maybe for the last race or something it would be a nice memory to have.”
Ensuring the output of the camera is broadcast-quality is an important factor but F1 views safety as the key parameter and there are steps it must go through if a camera is used that would interfere with the helmet itself.
While Bell’s camera would be mounted outside, F1 is understood to be working on other designs that include one that would be embedded in the internal padding of the helmet to the side of the driver’s head and level with their eyeline.
Anything that involves potentially altering the internals of the helmet needs to be greenlit by the helmet manufacturer but crucially the FIA, which is responsible for homologating designs. |
% -------------------------------------------------------------------------------------------------------------------------
function net = add_adjust_layer(net, name, input, output, params, gain, bias, lr_gain, lr_bias)
% -------------------------------------------------------------------------------------------------------------------------
net.addLayer(name, ...
dagnn.Conv('size', [1, 1, 1, 1]), ...
{input}, {output}, ...
params);
filters = net.getParamIndex(params{1});
biases = net.getParamIndex(params{2});
net.params(filters).value = single(gain);
net.params(biases).value = single(bias);
net.params(filters).learningRate = lr_gain;
net.params(biases).learningRate = lr_bias;
end |
China's Alibaba restructures online retailer Taobao
Taobao, China's largest online retailer, has split into three separate companies to better address its target markets, parent company Alibaba Group said Thursday.
The move could also foreclose a public listing of Taobao, an option that Yahoo, a stakeholder in Alibaba, had hoped would lead to an increase in the value of its investment, according to an analyst.
The restructuring creates Taobao Marketplace, a consumer-to-consumer platform designed for consumers and small businesses; Taobao Mall, a business-to-consumer marketplace; and eTao, which will target the shopping search market. All three companies will continue under the Alibaba Group.
Taobao currently dominates China's online retail market with a 71.6 percent share, according to Beijing-based research firm Analysys International. The site is very popular and reported reaching 370 million users at the end of 2010.
But Taobao, which first took off as a consumer-to-consumer site in 2003, has also been working to expand its e-commerce business. The site launched Taobao Mall in 2008, as a business-to-consumer platform that now features more than 30,000 international and domestic brands available to shoppers.
In an e-mail to Alibaba employees, company CEO Jack Ma said the company is making the move as e-commerce has faced "disruptive changes," pointing to social trends and the entrance of new companies in the market. "Significant change has taken place in customer demand," he said. "We need to offer consumers more sophisticated and customized services."
In spite of Alibaba's dominance in the overall e-commerce market, Taobao only has a 31.4 percent share of China's business-to-consumer market, according to Analysys International. Numerous competitors like Chinese electronics retailer 360buy and Amazon's Chinese site are all vying for the business.
Alibaba's eTao service also faces an uphill battle in its bid to get search engine users. China's Baidu is currently the country's largest search engine with a 75.8 percent share, and many users frequent the site to seek online goods, according to analysts. Alibaba aims to attract those users to its own eTao search platform, analysts said.
Even as the restructuring will allow the new companies to better focus on their core businesses, the move is also part of Alibaba's strategy to attract other players to take advantage of its platforms, according to Ma's letter.
Alibaba has tried to market its eTao as a search engine that shows results for all e-commerce companies, including rivals, said Mark Natkin, managing director of Beijing-based Marbridge Consulting. But Alibaba's competitors have been reluctant to support it, as eTao was operated by Taobao.
"At the moment, the perception within the industry is that Taobao is a competitor rather than a facilitator, so I think companies have been a little unsure if the eTao platform has their best interests at heart," he said. But now that eTao is a company on its own, other e-commerce players may be more be willing to support the search platform, Natkin added.
Still, some analysts question the timing of Alibaba's announcement and if more might be at play. The Chinese company has been involved in a recent dispute with Yahoo, which has a 43 percent stake in Alibaba.
The dispute arose when it was revealed last month that Alibaba Group decided to transfer its successful online payment service known as Alipay to a separate company controlled by Ma. By doing so, the move has threatened to devalue Yahoo's investment in Alibaba Group.
Alibaba defended the move and said it was done in order to obtain a license from the Chinese government to operate Alipay. But Yahoo fired back, arguing that the transfer in ownership occurred without the company's knowledge, a claim that Alibaba denies.
The dispute over Alipay underscores the ongoing discontent between the two companies over business issues. Last year, Alibaba held negotiations with Yahoo to buy back its stake, but those talks went nowhere.
Yahoo, however, may feel pressured to return to the negotiating table. It has been willing to "stomach" its difficult relationship with Alibaba because of the Chinese company's growing worth, Natkin said. Many believed Alibaba would list Taobao within the next 12 to 18 months, which would only further generate value for Yahoo's investment, he added.
Thursday's announcement, however, makes that more unlikely. Instead, Ma's letter said that the company "won't rule out" the possibility of taking Alibaba Group public. As a result, investors and Yahoo will probably have to wait longer for the company to list, Natkin said.
"It could put Yahoo in a situation (where) it has to make a decision: staying in a relationship where the romance has long ago faded, or go ahead and sell back its stake now to bring a conclusion to that relationship," Natkin added. |
Thermo-Quickleen
The Pies Have It ~ Aussie Cuisine?
by Tenina Holder
My Menus
After many requests and many more half started New Year's Posts (some of which will see the light of day, time permitting) this was a recipe I could get up on here quickly before the half way point of the first month of twenty ten was staring back at me. If last year was anything to go by, this year will feel like about 2 months, and I'll be adding Christmas recipes before I can finish singing Auld Lang Syne! Never one for weight loss resolutions, this will certainly not help in that department, but what the hell, Lets Get Fat this year!
Shortcrust Pastry...always easy in the Thermomix, but if you are Thermomix-less, feel free to buy or simply make by hand. Remember the colder your butter/hands/workbench the better. I have a fantastic new book Ratio by Michael Ruhlman which you should all rush out and buy...you will never need a recipe for pastry again, but for those of you without that book, this is for you;
Place flour, butter and salt into Thermo bowl and blend 3 sec/speed 6.
8
Add water through hole in lid as you continue to blend on speed 5 until pastry forms a ball. Remove from bowl and mold into flat disc. Chill whilst you make filling.
9
Roll shortcrust pastry out to 2mm thickness and line 6 large muffin holes in ‘Texas’ size muffin tin. Double line the base of each pie, by re rolling pastry and cutting to suit. Place in freezer until use.
10
Fill lined pie shells with cold mixture, top with puff pastry top. Cut cross slit in pastry and cook for 30-35 minutes until golden and puffy. Allow to cool slightly before removing from tray.
11
If you prefer to skip the whole shortcrust base thing, do so, use the ceramic pie dish (or dishes for individuals) and just use Puff Pastry as a topper...as shown. YUM!
Sous Vide Steak with Red Capsicum Puree
My Menus
Who am I?
Tenina Holder is a wife and mum and more recently grandmother, who started cooking for a living back in 2006.
Tenina has become the premium go to source for all thermomix expertise and of course fresh and easy recipes that work. Her cooking classes are sold out in literally hours, her cookbooks frequently appear on the Australian best seller lists and her Spin A Dinner app hovers around on top of the charts.
Her following is growing and global with people as far away as Chile and Kazakhstan loving her books and sending her email! Tenina is not afraid of salt, butter or sugar and believes chocolate is a health food. |
/*
* Copyright (C) 2010 Google Inc. All Rights Reserved.
* Copyright (C) 2013 Apple Inc. All Rights Reserved.
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions
* are met:
* 1. Redistributions of source code must retain the above copyright
* notice, this list of conditions and the following disclaimer.
* 2. Redistributions in binary form must reproduce the above copyright
* notice, this list of conditions and the following disclaimer in the
* documentation and/or other materials provided with the distribution.
*
* THIS SOFTWARE IS PROVIDED BY APPLE COMPUTER, INC. ``AS IS'' AND ANY
* EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE
* IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
* PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL APPLE COMPUTER, INC. OR
* CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL,
* EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO,
* PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR
* PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY
* OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
* (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE
* OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
*
*/
#ifndef DocumentEventQueue_h
#define DocumentEventQueue_h
#include "EventQueue.h"
#include <wtf/HashSet.h>
#include <wtf/ListHashSet.h>
#include <wtf/OwnPtr.h>
namespace WebCore {
class Document;
class Event;
class Node;
class DocumentEventQueue FINAL : public EventQueue {
public:
explicit DocumentEventQueue(Document&);
virtual ~DocumentEventQueue();
virtual bool enqueueEvent(PassRefPtr<Event>) OVERRIDE;
virtual bool cancelEvent(Event&) OVERRIDE;
virtual void close() OVERRIDE;
void enqueueOrDispatchScrollEvent(Node&);
private:
void pendingEventTimerFired();
void dispatchEvent(Event&);
class Timer;
Document& m_document;
OwnPtr<Timer> m_pendingEventTimer;
ListHashSet<RefPtr<Event>, 16> m_queuedEvents;
HashSet<Node*> m_nodesWithQueuedScrollEvents;
bool m_isClosed;
};
}
#endif // DocumentEventQueue_h
|
655 S.W.2d 654 (1983)
Virginia R. McCONNELL, Plaintiff-Respondent,
v.
ST. LOUIS COUNTY, Missouri and Robert E. Emerick, Defendants-Appellants.
No. 44512.
Missouri Court of Appeals, Eastern District, En Banc.
June 14, 1983.
Motion for Rehearing and/or Transfer Denied August 1, 1983.
Application to Transfer Denied September 20, 1983.
*655 Ben Ely, Jr., Victoria Spann Sheehan, St. Louis, for defendants-appellants.
Rene E. Lusser, St. Louis, for plaintiff-respondent.
Motion for Rehearing and/or Transfer to Supreme Court Denied August 1, 1983.
SMITH, Presiding Judge.
Defendant appeals from a judgment against it of $65,000 based on a jury verdict. The judgment was affirmed by a panel of this court and a motion for rehearing thereafter granted before an expanded panel. We now reverse the judgment in part.
The lawsuit arose from a one-bus accident occurring during a "Fall Foliage" outing sponsored by the defendant, St. Louis County. Mrs. McConnell was one of 40 persons who made claims as a result of the accident. She subsequently died from causes unrelated to the accident and her executrix was substituted as plaintiff. Her suit was brought against defendant and Robert Emerick, the bus driver, who was discharged in bankruptcy prior to trial.[1] Defendant confessed liability and offered to confess judgment for $20,300.90 which was rejected by plaintiff. That figure constituted the amount remaining of defendant's $800,000 liability insurance policy not already distributed to other claimants through settlement. The amount remaining was stipulated to by the parties.
On appeal defendant raises two issues. The first is that the judgment should have been entered for $20,300.90 because of the restrictions of Sec. 537.610, RSMo 1978, imposing a maximum liability of $800,000 on St. Louis County. The second point involves the correctness of a damage instruction. Because we agree with defendant's first contention and because it offered before trial to confess judgment for $20,300.90 we need not reach the second contention.
Plaintiff contends that Secs. 537.600 and 537.610 are not applicable here because the accident occurred while the county was exercising a proprietary rather than a governmental function.
In Jones v. State Highway Commission, 557 S.W.2d 225 (Mo. banc 1977), the Supreme Court abolished the doctrine of sovereign immunity prospectively for torts occurring "on and after August 15, 1978." The General Assembly responded to that decision by enacting Secs. 537.600-537.650. Sec. 537.600 provides that: "Such sovereign or governmental tort immunity as existed at common law in this state prior to September 12, 1977 [the date of Jones, supra], except to the extent waived, abrogated or *656 modified by statutes in effect prior to that date, shall remain in full force and effect;...." Prior to Jones, the courts held that municipalities were not protected by sovereign immunity for torts arising from their proprietary functions but were protected from such torts arising from their governmental functions. This distinction was not applicable to the state and its political subdivisions which were fully protected under the immunity doctrine for their tortious acts. Wood v. County of Jackson, 463 S.W.2d 834 (Mo.1971) [1, 2]; Payne v. County of Jackson, 484 S.W.2d 483 (Mo.1972). We specifically so held as to St. Louis County in Coleman v. McNary, 549 S.W.2d 568 (Mo.App.1977). See also, Connor v. Crawford County, 588 S.W.2d 532 (Mo.App.1979). Pre-Jones, school districts were treated as political subdivisions for immunity purposes. Rennie v. Belleview School District, 521 S.W.2d 423 (Mo. banc 1975) [2]; Smith v. Consolidated School District No. 2, 408 S.W.2d 50 (Mo. banc 1966) [4-6]. The governmental-proprietary distinction drawn as to municipal corporations, but not as to political subdivisions, created the anomalous situation that a plaintiff's right of recovery for the same tortious conduct depended on whether the tortfeasor was a municipality or a political subdivision such as a county. See, Wood v. County of Jackson, supra (Finch, J., Concurring). Nevertheless, the governmental-proprietary distinction was not applied pre-Jones to political subdivisions of the state.
Following passage of 537.600-537.610, the case of State ex rel. Allen v. Barker, 581 S.W.2d 818 (Mo. banc 1979), came before the court. That case involved an activity which could arguably fit either the governmental or the proprietary function as defined in municipality cases. The entity involved, however, was a school district, where theretofore the nature of the function made no difference. The court, seizing upon the language of Sec. 537.600, concluded that the reinstatement of pre-Jones law served to reinstate also the governmental-proprietary dichotomy. The court did not address the line of pre-Jones cases holding such dichotomy of function was inapplicable when determining immunity of political subdivisions other than municipalities. The court in Barker remanded the case to give the plaintiff an opportunity to amend the petition "to aver sufficient facts to bring the cause within the [proprietary] exception to the general doctrine of immunity." Barker does not specifically overrule any of the pre-Jones cases. Following Barker, three appellate decisions in reliance upon Barker have concluded that the immunity of a school district is to be determined with reference to the governmental-proprietary distinction. Allen v. Salina Broadcasting, Inc., 630 S.W.2d 225 (Mo.App.1982); Johnson v. Carthell, 631 S.W.2d 923 (Mo.App. 1982); Fowler v. Board of Regents, etc., 637 S.W.2d 352 (Mo.App.1982).
From Barker, Allen, Johnson and Fowler, plaintiff argues that all sovereign immunity is now determined by reference to the governmental-proprietary function test. We cannot interpret those cases so broadly. At most they serve to bring school districts into the fold with municipalities. But in the absence of an express statement that such a test is also to apply to counties, or an express overruling of the pre-Jones cases regarding counties, we are unable to conclude that Barker and its progeny intended such a sweeping result. We find it especially difficult to reach such a conclusion in view of the statutory language reinstating sovereign immunity as it existed prior to Jones. Prior to that decision, St. Louis County was immune from the suit brought by the plaintiff and we do not find that Barker changes that immunity. Plaintiff's right of recovery rests upon Sec. 537.600 and .610 to which we now turn.
Sec. 537.600 creates two situations in which sovereign immunity is waived, i.e.: (1) operation of motor vehicles and (2) condition of property. Plaintiff's cause of action is clearly within the first situation. In Bartley v. Special School District of St. Louis County, 649 S.W.2d 864 (Mo. banc 1983), the Supreme Court held that in addition to those situations the public entity must have purchased liability insurance (or establish a self-insurance plan) for the *657 waiver to be effective. That was also done here. The limits of plaintiff's recovery against St. Louis County must be determined by reference, therefore, to Sec. 537.610.
In pertinent part that Section provides:
"(1) ... but the maximum amount of such coverage shall not exceed eight hundred thousand dollars for all claims arising out of a single occurrence ... and no amount in excess of the above limits shall be awarded or settled upon. Sovereign immunity for the state of Missouri and its political subdivisions is waived only to the maximum amount of and only for the purposes covered by such policy of insurance....
(2) The liability of the state and its public entities on claims within the scope of sections 537.600 to 537.650 shall not exceed eight hundred thousand dollars for all claims arising out of a single accident or occurrence ...." (Emphasis supplied)
In our divisional opinion we held that determination of the amount that plaintiff could recover on this judgment was premature and that resolution of that issue should await attempts to collect the judgment. Upon reconsideration it appears that such a holding overlooks the doctrine barring collateral attack on a judgment and the language of Sec. 537.610. As was stated in Hammett v. Hatton, 189 Mo.App. 567, 176 S.W. 1078 (1915) [1]:
"... validity of a judgment cannot be impeached on a motion to quash an execution issued on it. Such a motion cannot be based on the ground of mere error or irregularity in the judgment. The jurisdiction not being questioned, and the judgment not having been reversed, vacated or set aside, such a motion would constitute a collateral attack on it."
A motion to quash an execution cannot be substituted for an appeal and a defense which might have been valid in the underlying proceeding cannot be raised in a collateral proceeding such as a motion to quash execution. First National Bank in Chester v. Connor, 485 S.W.2d 667 (Mo.App. 1972) [2-6].[2]
It is also clear from Sec. 537.610 that no amount in excess of the statutory limit may be "awarded or settled upon." The statute does not speak to collection, but rather to award. It further provides that immunity is waived only to the extent of the limits set forth in the statute and that is the extent of the liability of the public entity. This language indicates to us that the judgment entered must conform to the statutory limits imposed by the General Assembly. Had this claim been the only one made for this accident and had the verdict exceeded the $100,000 one-claimant limit we would have no doubt that the judgment to be entered would have to have been $100,000. We can see no difference where the parties have stipulated that the amount already paid in settlement brings the jury award above the statutory limit. While the judgment normally follows the verdict, this is not inevitably true. Where the amount of recovery is limited as a matter of law, the judgment of the court must reflect that limitation regardless of the verdict. See, for example, MAI 4.11, Notes on Use 2; Parker v. Pan American World Airways, Inc., 447 S.W.2d 731 (Tex.Civ.App.1969) [1, 2]. The liability of the County under the statute was limited to $20,300.90 as a matter of law and the judgment of the court should have been for that amount.
We address two additional issues raised by plaintiff. The first is a contention that she is entitled to a pro rata share *658 of the amount of her verdict equivalent to the percentage that $800,000 bears to the total amount of settlements plus her verdict. This contention is based upon 537.610.4. That subparagraph provides an optional procedure which is available to any party. It does not impose any mandatory requirement upon the public entity to seek apportionment. Nor could such an apportionment proceeding increase the liability of the public entity beyond the limit statutorily established. If that subparagraph is available to give plaintiff an additional recovery, that recovery cannot come from defendant.[3]
Plaintiff also contends the judgment should be left intact to protect her rights against the County's insurer for bad faith settlement and disbursement of the $800,000. Normally, bad faith refusal to settle (which plaintiff claims here) creates a cause of action by the insured against the insurer who has subjected the insured to liability beyond the limits of the policy. That, of course, is not the situation here. The County's liability is limited to $800,000 and exhaustion of the insurance proceeds does not render it liable for the overage. Some courts have recognized an obligation of the insurance company to deal fairly with all claimants and have allowed suits directly against the insurer by claimants in situations not unlike this one where allegations of bad faith settlement are made. See, Haas v. Mid America Fire & Marine Ins. Co., 35 Ill.App.3d 993, 343 N.E.2d 36 (1976); Alford v. Textile Ins. Co., 248 N.C. 224, 103 S.E.2d 8 (1958); Bartlett v. Travelers' Ins. Co., 117 Conn. 147, 167 A. 180 (1933). We do not reach the availability or merits of such an action here. Plaintiff's verdict is a matter of record, and we are unable to see how our reduction of the judgment against the county to the limits established by law can preclude plaintiff from establishing the amount of her loss under such a theory. We, of course, do not intimate that such bad faith exists, we merely recognize plaintiff's contention that it does.
Judgment reversed and cause remanded with directions to enter judgment for plaintiff and against defendant St. Louis County for $20,300.90.
REINHARD, STEPHAN, SNYDER, SATZ, SIMON and KAROHL, JJ., concur.
PUDLOWSKI, J., dissents.
KELLY, J., joins in dissent.
PUDLOWSKI, Judge, dissenting.
I respectfully dissent for the reasons set forth in my previous authored opinion hereinafter stated. I would affirm the circuit court's judgment.
The relevant facts are as follows: On October 12, 1978, plaintiff-respondent Virginia McConnell was one of approximately 43 passengers of a St. Louis County bus as part of the Fall Color Tour. Ms. McConnell, then aged 79 years and an active lady, suffered severe personal injuries when the bus overturned upon leaving the roadway. She sustained fractured ribs, a collapsed lung, a fracture of the right humerus, a pelvic fracture, and a fracture of the right clavicle. For several months following the accident, she underwent rehabilitation and therapy for these injuries. On November 21, 1979, Ms. McConnell died, for reasons unrelated to the bus accident. Virginia Klamon, her daughter and executrix of her estate, was substituted as nominal plaintiff on April 17, 1980.
Respondent's claim was one of 40 claims brought against St. Louis County and Robert E. Emerick, the driver of the bus, who has since been discharged under bankruptcy. The claims were brought under RSMo § 537.600. Under the statute the common law governmental tort immunity is effective except for limited exceptions: injuries *659 arising from the negligent acts or omissions by public employees arising out of the operation of motor vehicles (§ 537.600(1)), and injuries caused by the condition of the public entity's property if the property was in a dangerous condition at the time of the injury (§ 537.600(2)).
According to § 537.610, the total extent of a public entity's liability "shall not exceed eight hundred thousand dollars for all claims arising out of a single accident or occurrence and shall not exceed one hundred thousand dollars for any one person in a single accident or occurrence, except [under Missouri Workmen's Compensation Law]." Appellant St. Louis County's insurance carrier, The Hartford Accident and Indemnity Company, made settlements with the 39 other claimants from the bus accident, leaving a balance of $20,300.90 with which to reimburse the last claimant, Virginia McConnell.
At trial, the jury awarded Ms. McConnell $65,000. Appellant St. Louis County contends that the trial judge erred in failing to set aside the judgment of $65,000 and enter a judgment in the amount of $20,300.90 because appellant alleges that St. Louis County could not be liable beyond the $800,000.00 for all claims arising out of this single accident. I disagree and would affirm the judgment of the trial court.
The trial court did not err in refusing to set aside the jury award of $65,000. Appellant's argument as to liability is premature. As I understand the statute, the public entity may be subject in situations similar to this set of facts to money judgments and claims in excess of $800,000 but is responsible for payment of $800,000. Under the sovereign immunity statute, § 537.610(4) clearly contemplates and makes provisions for the possibility that the total amount of the awards and settlements chargeable against the County may exceed $800,000. The statute clearly provides that an apportionment, or pro-rata distribution may be made if the total sum of awards and settlements exceeds such amount. Section 547.610(4) provides in full:
If the amount awarded to or settled upon multiple claimants exceeds eight hundred thousand dollars, any party may apply to any circuit court to apportion to each claimant his proper share of the total amount limited by subsection 1 of this section. The share apportioned each claimant shall be in the proportion that the ratio of the award or settlement made to him bears to the aggregate awards and settlements for all claims arising out of the accident or occurrence, but the share shall not exceed one hundred thousand dollars. (emphasis added).
Respondent claims that she is entitled to her proportion as set forth in this statute. Respondent contends that a reduction of the judgment from $65,000 to $20,300.90, which is the residue of the $800,000, would deny her the right to a fair proportionate share as provided under this section of the statute. I need not address the issue of the appropriate dollar value to be placed on respondent's claim under the statute because that issue of collection and the issue of enforcement of this judgment are not presently before us.
Appellant also alleges that the court erred in submitting plaintiff's verdict directing Instruction No. 4, M.A.I. 31.07 because it was misleading and confusing. I disagree. Taking all the instructions as a whole, I do not find that the jury was mislead or confused in their instructions to adequately compensate the deceased Virginia McConnell for any damages she sustained as to the accident. I would dispose of this point pursuant to Rule 84.16(b). I find no error of law and an extended opinion on this point would have no precedential value.
Therefore, I would affirm the decision of the trial court as to the validity of the judgment and as to the appropriateness of the jury instruction.
NOTES
[1] Both Emerick and St. Louis County have appealed. On appeal Emerick challenges only the court's damage instruction. Emerick was retained in the suit for "orderly prosecution" of the cause. We do not find it necessary to address the instruction question solely because Emerick is a named appellant.
[2] Some cases have indicated that such collateral attacks are available where the record "affirmatively discloses that the judgment is void" (McDougal v. McDougal, 279 S.W.2d 731 (Mo. App.1955) [31-33]) or partially void (Kennedy v. Boden, 241 Mo.App. 86, 231 S.W.2d 862 (1950) [3, 4]). We are not convinced that the stipulation in the record of the amounts paid to other claimants is the necessary affirmative disclosure in the record that the judgment is partially void sufficient to support a collateral attack. Nor does it serve judicial efficiency to avoid the issue on direct appeal of the judgment and force it to be litigated collaterally on execution of the judgment.
[3] We need not decide whether that subparagraph affords any practical remedy in cases such as this. The language is in the past tense indicating that apportionment cannot be sought until after awards have been made or settlements arrived at. We entertain serious doubts that such a procedure could be utilized to require payment back from claimants who have contractually settled their claims, thereby infringing on those contracts which in many cases involve compromise of anticipated judgments.
|
Synthesis and preliminary pharmacological studies on dihydropyrido-1,3,4-triazepinone derivatives.
New 4,5-dihydropyrido-[2,3-e]-1,3,4-triazepin-5-one derivatives (2-9) were synthesized. The preliminary pharmacological tests revealed antinociceptive action of compounds 4-7 and 9 and antianxiety action of compound 4. |
// Copyright (c) 2012 The Chromium Authors. All rights reserved.
// Use of this source code is governed by a BSD-style license that can be
// found in the LICENSE file.
#include "ppapi/shared_impl/ppapi_switches.h"
namespace switches {
// Enables the testing interface for PPAPI.
const char kEnablePepperTesting[] = "enable-pepper-testing";
// Specifies throttling time in milliseconds for PpapiHostMsg_Keepalive IPCs.
const char kPpapiKeepAliveThrottle[] = "ppapi-keep-alive-throttle";
} // namespace switches
|
I say "people", not "athletes" because Taylor is much more than a phenomenal running back and stellar athlete, he is a person who cares and respects the game of football, his peers, and carries himself in an unselfish and professional manner that is almost unique in today’s "there is an I in team" attitude.
The NFL is filled with middle-of-the-road players like Adam Jones who have no problem taking what they have for granted and can’t stay out of trouble.
There is also the unique case of Michael Vick, who is arguably one of the best athletes in NFL history and who made a terrible off-field decision which landed him in prison, bankrupt, and the face of dog fighting in America.
It isn't uncommon for veteran players to sit out of voluntary mini-camps and summer workouts because of their age and experience.
It is understandable that when players begin to age, staying healthy can be more of a chore than when they were young. The threat of a career ending injury during a preseason drill becomes much more real towards the end of a players career.
Unfortunately, it is also common to see players sitting out of these drills because they simply don't think they need to attend. They believe the team is lucky to have signed them, and they will perform when they are ready to perform.
Family issues, age, and veteran status aside, we all know players will stay away from camp for ridiculous reasons every year. A player who wants a larger salary, bigger bonus, longer contract extension, etc., will put all of these issues above the team.
So why is Fred Taylor, an 11-year veteran of the NFL who has over 11,000 rushing yards and over 12,000 total yards from scrimmage, acting the polar opposite of this “superstar” attitude?
The answer is simple, Fred is the rare breed of NFL athlete who can appreciate where he is, and what he does.
Taylor showed up ready to learn at New England's preseason workouts. “I decided to come out here with the rookies and the other guys returning to the team. It’s fun getting to know my teammates, getting to know all the different faces around here."
Taylor's attitude and outlook toward his new team and situation should be the blueprint for NFL players, regardless if you are the new hotshot rookie, or the veteran who has been proving himself for years.
Showing an effort, desire, and eagerness to meet your new team and striving to become a productive member of an organization are aspects of a player that are just as important for coaches to consider as age or accomplishments.
Take a look at the 2005 NFL draft. Adam "Pacman" Jones was picked sixth overall by the Titans. He was involved in several incidents (according to the Titans organization) immediately following the draft, and then skipped most of the preseason workouts because he was holding out over "contract issues."
Jones had a decent rookie season, he didn't make the Pro Bowl but he still put up respectable numbers. The Titans spent the rest of their time with Jones trying to calm him down and work with him so he would stop being involved in off-field issues.
After Jones was suspended for a year, he was traded to Dallas where his issues continued until he finally became the main event on Pros vs. Joes.
Fast forward to the second round of the 2005 NFL draft where Justin Miller, a cornerback out of Clemson, was picked up by the New York Jets.
Miller didn't have all the dazzling statistics at Clemson that Jones had at West Virginia; however, Miller never had any major character issues in college or immediately following the draft.
Miller went on to make the Pro Bowl in 2006, and after a season-ending knee injury was traded to the Raiders. Once in Oakland, Miller didn't hold out, and didn’t get into trouble.
Instead, he spent his time working out with the team and rehabbing his knee, and in 2008 had back-to-back games with kickoff returns for over 90 yards earning himself Special Teams Player of the Month for December, 2008.
The Vick situation is as big a headache as it is unique. Vick has more athletic ability than most people have ever seen which is why it gives fans of the NFL such a headache that he could throw it away so easily.
Anyone who appreciates athleticism can say they enjoyed watching Vick run all over defenses, and his arm strength is amazing (although his accuracy needs some work).
Vick didn't get the slap on the wrist that Jones did for fighting other humans and being involved in altercations that involved handguns.
Vick had the book thrown in his face and spent a good chunk of time in a federal prison for dog fighting.
Not to mention becoming the poster boy for animal cruelty in a society where dog fighting happens all the time, just ask Clinton Portis.
As far as athletic ability, Adam Jones was an average (if that) defensive back and return man who couldn't play anything other than those two positions, while Vick's athletic ability is questioned by no one and he could theoretically play running back, receiver, and quarterback.
Taylor is a phenomenal running back, but he has remained out of trouble and is getting ready to win another championship.
Adam Jones, more than likely, will never play in the NFL again, let alone start. He has been in the same sort of trouble over and over again and continues to deny involvement and give sob-story explanations for why he was even at the location of the incidents.
Michael Vick took the blame, and even though he didn't expect to have the book thrown at him, he accepted the consequences for his actions.
It's sad that the NFL and its fans have to deal with the ignorance and disregard of some players. Adam Jones will likely never play on an NFL field again.
Michael Vick absolutely deserves another shot at the NFL and has already proved himself as a worthy athlete; however, the dog fighting issue (regardless of how he accepted his punishment) was a major step in the wrong direction and resulted in him sitting out what could have been two of the most productive seasons in his career.
Fred Taylor is handling his transition to his first new team since signing with the Jaguars like a true professional and should be a role model for the Joneses and Vicks of the league.
Not only will his athleticism help the Patriots win games, his attitude will help bond a locker room and keep morale high as New England tries to take back its crown as the dynasty of the decade. |
<?php
/**
* This file implements additional functional for widgets.
*
* This file is part of the b2evolution/evocms project - {@link http://b2evolution.net/}.
* See also {@link https://github.com/b2evolution/b2evolution}.
*
* @license GNU GPL v2 - {@link http://b2evolution.net/about/gnu-gpl-license}
*
* @copyright (c)2003-2020 by Francois Planque - {@link http://fplanque.com/}.
* Parts of this file are copyright (c)2004-2005 by Daniel HAHLER - {@link http://thequod.de/contact}.
*
* @package evocore
*
* {@internal Below is a list of authors who have contributed to design/coding of this file: }}
*
*/
if( !defined('EVO_CONFIG_LOADED') ) die( 'Please, do not access this page directly.' );
load_class( '_core/ui/_table.class.php', 'Table' );
/**
* Get config array of default widgets for install, upgrade and new collections
*
* @param string Collection kind: 'minisite', 'main', 'std', 'photo', 'forum', 'manual', 'group'
* @param integer Collection ID
* @param boolean Should be true only when it's called after initial install
* @return array
*/
function get_default_widgets( $kind = '', $blog_id = NULL, $initial_install = false )
{
global $DB, $install_test_features, $installed_collection_info_pages;
// Handle all blog IDs which can go from function create_demo_contents()
global $blog_minisite_ID, $blog_home_ID, $blog_a_ID, $blog_b_ID, $blog_photoblog_ID, $blog_forums_ID, $blog_manual_ID, $events_blog_ID;
global $demo_poll_ID;
$blog_minisite_ID = intval( $blog_minisite_ID );
$blog_home_ID = intval( $blog_home_ID );
$blog_a_ID = intval( $blog_a_ID );
$blog_b_ID = intval( $blog_b_ID );
$blog_photoblog_ID = intval( $blog_photoblog_ID );
$blog_forums_ID = intval( $blog_forums_ID );
$blog_manual_ID = intval( $blog_manual_ID );
$events_blog_ID = intval( $events_blog_ID );
$demo_poll_ID = intval( $demo_poll_ID );
// Init insert widget query and default params
$default_blog_param = 's:7:"blog_ID";s:0:"";';
if( $initial_install && ! empty( $blog_photoblog_ID ) )
{ // In the case of initial install, we grab photos out of the photoblog (Blog #4)
$default_blog_param = 's:7:"blog_ID";s:1:"'.intval( $blog_photoblog_ID ).'";';
}
$default_widgets = array();
/* Header */
$default_widgets['header'] = array(
array( 1, 15000, 'coll_title' ),
array( 2, 15000, 'coll_tagline' ),
);
/* Menu */
$default_widgets['menu'] = array(
'coll_type' => '-main', // Don't add widgets to Menu container for Main collections
array( 5, 15000, 'basic_menu_link', 'coll_type' => '-minisite', 'params' => array( 'link_type' => 'home' ) ),
array( 7, 15000, 'mustread_menu_link', 'is_pro' => true, 'coll_type' => '-main,minisite' ),
array( 8, 15000, 'flag_menu_link', 'coll_type' => 'forum,group', 'params' => array( 'link_type' => 'latestcomments', 'link_text' => T_('Flagged topics') ) ),
array( 8, 15000, 'flag_menu_link', 'coll_type' => 'manual', 'params' => array( 'link_type' => 'latestcomments', 'link_text' => T_('Flagged pages') ) ),
array( 10, 15000, 'basic_menu_link', 'coll_ID' => $blog_b_ID, 'params' => array( 'link_type' => 'recentposts', 'link_text' => T_('News') ) ),
array( 13, 15000, 'basic_menu_link', 'coll_type' => 'forum', 'params' => array( 'link_type' => 'recentposts', 'link_text' => T_('Latest topics') ) ),
array( 15, 15000, 'basic_menu_link', 'coll_type' => 'forum', 'params' => array( 'link_type' => 'latestcomments', 'link_text' => T_('Latest replies') ) ),
array( 13, 15000, 'basic_menu_link', 'coll_type' => 'manual', 'params' => array( 'link_type' => 'recentposts', 'link_text' => T_('Latest pages') ) ),
array( 15, 15000, 'basic_menu_link', 'coll_type' => 'manual', 'params' => array( 'link_type' => 'latestcomments', 'link_text' => T_('Latest comments') ) ),
array( 18, 15000, 'basic_menu_link', 'coll_type' => 'photo', 'params' => array( 'link_type' => 'mediaidx', 'link_text' => T_('Index') ) ),
array( 20, 15000, 'basic_menu_link', 'coll_type' => 'forum', 'params' => array( 'link_type' => 'users' ) ),
array( 21, 15000, 'basic_menu_link', 'coll_type' => 'forum', 'params' => array( 'link_type' => 'visits' ) ),
array( 25, 15000, 'coll_page_list' ),
array( 30, 15000, 'basic_menu_link', 'coll_type' => 'forum', 'params' => array( 'link_type' => 'myprofile' ), 'enabled' => 0 ),
array( 33, 15000, 'basic_menu_link', 'coll_type' => 'std', 'params' => array( 'link_type' => 'catdir' ) ),
array( 35, 15000, 'basic_menu_link', 'coll_type' => 'std', 'params' => array( 'link_type' => 'arcdir' ) ),
array( 37, 15000, 'basic_menu_link', 'coll_type' => 'std', 'params' => array( 'link_type' => 'latestcomments' ) ),
array( 50, 15000, 'msg_menu_link', 'params' => array( 'link_type' => 'messages' ), 'enabled' => 0 ),
array( 60, 15000, 'basic_menu_link', 'params' => array( 'link_type' => 'ownercontact', 'show_badge' => 0 ), 'enabled' => ( $kind == 'minisite' ) ),
array( 70, 15000, 'basic_menu_link', 'params' => array( 'link_type' => 'login' ), 'enabled' => 0 ),
array( 80, 15000, 'basic_menu_link', 'coll_type' => 'forum', 'params' => array( 'link_type' => 'register' ) ),
);
/* Item List */
$default_widgets['item_list'] = array(
array( 10, 15190, 'coll_item_list_pages' ),
);
/* Item in List */
$default_widgets['item_in_list'] = array(
array( 10, 15190, 'item_title' ),
array( 20, 15190, 'item_visibility_badge', 'coll_type' => '-manual' ),
array( 30, 15190, 'item_info_line', 'coll_type' => '-manual' ),
array( 40, 15720, 'item_content' ),
array( 50, 15760, 'item_info_line', 'coll_type' => '-manual,forum', 'params' => array( 'template' => 'item_details_feedback_link' ) ),
);
/* Item Single Header */
$default_widgets['item_single_header'] = array(
array( 4, 15190, 'item_next_previous', 'coll_type' => '-manual,minisite' ),
array( 5, 15190, 'item_title' ),
array( 10, 15000, 'item_info_line', 'coll_type' => 'forum,group', 'params' => array( 'template' => 'item_details_infoline_forums' ) ),
array( 20, 15000, 'item_tags', 'coll_type' => 'forum,group' ),
array( 30, 15000, 'item_seen_by', 'coll_type' => 'forum,group' ),
array( 8, 15190, 'item_visibility_badge', 'coll_type' => '-manual,forum,group' ),
array( 10, 15000, 'item_info_line', 'coll_type' => '-manual,forum,group' ),
);
/* Item Single */
$default_widgets['item_single'] = array(
array( 4, 15590, 'breadcrumb_path', 'coll_type' => 'manual' ),
array( 5, 15190, 'item_visibility_badge', 'coll_type' => 'manual' ),
array( 7, 15190, 'item_title', 'coll_type' => 'manual' ),
array( 10, 15000, 'item_content' ),
array( 15, 15000, 'item_attachments', 'coll_type' => '-manual' ),
array( 17, 15000, 'item_link', 'coll_type' => '-manual' ),
array( 18, 15000, 'item_workflow', 'coll_type' => 'photo' ),
array( 20, 15000, 'item_tags', 'coll_type' => '-forum,group,manual', 'coll_ID' => '-'.$blog_a_ID.','.$events_blog_ID ),
array( 25, 15000, 'item_about_author', 'coll_ID' => $blog_b_ID ),
array( 40, 15000, 'item_small_print', 'coll_ID' => $blog_a_ID, 'params' => array( 'template' => 'item_details_smallprint_standard' ) ),
array( 40, 15000, 'item_small_print', 'coll_type' => 'manual', 'params' => array( 'template' => 'item_details_revisions' ) ),
array( 50, 15000, 'item_seen_by', 'coll_type' => '-forum,group,manual' ),
array( 60, 15000, 'item_vote', 'coll_type' => '-forum,group,manual' ),
);
/* Item Page */
$default_widgets['item_page'] = array(
array( 10, 15000, 'item_content' ),
array( 15, 15000, 'item_attachments' ),
array( 50, 15000, 'item_seen_by' ),
array( 60, 15000, 'item_vote', 'coll_type' => '-forum,group' ),
);
/* Comment List */
$default_widgets['comment_list'] = array();
/* Comment Area */
$default_widgets['comment_area'] = array(
array( 5, 15300, 'fin_contrib', 'coll_type' => 'forum', 'type' => 'plugin' ),
array( 10, 15300, 'item_comment_form' ),
array( 20, 15300, 'item_comment_notification' ),
array( 30, 15300, 'coll_item_notification' ),
array( 40, 15300, 'coll_comment_notification' ),
array( 50, 15300, 'item_comment_feed_link' ),
);
/* Sidebar Single */
$default_widgets['sidebar_single'] = array(
array( 1, 15000, 'item_workflow', 'coll_type' => 'forum,group,manual' ),
array( 5, 15000, 'coll_related_post_list', 'coll_type' => 'forum' ),
array( 10, 15000, 'item_vote', 'coll_type' => 'manual' ),
array( 20, 15000, 'item_tags', 'coll_type' => 'manual' ),
array( 30, 15000, 'item_attachments', 'coll_type' => 'manual' ),
array( 40, 15000, 'item_link', 'coll_type' => 'manual' ),
array( 50, 15000, 'item_custom_fields', 'coll_type' => 'manual' ),
array( 60, 15000, 'item_seen_by', 'coll_type' => 'manual' ),
);
/* Page Top */
$default_widgets['page_top'] = array(
array( 10, 15000, 'social_links', 'params' => array(
'link1' => 'twitter',
'link1_href' => 'https://twitter.com/b2evolution/',
'link2' => 'facebook',
'link2_href' => 'https://www.facebook.com/b2evolution',
'link3' => 'linkedin',
'link3_href' => 'https://www.linkedin.com/company/b2evolution-net',
'link4' => 'github',
'link4_href' => 'https://github.com/b2evolution/b2evolution',
) ),
array( 20, 15450, 'coll_locale_switch' ),
);
/* Sidebar */
if( $kind == 'manual' )
{
$default_widgets['sidebar'] = array(
'coll_type' => 'manual',
array( 10, 15000, 'coll_search_form', 'params' => array( 'title' => T_('Search this manual:'), 'template' => 'search_form_simple' ) ),
array( 20, 15000, 'content_hierarchy' ),
);
}
else
{
// Special checking to don't install several Sidebar widgets below for collection 'Forums':
$install_not_forum = ( ( ! $initial_install || $blog_id != $blog_forums_ID ) && $kind != 'forum' );
if( $blog_id == $blog_home_ID )
{ // Advertisements, Install only for collection #1 home collection:
$advertisement_type_ID = $DB->get_var( 'SELECT ityp_ID FROM T_items__type WHERE ityp_name = "Advertisement"' );
}
if( ! empty( $blog_home_ID ) && ( $blog_id == $blog_a_ID || $blog_id == $blog_b_ID ) )
{
$sidebar_type_ID = $DB->get_var( 'SELECT ityp_ID FROM T_items__type WHERE ityp_name = "Sidebar link"' );
}
$default_widgets['sidebar'] = array(
array( 5, 15000, 'coll_current_filters', 'coll_type' => '-forum', 'install' => $install_test_features ),
array( 10, 15000, 'user_login', 'install' => $install_test_features ),
array( 15, 15000, 'user_greetings', 'install' => $install_test_features ),
array( 20, 15000, 'user_profile_pics', 'install' => $install_not_forum ),
array( 30, 15000, 'evo_Calr', 'type' => 'plugin', 'install' => ( $install_not_forum && $blog_id > $blog_a_ID ) ),
array( 40, 15000, 'coll_longdesc', 'install' => $install_not_forum, 'params' => array( 'title' => '$title$' ) ),
array( 50, 15000, 'coll_search_form', 'install' => $install_not_forum, 'params' => array( 'template' => 'search_form_simple' ) ),
array( 60, 15000, 'coll_category_list', 'install' => $install_not_forum ),
array( 70, 15000, 'coll_item_list', 'coll_ID' => $blog_home_ID, 'install' => $install_not_forum, 'params' => array(
'title' => 'Advertisement (Demo)',
'item_type' => empty( $advertisement_type_ID ) ? '#' : $advertisement_type_ID,
'blog_ID' => $blog_id,
'order_by' => 'RAND',
'limit' => 1,
'disp_title' => false,
'item_title_link_type' => 'linkto_url',
'attached_pics' => 'first',
'item_pic_link_type' => 'linkto_url',
'thumb_size' => 'fit-160x160',
) ),
array( 80, 15000, 'coll_media_index', 'coll_ID' => '-'.$blog_b_ID, 'install' => $install_not_forum, 'params' => 'a:11:{s:5:"title";s:12:"Random photo";s:10:"thumb_size";s:11:"fit-160x120";s:12:"thumb_layout";s:4:"grid";s:12:"grid_nb_cols";s:1:"1";s:5:"limit";s:1:"1";s:8:"order_by";s:4:"RAND";s:9:"order_dir";s:3:"ASC";'.$default_blog_param.'s:11:"widget_name";s:12:"Random photo";s:16:"widget_css_class";s:0:"";s:9:"widget_ID";s:0:"";}' ),
array( 90, 15000, 'coll_item_list', 'coll_ID' => $blog_a_ID.','.$blog_b_ID, 'install' => $install_not_forum, 'params' => array(
'blog_ID' => $blog_home_ID,
'item_type' => empty( $sidebar_type_ID ) ? '#' : $sidebar_type_ID,
'title' => 'Linkblog',
'item_group_by' => 'chapter',
'item_title_link_type' => 'auto',
'item_type_usage' => 'special',
) ),
array( 90, 15000, 'user_avatars', 'coll_type' => 'forum', 'params' => array(
'title' => 'Most Active Users',
'limit' => 6,
'order_by' => 'numposts',
'rwd_block_class' => 'col-lg-3 col-md-3 col-sm-4 col-xs-6'
) ),
array( 100, 15000, 'coll_xml_feeds' ),
array( 110, 15000, 'mobile_skin_switcher' ),
);
}
/* Sidebar 2 */
$default_widgets['sidebar_2'] = array(
'coll_type' => '-forum',
array( 1, 15000, 'coll_post_list' ),
array( 5, 15000, 'coll_item_list', 'coll_ID' => $blog_b_ID, 'params' => array(
'title' => 'Sidebar links',
'order_by' => 'RAND',
'item_title_link_type' => 'auto',
'item_type_usage' => 'special',
) ),
array( 10, 15000, 'coll_comment_list' ),
array( 15, 15000, 'coll_media_index', 'params' => 'a:11:{s:5:"title";s:13:"Recent photos";s:10:"thumb_size";s:10:"crop-80x80";s:12:"thumb_layout";s:4:"flow";s:12:"grid_nb_cols";s:1:"3";s:5:"limit";s:1:"9";s:8:"order_by";s:9:"datestart";s:9:"order_dir";s:4:"DESC";'.$default_blog_param.'s:11:"widget_name";s:11:"Photo index";s:16:"widget_css_class";s:0:"";s:9:"widget_ID";s:0:"";}' ),
array( 20, 15000, 'free_html', 'params' => 'a:5:{s:5:"title";s:9:"Sidebar 2";s:7:"content";s:166:"This is the "Sidebar 2" container. You can place any widget you like in here. In the evo toolbar at the top of this page, select "Collection", then "Widgets…".";s:11:"widget_name";s:9:"Free HTML";s:16:"widget_css_class";s:0:"";s:9:"widget_ID";s:0:"";}' ),
);
/* Front Page Main Area */
$default_widgets['front_page_main_area'] = array(
array( 1, 15000, 'coll_title', 'coll_type' => 'main,minisite' ),
array( 2, 15000, 'coll_tagline', 'coll_type' => 'minisite' ),
array( 5, 15000, 'free_text', 'coll_type' => 'main', 'params' => array(
'content' => T_('This is the Home page of your site.')."\n\n"
.T_('More specifically it is the "Front page" of the first collection of your site. This first collection is called "Home". Several other sample collections may have been created during the setup process. You can access these collections by clicking "Blog A", "Blog B", "Photos", etc. in the menu bar at the top of this page.')."\n\n"
.T_('You can think of collections as "sections" of your site. Different collections/sections may have different purposes: blog, photo gallery, forums, manual, etc. You can add or remove collections at will through the back-office. You can even remove this "Home" collection if you don\'t need it.')."\n\n"
.T_('Feel free to experiment! If you delete all collections, the Quick start wizard will come back and you will be able to start with a completely new arrangement of collections.'),
) ),
array( 10, 15000, 'coll_featured_intro', 'coll_type' => '-main,minisite', 'params' => ( $kind == 'main' ? array(
// Hide a title of the front intro post:
'disp_title' => 0,
) : NULL ) ),
array( 15, 15000, 'social_links', 'coll_type' => 'main', 'params' => array(
'link1' => 'twitter',
'link1_href' => 'https://twitter.com/b2evolution/',
'link2' => 'facebook',
'link2_href' => 'https://www.facebook.com/b2evolution',
'link3' => 'linkedin',
'link3_href' => 'https://www.linkedin.com/company/b2evolution-net',
'link4' => 'github',
'link4_href' => 'https://github.com/b2evolution/b2evolution',
) ),
array( 20, 15000, 'coll_featured_posts', 'coll_type' => '-minisite', 'params' => ( $kind == 'main' ? array(
'blog_ID' => '*', // Display Items from all Collections
'limit' => 5,
'layout' => 'list',
'thumb_size' => 'crop-80x80',
) : NULL ) ),
array( 30, 15000, 'coll_post_list', 'coll_type' => 'main', 'params' => array(
'blog_ID' => '*', // Display Items from all Collections
'title' => T_('More Posts'),
'featured' => 'other',
) ),
// Install widget "Poll" only for Blog B on install:
array( 40, 15000, 'poll', 'coll_ID' => $blog_b_ID, 'params' => array( 'poll_ID' => $demo_poll_ID ) ),
array( 45, 15000, 'content_hierarchy', 'coll_type' => 'manual' ),
array( 50, 15000, 'subcontainer_row', 'coll_type' => '-main', 'params' => array(
'column1_container' => 'coll:front_page_column_a',
'column1_class' => 'col-sm-6 col-xs-12',
'column2_container' => 'coll:front_page_column_b',
'column2_class' => 'col-sm-6 col-xs-12',
) ),
);
/* Front Page Column A */
$default_widgets['front_page_column_a'] = array(
'type' => 'sub',
'name' => NT_('Front Page Column A'),
'order' => 1,
array( 10, 15230, 'coll_post_list', 'coll_type' => '-minisite', 'params' => array( 'title' => T_('More Posts'), 'featured' => 'other' ) ),
);
/* Front Page Column B */
$default_widgets['front_page_column_b'] = array(
'type' => 'sub',
'name' => NT_('Front Page Column B'),
'order' => 2,
array( 10, 15230, 'coll_comment_list', 'coll_type' => '-main,minisite' ),
);
/* Front Page Secondary Area */
$default_widgets['front_page_secondary_area'] = array(
array( 10, 15000, 'org_members', 'coll_type' => 'main,minisite' ),
array( 20, 15000, 'coll_flagged_list', 'coll_type' => '-main,minisite' ),
array( 30, 15000, 'content_block', 'coll_type' => 'main', 'params' => array(
'title' => T_('Content Block Example'),
'item_slug' => 'this-is-a-content-block',
) ),
);
/* Front Page Area 3 */
$default_widgets['front_page_area_3'] = array(
'coll_type' => 'minisite',
array( 10, 15230, 'free_text', 'params' => 'a:6:{s:5:"title";s:0:"";s:7:"content";s:446:"Lorem ipsum dolor sit amet, consectetur adipisicing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur. Excepteur sint occaecat cupidatat non proident, sunt in culpa qui officia deserunt mollit anim id est laborum.";s:9:"renderers";a:10:{s:11:"escape_code";i:1;s:8:"b2evMark";i:1;s:8:"b2evWiLi";i:1;s:8:"b2evCTag";i:1;s:8:"b2evGMco";i:1;s:8:"b2evALnk";i:1;s:8:"evo_poll";i:1;s:13:"evo_videoplug";i:1;s:8:"b2WPAutP";i:1;s:14:"evo_widescroll";i:1;}s:16:"widget_css_class";s:0:"";s:9:"widget_ID";s:0:"";s:16:"allow_blockcache";i:0;}' ),
array( 20, 15230, 'user_links' ),
);
/* Forum Front Secondary Area */
$default_widgets['forum_front_secondary_area'] = array(
'coll_type' => 'forum',
array( 10, 15000, 'coll_activity_stats' ),
);
/* Compare Main Area */
$default_widgets['compare_main_area'] = array(
array( 10, 15000, 'item_fields_compare', 'params' => array( 'items_source' => 'all' ) ),
);
/* Chapter Main Area */
$default_widgets['chapter_main_area'] = array(
'coll_type' => 'manual',
array( 10, 15320, 'breadcrumb_path', 'params' => array( 'separator' => '' ) ),
array( 20, 15320, 'coll_featured_intro' ),
array( 30, 15320, 'cat_title', 'params' => array( 'blog_ID' => '-', 'display_when' => 'no_intro' ) ),
array( 40, 15730, 'cat_content_list' ),
);
/* 404 Page */
$default_widgets['404_page'] = array(
array( 10, 15000, 'page_404_not_found' ),
array( 20, 15000, 'coll_search_form' ),
array( 30, 15000, 'coll_tag_cloud' ),
);
/* Login Required */
$default_widgets['login_required'] = array(
array( 10, 15000, 'content_block', 'params' => array( 'item_slug' => 'login-required' ) ),
array( 20, 15000, 'user_login', 'params' => array(
'title' => T_( 'Log in to your account' ),
'login_button_class' => 'btn btn-success btn-lg',
'register_link_class' => 'btn btn-primary btn-lg pull-right',
) ),
);
/* Access Denied */
$default_widgets['access_denied'] = array(
array( 10, 15000, 'content_block', 'params' => array( 'item_slug' => 'access-denied' ) ),
);
/* Help */
$default_widgets['help'] = array(
array( 10, 15000, 'content_block', 'params' => array(
'item_slug' => 'help-content',
'title' => T_('Personal Data & Privacy'),
) ),
);
/* Register */
$default_widgets['register'] = array(
array( 10, 15000, 'user_register_standard' ),
array( 20, 15000, 'content_block', 'params' => array( 'item_slug' => 'register-content' ) ),
);
/* Photo Index */
$default_widgets['photo_index'] = array(
array( 10, 15370, 'coll_media_index', 'params' => array(
'title' => '',
'thumb_size' => 'fit-256x256',
'thumb_layout' => 'grid',
'grid_nb_cols' => 8,
'limit' => 1000,
) ),
);
/* Mobile Footer */
$default_widgets['mobile_footer'] = array(
array( 10, 15000, 'coll_longdesc' ),
array( 20, 15000, 'mobile_skin_switcher' ),
);
/* Mobile Navigation Menu */
$default_widgets['mobile_navigation_menu'] = array(
array( 10, 15000, 'coll_page_list' ),
array( 20, 15000, 'basic_menu_link', 'params' => array( 'link_type' => 'ownercontact' ) ),
array( 30, 15000, 'basic_menu_link', 'params' => array( 'link_type' => 'home' ) ),
array( 30, 15000, 'basic_menu_link', 'coll_type' => 'forum', 'params' => array( 'link_type' => 'users' ) ),
);
/* Mobile Tools Menu */
$default_widgets['mobile_tools_menu'] = array(
array( 10, 15000, 'basic_menu_link', 'params' => array( 'link_type' => 'login' ) ),
array( 20, 15000, 'msg_menu_link', 'params' => array( 'link_type' => 'messages' ) ),
array( 30, 15000, 'msg_menu_link', 'params' => array( 'link_type' => 'contacts', 'show_badge' => 0 ) ),
array( 50, 15000, 'basic_menu_link', 'params' => array( 'link_type' => 'logout' ) ),
);
/* User Profile - Left */
$default_widgets['user_profile_left'] = array(
// User Profile Picture(s):
array( 10, 15230, 'user_profile_pics', 'params' => array(
'link_to' => 'fullsize',
'thumb_size' => 'crop-top-320x320',
'anon_thumb_size' => 'crop-top-320x320-blur-8',
'anon_overlay_show' => '1',
'widget_css_class' => 'evo_user_profile_pics_main',
) ),
// User info / Name:
array( 20, 15230, 'user_info', 'params' => array(
'info' => 'name',
'widget_css_class' => 'evo_user_info_name',
) ),
// User info / Nickname:
array( 30, 15230, 'user_info', 'params' => array(
'info' => 'nickname',
'widget_css_class' => 'evo_user_info_nickname',
) ),
// User info / Login:
array( 40, 15230, 'user_info', 'params' => array(
'info' => 'login',
'widget_css_class' => 'evo_user_info_login',
) ),
// Separator:
array( 60, 15230, 'separator' ),
// User info / :
array( 70, 15230, 'user_info', 'params' => array(
'info' => 'gender_age',
'widget_css_class' => 'evo_user_info_gender',
) ),
// User info / Location:
array( 80, 15230, 'user_info', 'params' => array(
'info' => 'location',
'widget_css_class' => 'evo_user_info_location',
) ),
// Separator:
array( 90, 15230, 'separator' ),
// User action / Edit my profile:
array( 100, 15230, 'user_action', 'params' => array(
'button' => 'edit_profile',
) ),
// User action / Send Message:
array( 110, 15230, 'user_action', 'params' => array(
'button' => 'send_message',
) ),
// User action / Add to Contacts:
array( 120, 15230, 'user_action', 'params' => array(
'button' => 'add_contact',
) ),
// User action / Block Contact & Report User:
array( 130, 15230, 'user_action', 'params' => array(
'button' => 'block_report',
'widget_css_class' => 'btn-group',
) ),
// User action / Edit in Back-Office:
array( 140, 15230, 'user_action', 'params' => array(
'button' => 'edit_backoffice',
) ),
// User action / Delete & Delete Spammer:
array( 150, 15230, 'user_action', 'params' => array(
'button' => 'delete',
'widget_css_class' => 'btn-group',
) ),
// Separator:
array( 160, 15230, 'separator' ),
// User info / Organizations:
array( 170, 15230, 'user_info', 'params' => array(
'info' => 'orgs',
'title' => T_('Organizations').':',
'widget_css_class' => 'evo_user_info_orgs',
) ),
);
/* User Profile - Right */
$default_widgets['user_profile_right'] = array(
// User Profile Picture(s):
array( 10, 15230, 'user_profile_pics', 'params' => array(
'display_main' => 0,
'display_other' => 1,
'link_to' => 'fullsize',
'thumb_size' => 'crop-top-80x80',
'widget_css_class' => 'evo_user_profile_pics_other',
) ),
// User fields:
array( 20, 15230, 'user_fields' ),
// Reputation:
array( 30, 15230, 'subcontainer', 'params' => array(
'title' => T_('Reputation'),
'container' => 'coll:user_page_reputation',
) ),
);
/* User Page - Reputation */
$default_widgets['user_page_reputation'] = array(
'type' => 'sub',
'name' => NT_('User Page - Reputation'),
'order' => 100,
// User info / Joined:
array( 10, 15230, 'user_info', 'params' => array(
'title' => T_('Joined'),
'info' => 'joined',
) ),
// User info / Last Visit:
array( 20, 15230, 'user_info', 'params' => array(
'title' => T_('Last seen on'),
'info' => 'last_visit',
) ),
// User info / Number of posts:
array( 30, 15230, 'user_info', 'params' => array(
'title' => T_('Number of posts'),
'info' => 'posts',
) ),
// User info / Comments:
array( 40, 15230, 'user_info', 'params' => array(
'title' => T_('Comments'),
'info' => 'comments',
) ),
// User info / Photos:
array( 50, 15230, 'user_info', 'params' => array(
'title' => T_('Photos'),
'info' => 'photos',
) ),
// User info / Audio:
array( 60, 15230, 'user_info', 'params' => array(
'title' => T_('Audio'),
'info' => 'audio',
) ),
// User info / Other files:
array( 70, 15230, 'user_info', 'params' => array(
'title' => T_('Other files'),
'info' => 'files',
) ),
// User info / Spam fighter score:
array( 80, 15230, 'user_info', 'params' => array(
'title' => T_('Spam fighter score'),
'info' => 'spam',
) ),
);
/* Search Area */
$default_widgets['search_area'] = array(
array( 10, 15960, 'coll_search_form', 'params' => array(
'template' => 'search_form_full',
) ),
);
// **** SHARED CONTAINERS ***** //
/* Site Header */
$default_widgets['site_header'] = array(
'type' => 'shared',
'name' => NT_('Site Header'),
array( 10, 15260, 'site_logo' ),
array( 20, 15260, 'subcontainer', 'params' => array(
'title' => T_('Main Navigation'),
'container' => 'shared:main_navigation',
) ),
array( 30, 15260, 'subcontainer', 'params' => array(
'title' => T_('Right Navigation'),
'container' => 'shared:right_navigation',
'widget_css_class' => 'floatright',
) ),
);
/* Site Footer */
$default_widgets['site_footer'] = array(
'type' => 'shared',
'name' => NT_('Site Footer'),
array( 10, 15260, 'free_text', 'params' => array(
'content' => T_('Cookies are required to enable core site functionality.'),
) ),
);
/* Navigation Hamburger */
$default_widgets['navigation_hamburger'] = array(
'type' => 'shared',
'name' => NT_('Navigation Hamburger'),
array( 10, 15260, 'colls_list_public', 'params' => array(
'widget_css_class' => 'visible-xs',
) ),
);
$tmp_widget_order = 20;
if( ! empty( $installed_collection_info_pages ) && is_array( $installed_collection_info_pages ) )
{ // Install additional menu items for each page from info/shared collection:
foreach( $installed_collection_info_pages as $installed_collection_info_page_item_ID )
{
$default_widgets['navigation_hamburger'][] = array( $tmp_widget_order++, 15260, 'basic_menu_link', 'params' => array(
'link_type' => 'item',
'item_ID' => $installed_collection_info_page_item_ID,
'widget_css_class' => 'visible-sm visible-xs',
) );
}
}
$tmp_widget_order = intval( $tmp_widget_order / 10 ) * 10;
$default_widgets['navigation_hamburger'] = array_merge( $default_widgets['navigation_hamburger'], array(
array( $tmp_widget_order + 10, 15260, 'basic_menu_link', 'params' => array(
'link_type' => 'ownercontact',
'widget_css_class' => 'visible-sm visible-xs',
) ),
array( $tmp_widget_order + 20, 15260, 'free_html', 'params' => array(
'content' => '<hr class="visible-xs" />',
) ),
array( $tmp_widget_order + 30, 15260, 'basic_menu_link', 'params' => array(
'link_type' => 'register',
'widget_css_class' => 'visible-xs',
'widget_link_class'=> 'bg-white',
) ),
array( $tmp_widget_order + 40, 15260, 'msg_menu_link', 'params' => array(
'widget_css_class' => 'visible-xs',
) ),
array( $tmp_widget_order + 50, 15260, 'basic_menu_link', 'params' => array(
'link_type' => 'logout',
'widget_css_class' => 'visible-xs',
) ),
) );
/* Main Navigation */
$default_widgets['main_navigation'] = array(
'type' => 'shared-sub',
'name' => NT_('Main Navigation'),
array( 10, 15260, 'colls_list_public', 'params' => array(
'widget_css_class' => 'hidden-xs',
) )
);
$tmp_widget_order = 20;
if( ! empty( $installed_collection_info_pages ) && is_array( $installed_collection_info_pages ) )
{ // Install additional menu items for each page from info/shared collection:
foreach( $installed_collection_info_pages as $installed_collection_info_page_item_ID )
{
$default_widgets['main_navigation'][] = array( $tmp_widget_order++, 15260, 'basic_menu_link', 'params' => array(
'link_type' => 'item',
'item_ID' => $installed_collection_info_page_item_ID,
'widget_link_class'=> 'hidden-sm hidden-xs',
) );
}
}
$tmp_widget_order = intval( $tmp_widget_order / 10 ) * 10;
$default_widgets['main_navigation'] = array_merge( $default_widgets['main_navigation'], array(
array( $tmp_widget_order + 10, 15260, 'basic_menu_link', 'params' => array(
'link_type' => 'ownercontact',
'widget_link_class'=> 'hidden-sm hidden-xs',
) ),
) );
/* Right Navigation */
$default_widgets['right_navigation'] = array(
'type' => 'shared-sub',
'name' => NT_('Right Navigation'),
array( 10, 15260, 'basic_menu_link', 'params' => array(
'link_type' => 'login',
) ),
array( 20, 15260, 'basic_menu_link', 'params' => array(
'link_type' => 'register',
'widget_link_class' => 'hidden-xs bg-white',
) ),
array( 30, 15260, 'profile_menu_link', 'params' => array(
'profile_picture_size' => 'crop-top-32x32',
) ),
array( 40, 15260, 'msg_menu_link', 'params' => array(
'widget_link_class' => 'hidden-xs',
) ),
array( 50, 15260, 'basic_menu_link', 'params' => array(
'link_type' => 'logout',
'widget_css_class' => 'hidden-xs',
) ),
array( 60, 15260, 'free_html', 'params' => array(
'content' => '<label for="nav-trigger"></label>',
'widget_css_class' => 'visible-sm-inline-block visible-xs-inline-block',
) ),
);
/* Marketing Popup */
$default_widgets['marketing_popup'] = array(
'type' => 'shared',
'name' => NT_('Marketing Popup'),
array( 10, 15310, 'user_register_quick' ),
);
// **** PAGE CONTAINERS ***** //
if( isset( $installed_collection_info_pages['widget_page'] ) )
{ // Install page containers only with defined item ID:
/* Widget Page Section 1 */
$default_widgets['widget_page_section_1'] = array(
'type' => 'page',
'name' => NT_('Widget Page Section 1'),
'order' => 10,
'item_ID' => $installed_collection_info_pages['widget_page'],
array( 5, 15000, 'free_text', 'params' => array(
'title' => T_('This is a sample widget page'),
'content' => T_('A widget page is a page that is constructed entirely with widgets, rather than being constructed around a classic structure of title, content and comments.'),
) ),
array( 10, 15000, 'coll_featured_posts', 'params' => array(
'blog_ID' => '*', // Display Items from all Collections
) ),
);
/* Widget Page Section 2 */
$default_widgets['widget_page_section_2'] = array(
'type' => 'page',
'name' => NT_('Widget Page Section 2'),
'order' => 20,
'item_ID' => $installed_collection_info_pages['widget_page'],
array( 10, 15000, 'org_members' ),
);
/* Widget Page Section 3 */
$default_widgets['widget_page_section_3'] = array(
'type' => 'page',
'name' => NT_('Widget Page Section 3'),
'order' => 30,
'item_ID' => $installed_collection_info_pages['widget_page'],
);
}
return $default_widgets;
}
/**
* Get config array of default widgets on one container
*
* @param string Container code
* @param string Collection kind
* @param integer Collection ID
* @param boolean Should be true only when it's called after initial install
* @return array|boolean FALSE if no widgets for a requested container
*/
function get_default_widgets_by_container( $container_code, $kind = '', $blog_id = NULL, $initial_install = false )
{
$default_widgets = get_default_widgets( $kind, $blog_id, $initial_install );
return isset( $default_widgets[ $container_code ] ) ? $default_widgets[ $container_code ] : false;
}
/**
* Install new default widgets
*
* @param string Container code
* @param string Widget codes, separated by comma
* @param integer|NULL Collection ID, NULL - to install widgets for all collections
* @param string Skin type
* @return integer Number of new installed widgets
*/
function install_new_default_widgets( $new_container_code, $new_widget_codes = '*', $coll_ID = NULL, $skin_type = 'normal' )
{
global $DB, $Settings, $upgrade_db_version;
if( function_exists( 'upg_init_environment' ) )
{ // We're going to need some environment in order to init item type cache and create item:
upg_init_environment();
}
// Get config of default widgets for the requested container:
$container_widgets = get_default_widgets_by_container( $new_container_code );
// Get container type:
$container_type = isset( $container_widgets['type'] ) ? $container_widgets['type'] : 'main';
$new_widgets_insert_sql_rows = array();
switch( $container_type )
{
case 'main':
case 'sub':
case 'page':
// Install widgets for collection/skin container:
$BlogCache = & get_BlogCache();
if( $coll_ID === NULL )
{ // Load all collections:
$BlogCache->load_all();
}
else
{ // Load a requested collection:
$BlogCache->load_list( array( $coll_ID ) );
}
if( empty( $BlogCache->cache ) )
{ // No collections in DB:
break;
}
foreach( $BlogCache->cache as $widget_Blog )
{
// Get all containers declared in the given blog's skins
$coll_containers = $widget_Blog->get_main_containers( $skin_type, true );
// Get again config of default widgets for the requested container because several settings depend on collection type/kind:
$container_widgets = get_default_widgets_by_container( $new_container_code, $widget_Blog->get( 'type' ) );
if( isset( $container_widgets['coll_type'] ) &&
! is_allowed_option( $widget_Blog->get( 'type' ), $container_widgets['coll_type'] ) )
{ // Skip container because it should not be installed for the given collection kind:
continue;
}
if( ! isset( $coll_containers[ $new_container_code ] ) &&
( $container_type == 'sub' || $container_type == 'page' ) )
{ // Initialize sub-container and page containers data in order to install it below:
$coll_containers[ $new_container_code ] = array(
isset( $container_widgets['name'] ) ? $container_widgets['name'] : $new_container_code,
isset( $container_widgets['order'] ) ? $container_widgets['order'] : 1,
);
$WidgetContainerCache = & get_WidgetContainerCache();
if( $sub_WidgetContainer = & $WidgetContainerCache->get_by_coll_skintype_code( $widget_Blog->ID, $skin_type, $new_container_code ) )
{ // Set ID if widget container already exists for the collection:
$coll_containers[ $new_container_code ]['ID'] = $sub_WidgetContainer->ID;
}
}
if( $container_widgets !== false )
{ // If the requested container has at least one widget:
if( ! isset( $coll_containers[ $new_container_code ] ) )
{ // Skip container which is not supported by current collection's skin:
continue;
}
$coll_container = $coll_containers[ $new_container_code ];
if( ! isset( $coll_container['ID'] ) )
{ // Create new container if it is not installed yet:
if( ! isset( $coll_container[0] ) || ! isset( $coll_container[1] ) )
{ // We cannot create a container without name and order, Skip it:
continue;
}
// Insert new widget container into DB:
$new_container_fields = array(
'wico_code' => $new_container_code,
'wico_skin_type' => $skin_type,
'wico_name' => $coll_container[0],
'wico_coll_ID' => $widget_Blog->ID,
'wico_order' => $coll_container[1],
'wico_main' => $container_type == 'sub' ? 0 : 1,
);
if( $container_type == 'page' && isset( $container_widgets['item_ID'] ) )
{ // Page container has an additional field for Item:
$new_container_fields['wico_item_ID'] = $container_widgets['item_ID'];
}
$DB->query( 'INSERT INTO T_widget__container ( '.implode( ', ', array_keys( $new_container_fields ) ).' )
VALUES ( '.$DB->quote( $new_container_fields ).' )' );
// Update ID of new inserted widget container:
$coll_container['ID'] = $DB->insert_id;
// Also update ID in collection cache for next calls:
$widget_Blog->widget_containers[ $skin_type ][ $new_container_code ]['ID'] = $coll_container['ID'];
}
elseif( ! isset( $widget_orders_in_containers ) )
{ // For existing containers we should get all widget orders in order to avoid duplicate error on insert new widgets:
$SQL = new SQL( 'Get widget orders in container #'.$coll_container['ID'].' of collection #'.$widget_Blog->ID );
$SQL->SELECT( 'wi_wico_ID, GROUP_CONCAT( wi_order )' );
$SQL->FROM( 'T_widget__widget' );
$SQL->GROUP_BY( 'wi_wico_ID' );
$SQL->ORDER_BY( 'wi_wico_ID, wi_order' );
$widget_orders_in_containers = $DB->get_assoc( $SQL );
foreach( $widget_orders_in_containers as $order_wico_ID => $widget_orders_in_container )
{
$widget_orders_in_containers[ $order_wico_ID ] = explode( ',', $widget_orders_in_container );
}
}
// Create array to cache widget orders per container:
if( ! isset( $widget_orders_in_containers ) )
{
$widget_orders_in_containers = array();
}
if( ! isset( $widget_orders_in_containers[ $coll_container['ID'] ] ) )
{
$widget_orders_in_containers[ $coll_container['ID'] ] = array();
}
foreach( $container_widgets as $key => $widget )
{
if( ! is_number( $key ) )
{ // Skip the config data which is used as additional info for container like 'type', 'name', 'order', 'item_ID', 'coll_type':
continue;
}
if( ! is_allowed_option( $widget[2], $new_widget_codes ) )
{ // Skip not requested widget:
continue;
}
if( ! empty( $upgrade_db_version ) && $widget[1] != $upgrade_db_version )
{ // Skip widget because it must be installed only for the specific upgrade block:
continue;
}
if( isset( $widget['install'] ) && ! $widget['install'] )
{ // Skip widget because it should not be installed by condition from config:
continue;
}
if( isset( $widget['coll_type'] ) && ! is_allowed_option( $widget_Blog->get( 'type' ), $widget['coll_type'] ) )
{ // Skip widget because it should not be installed for the given collection kind:
continue;
}
if( isset( $widget['is_pro'] ) && $widget['is_pro'] !== is_pro() )
{ // Skip widget because it should not be installed for the current version:
continue;
}
if( isset( $widget['coll_ID'] ) && ! is_allowed_option( $widget_Blog->ID, $widget['coll_ID'] ) )
{ // Skip widget because it should not be installed for the given collection ID:
continue;
}
// Initialize a widget row to insert into DB below by single query:
$widget_type = isset( $widget['type'] ) ? $widget['type'] : 'core';
$widget_params = isset( $widget['params'] ) ? ( is_array( $widget['params'] ) ? serialize( $widget['params'] ) : $widget['params'] ) : NULL;
$widget_enabled = isset( $widget['enabled'] ) ? intval( $widget['enabled'] ) : 1;
// Fix a widget order to avoid mysql error of duplicated rows with same order per container:
$widget_order = intval( $widget[0] );
while( in_array( $widget_order, $widget_orders_in_containers[ $coll_container['ID'] ] ) )
{ // Search next free order inside the container:
$widget_order++;
}
if( $widget_order != $widget[0] )
{ // Update widget order in cache:
$widget_orders_in_containers[ $coll_container['ID'] ][] = $widget_order;
}
// A row with new widget values:
$new_widgets_insert_sql_rows[] = '( '.$coll_container['ID'].', '.$widget_order.', '.$widget_enabled.', '.$DB->quote( $widget_type ).', '.$DB->quote( $widget[2] ).', '.$DB->quote( $widget_params ).' )';
}
}
}
break;
case 'shared':
case 'shared-sub':
// Install widgets for shared container:
global $cache_installed_shared_containers, $cache_installed_shared_container_order;
if( ! isset( $cache_installed_shared_containers ) )
{ // Load all shared containers in cache global array once:
$shared_containers_SQL = new SQL( 'Get all shared widget containers' );
$shared_containers_SQL->SELECT( 'wico_code, wico_ID' );
$shared_containers_SQL->FROM( 'T_widget__container' );
$shared_containers_SQL->WHERE( 'wico_coll_ID IS NULL' );
$shared_containers_SQL->WHERE_and( 'wico_skin_type = '.$DB->quote( $skin_type ) );
$cache_installed_shared_containers = $DB->get_assoc( $shared_containers_SQL );
// Get max order of the shared widget containers:
$max_order_SQL = new SQL( 'Get max order of the shared widget containers' );
$max_order_SQL->SELECT( 'wico_order' );
$max_order_SQL->FROM( 'T_widget__container' );
$max_order_SQL->WHERE( 'wico_coll_ID IS NULL' );
$max_order_SQL->ORDER_BY( 'wico_order DESC' );
$max_order_SQL->LIMIT( '1' );
$cache_installed_shared_container_order = intval( $DB->get_var( $max_order_SQL ) );
}
if( isset( $container_widgets['name'] ) )
{ // Handle special array item with container data:
if( ! isset( $cache_installed_shared_containers[ $new_container_code ] ) )
{ // Insert new shared container:
$insert_result = $DB->query( 'INSERT INTO T_widget__container( wico_code, wico_skin_type, wico_name, wico_coll_ID, wico_order, wico_main ) VALUES '
.'( '.$DB->quote( $new_container_code ).', '.$DB->quote( $skin_type ).', '.$DB->quote( $container_widgets['name'] ).', '.'NULL, '.( ++$cache_installed_shared_container_order ).', '.$DB->quote( $container_type == 'shared' ? 1 : 0 ).' )',
'Insert default shared widget container' );
if( $insert_result && $DB->insert_id > 0 )
{
$cache_installed_shared_containers[ $new_container_code ] = $DB->insert_id;
}
}
}
if( ! isset( $cache_installed_shared_containers[ $new_container_code ] ) )
{ // Skip container which is not installed as shared:
break;
}
foreach( $container_widgets as $key => $widget )
{
if( ! is_number( $key ) )
{ // Skip the config data which is used as additional info for container like 'type', 'name', 'order', 'item_ID', 'coll_type':
continue;
}
if( ! empty( $upgrade_db_version ) && $widget[1] != $upgrade_db_version )
{ // Skip widget because it must be installed only for the specific upgrade block:
continue;
}
if( isset( $widget['install'] ) && ! $widget['install'] )
{ // Skip widget because it should not be installed by condition from config:
continue;
}
if( isset( $widget['is_pro'] ) && $widget['is_pro'] !== is_pro() )
{ // Skip widget because it should not be installed for the current version:
continue;
}
// Initialize a widget row to insert into DB below by single query:
$widget_type = isset( $widget['type'] ) ? $widget['type'] : 'core';
$widget_params = isset( $widget['params'] ) ? ( is_array( $widget['params'] ) ? serialize( $widget['params'] ) : $widget['params'] ) : NULL;
$widget_enabled = isset( $widget['enabled'] ) ? intval( $widget['enabled'] ) : 1;
$new_widgets_insert_sql_rows[] = '( '.$cache_installed_shared_containers[ $new_container_code ].', '.$widget[0].', '.$widget_enabled.', '.$DB->quote( $widget_type ).', '.$DB->quote( $widget[2] ).', '.$DB->quote( $widget_params ).' )';
}
break;
}
$new_inserted_widgets_num = 0;
if( ! empty( $new_widgets_insert_sql_rows ) )
{ // Insert the widget rows by single SQL query:
$new_inserted_widgets_num = $DB->query( 'INSERT INTO T_widget__widget( wi_wico_ID, wi_order, wi_enabled, wi_type, wi_code, wi_params )
VALUES '.implode( ', ', $new_widgets_insert_sql_rows ) );
}
return $new_inserted_widgets_num;
}
/**
* Check if the requested widget is already installed in Container
*
* @param string Widget code
* @param string Container code
* @param integer Collection ID or NULL for shared container
* @return boolean
*/
function is_installed_widget( $widget_code, $container_code, $coll_ID = NULL )
{
global $evo_installed_widgets_by_container_collection;
if( ! isset( $evo_installed_widgets_by_container_collection ) ||
! is_array( $evo_installed_widgets_by_container_collection ) )
{
$evo_installed_widgets_by_container_collection = array();
}
if( ! isset( $evo_installed_widgets_by_container_collection[ $container_code ] ) )
{ // Get widget and store in global cache array:
global $DB;
$SQL = new SQL( 'Get all widgets per container for check installed widgets' );
$SQL->SELECT( 'wi_code, wico_coll_ID' );
$SQL->FROM( 'T_widget__widget' );
$SQL->FROM_add( 'INNER JOIN T_widget__container ON wi_wico_ID = wico_ID' );
$SQL->WHERE( 'wico_code = '.$DB->quote( $container_code ) );
$widgets = $DB->get_results( $SQL );
foreach( $widgets as $widget )
{
$widget_coll_ID = ( $widget->wico_coll_ID === NULL ? 'shared' : $widget->wico_coll_ID );
if( ! isset( $evo_installed_widgets_by_container_collection[ $container_code ][ $widget_coll_ID ] ) )
{
$evo_installed_widgets_by_container_collection[ $container_code ][ $widget_coll_ID ] = array();
}
$evo_installed_widgets_by_container_collection[ $container_code ][ $widget_coll_ID ][] = $widget->wi_code;
}
}
$coll_ID = ( $coll_ID === NULL ? 'shared' : $coll_ID );
return ( isset( $evo_installed_widgets_by_container_collection[ $container_code ][ $coll_ID ] ) &&
in_array( $widget_code, $evo_installed_widgets_by_container_collection[ $container_code ][ $coll_ID ] ) );
}
/**
* Insert the basic widgets for a collection
*
* @param integer should never be 0
* @param string Skin type: 'normal', 'mobile', 'tablet', 'alt'
* @param boolean should be true only when it's called after initial install
* fp> TODO: $initial_install is used to know if we want to trust globals like $blog_photoblog_ID and $blog_forums_ID. We don't want that.
* We should pass a $context array with values like 'photo_source_coll_ID' => 4.
* Also, checking $blog_forums_ID is unnecessary complexity. We can check the collection kind == forum
* @param string Kind of blog ( 'std', 'photo', 'group', 'forum' )
*/
function insert_basic_widgets( $blog_id, $skin_type, $initial_install = false, $kind = '' )
{
global $DB, $install_test_features;
// Handle all blog IDs which can go from function create_demo_contents()
global $blog_minisite_ID, $blog_home_ID, $blog_a_ID, $blog_b_ID, $blog_photoblog_ID, $blog_forums_ID, $blog_manual_ID, $events_blog_ID;
$blog_minisite_ID = intval( $blog_minisite_ID );
$blog_home_ID = intval( $blog_home_ID );
$blog_a_ID = intval( $blog_a_ID );
$blog_b_ID = intval( $blog_b_ID );
$blog_photoblog_ID = intval( $blog_photoblog_ID );
$blog_forums_ID = intval( $blog_forums_ID );
$blog_manual_ID = intval( $blog_manual_ID );
$events_blog_ID = intval( $events_blog_ID );
$BlogCache = & get_BlogCache();
if( ! ( $Blog = & $BlogCache->get_by_ID( $blog_id, false, false ) ) )
{ // Wrong requested collection:
return;
}
// Get all containers declared in the given collection skin type:
$blog_containers = $Blog->get_skin_containers( $skin_type );
if( empty( $blog_containers ) )
{ // No containers for given skin:
return;
}
// Get config of default widgets:
$default_widgets = get_default_widgets( $kind, $blog_id, $initial_install );
// Install additional sub-containers and page containers from default config,
// which are not declared as main containers but should be installed too:
foreach( $default_widgets as $wico_code => $container_widgets )
{
if( isset( $container_widgets['type'] ) &&
( $container_widgets['type'] == 'sub' || $container_widgets['type'] == 'page' ) )
{ // If it is a sub-container or page container:
$blog_containers[ $wico_code ] = array(
isset( $container_widgets['name'] ) ? $container_widgets['name'] : $wico_code,
isset( $container_widgets['order'] ) ? $container_widgets['order'] : 1,
( $container_widgets['type'] == 'sub' ? 0 : 1 ), // Main or Sub-container
isset( $container_widgets['item_ID'] ) ? $container_widgets['item_ID'] : NULL,
);
}
}
// Create rows to insert for all collection containers:
$widget_containers_sql_rows = array();
foreach( $blog_containers as $wico_code => $wico_data )
{
$widget_containers_sql_rows[] = '( '.$DB->quote( $wico_code ).', '
.$DB->quote( $skin_type ).', '
.$DB->quote( $wico_data[0] ).', '
.$blog_id.', '
.$DB->quote( $wico_data[1] ).', '
.( isset( $wico_data[2] ) ? intval( $wico_data[2] ) : '1' ).', '
.( isset( $wico_data[3] ) ? intval( $wico_data[3] ) : 'NULL' ).' )';
}
// Insert widget containers records by one SQL query
$DB->query( 'INSERT INTO T_widget__container ( wico_code, wico_skin_type, wico_name, wico_coll_ID, wico_order, wico_main, wico_item_ID ) VALUES'
.implode( ', ', $widget_containers_sql_rows ) );
$insert_id = $DB->insert_id;
foreach( $blog_containers as $wico_code => $wico_data )
{
$blog_containers[ $wico_code ]['wico_ID'] = $insert_id;
$insert_id++;
}
$basic_widgets_insert_sql_rows = array();
foreach( $default_widgets as $wico_code => $container_widgets )
{
if( ! isset( $blog_containers[ $wico_code ] ) )
{ // Skip container which is not supported by current colelction's skin:
continue;
}
if( ! empty( $container_widgets['type'] ) &&
! in_array( $container_widgets['type'], array( 'main', 'sub', 'page' ) ) )
{ // Skip not collection container:
continue;
}
if( isset( $container_widgets['coll_type'] ) &&
! is_allowed_option( $kind, $container_widgets['coll_type'] ) )
{ // Skip container because it should not be installed for the given collection kind:
continue;
}
$wico_id = $blog_containers[ $wico_code ]['wico_ID'];
foreach( $container_widgets as $key => $widget )
{
if( ! is_number( $key ) )
{ // Skip the config data which is used as additional info for container like 'type', 'name', 'order', 'item_ID', 'coll_type':
continue;
}
if( isset( $widget['install'] ) && ! $widget['install'] )
{ // Skip widget because it should not be installed by condition from config:
continue;
}
if( isset( $widget['coll_type'] ) && ! is_allowed_option( $kind, $widget['coll_type'] ) )
{ // Skip widget because it should not be installed for the given collection kind:
continue;
}
if( isset( $widget['is_pro'] ) && $widget['is_pro'] !== is_pro() )
{ // Skip widget because it should not be installed for the current version:
continue;
}
if( isset( $widget['coll_ID'] ) && ! is_allowed_option( $blog_id, $widget['coll_ID'] ) )
{ // Skip widget because it should not be installed for the given collection ID:
continue;
}
// Initialize a widget row to insert into DB below by single query:
$widget_type = isset( $widget['type'] ) ? $widget['type'] : 'core';
$widget_params = isset( $widget['params'] ) ? ( is_array( $widget['params'] ) ? serialize( $widget['params'] ) : $widget['params'] ) : NULL;
$widget_enabled = isset( $widget['enabled'] ) ? intval( $widget['enabled'] ) : 1;
$basic_widgets_insert_sql_rows[] = '( '.$wico_id.', '.$widget[0].', '.$widget_enabled.', '.$DB->quote( $widget_type ).', '.$DB->quote( $widget[2] ).', '.$DB->quote( $widget_params ).' )';
}
}
// Check if there are widgets to create
if( ! empty( $basic_widgets_insert_sql_rows ) )
{ // Insert the widget records by single SQL query
$DB->query( 'INSERT INTO T_widget__widget( wi_wico_ID, wi_order, wi_enabled, wi_type, wi_code, wi_params ) '
.'VALUES '.implode( ', ', $basic_widgets_insert_sql_rows ) );
}
}
/**
* Get WidgetContainer object from the widget list view widget container fieldset id
* Note: It is used during creating and reordering widgets
*
* @param integer Collection ID
* @param string Skin type: 'normal', 'mobile', 'tablet', 'alt'
* @param string Container fieldset ID like 'wico_code_containercode' or 'wico_ID_123'
* @return object WidgetContainer
*/
function & get_WidgetContainer_by_coll_skintype_fieldset( $coll_ID, $skin_type, $container_fieldset_id )
{
$WidgetContainerCache = & get_WidgetContainerCache();
if( substr( $container_fieldset_id, 0, 10 ) == 'wico_code_' )
{ // The widget contianer fieldset id was given by the container code because probably it was not created in the database yet
$container_code = substr( $container_fieldset_id, 10 );
$WidgetContainer = & $WidgetContainerCache->get_by_coll_skintype_code( $coll_ID, $skin_type, $container_code );
if( ! $WidgetContainer )
{ // The skin container didn't contain any widget before, and it was not saved in the database
$WidgetContainer = new WidgetContainer();
$WidgetContainer->set( 'code', $container_code );
$WidgetContainer->set( 'name', $container_code );
$WidgetContainer->set( 'coll_ID', $coll_ID );
$WidgetContainer->set( 'main', 1 );
$WidgetContainer->set( 'skin_type', $skin_type );
}
}
elseif( substr( $container_fieldset_id, 0, 8 ) == 'wico_ID_' )
{ // The widget contianer fieldset id contains the container database ID
$container_ID = substr( $container_fieldset_id, 8 );
$WidgetContainer = & $WidgetContainerCache->get_by_ID( $container_ID );
}
else
{ // The received fieldset id is not valid
debug_die( 'Invalid container fieldset id received' );
}
return $WidgetContainer;
}
/**
* Insert shared widget containers
*
* @param string Skin type: 'normal', 'mobile', 'tablet', 'alt'
*/
function insert_shared_widgets( $skin_type )
{
global $DB;
// Get config of default shared widgets:
$default_widgets = get_default_widgets();
$shared_widgets_insert_sql_rows = array();
$shared_containers = array();
$shared_widgets = array();
$shared_container_order = 1;
// Get all shared containers and widgets in order to don't install them twice when it is requested:
$existing_widgets_SQL = new SQL( 'Get existings shared widget containers' );
$existing_widgets_SQL->SELECT( 'wico_code, wico_ID, wi_code, wi_order' );
$existing_widgets_SQL->FROM( 'T_widget__container' );
$existing_widgets_SQL->FROM_add( 'LEFT JOIN T_widget__widget ON wico_ID = wi_wico_ID' );
$existing_widgets_SQL->WHERE( 'wico_coll_ID IS NULL' );
$existing_widgets = $DB->get_results( $existing_widgets_SQL );
foreach( $existing_widgets as $existing_widget )
{
$shared_containers[ $existing_widget->wico_code ] = $existing_widget->wico_ID;
if( ! isset( $shared_widgets[ $existing_widget->wico_ID ] ) )
{
$shared_widgets[ $existing_widget->wico_ID ] = array();
}
// Table T_widget__widget has the unique index ( wi_wico_ID, wi_order ),
// so we should check widgets per container ID and widget order
// in order to avoid error of duplicate records:
$shared_widgets[ $existing_widget->wico_ID ][ $existing_widget->wi_order ] = $existing_widget->wi_code;
}
foreach( $default_widgets as $wico_code => $container_widgets )
{
if( ! isset( $container_widgets['type'] ) ||
! in_array( $container_widgets['type'], array( 'shared', 'shared-sub' ) ) )
{ // Skip not shared container:
continue;
}
if( isset( $container_widgets['name'] ) )
{ // Handle special array item with container data:
if( ! isset( $shared_containers[ $wico_code ] ) )
{ // Insert new shared container:
$insert_result = $DB->query( 'INSERT INTO T_widget__container ( wico_code, wico_skin_type, wico_name, wico_coll_ID, wico_order, wico_main ) VALUES '
.'( '.$DB->quote( $wico_code ).', '.$DB->quote( $skin_type ).', '.$DB->quote( $container_widgets['name'] ).', '.'NULL, '.$shared_container_order++.', '.$DB->quote( $container_widgets['type'] == 'shared' ? 1 : 0 ).' )',
'Insert default shared widget container' );
if( $insert_result && $DB->insert_id > 0 )
{
$shared_containers[ $wico_code ] = $DB->insert_id;
}
}
}
if( ! isset( $shared_containers[ $wico_code ] ) )
{ // Skip container which is not installed as shared:
continue;
}
$wico_id = $shared_containers[ $wico_code ];
foreach( $container_widgets as $key => $widget )
{
if( ! is_number( $key ) )
{ // Skip the config data which is used as additional info for container like 'type', 'name', 'order', 'item_ID', 'coll_type':
continue;
}
if( isset( $widget['install'] ) && ! $widget['install'] )
{ // Skip widget because it should not be installed by condition from config:
continue;
}
if( isset( $widget['is_pro'] ) && $widget['is_pro'] !== is_pro() )
{ // Skip widget because it should not be installed for the current version:
continue;
}
if( isset( $shared_widgets[ $wico_id ][ $widget[0] ] ) )
{ // Skip the widget because a widget was already installed for the container with same order:
continue;
}
// Initialize a widget row to insert into DB below by single query:
$widget_type = isset( $widget['type'] ) ? $widget['type'] : 'core';
$widget_params = isset( $widget['params'] ) ? ( is_array( $widget['params'] ) ? serialize( $widget['params'] ) : $widget['params'] ) : NULL;
$widget_enabled = isset( $widget['enabled'] ) ? intval( $widget['enabled'] ) : 1;
$shared_widgets_insert_sql_rows[] = '( '.$wico_id.', '.$widget[0].', '.$widget_enabled.', '.$DB->quote( $widget_type ).', '.$DB->quote( $widget[2] ).', '.$DB->quote( $widget_params ).' )';
}
}
// Check if there are widgets to create:
if( ! empty( $shared_widgets_insert_sql_rows ) )
{ // Insert the widget records by single SQL query:
$DB->query( 'INSERT INTO T_widget__widget( wi_wico_ID, wi_order, wi_enabled, wi_type, wi_code, wi_params ) '
.'VALUES '.implode( ', ', $shared_widgets_insert_sql_rows ) );
}
}
/*
* @param object Widget Container
* @param array Params
*/
function display_container( $WidgetContainer, $params = array() )
{
global $Collection, $Blog, $DB, $admin_url, $embedded_containers, $mode;
global $Session;
$params = array_merge( array(
'table_layout' => NULL, // Possible values: 'accordion_table', NULL(for default 'Results')
'group_id' => NULL,
'group_item_id' => NULL,
), $params );
if( $mode != 'customizer' )
{ // Use simple icons instead of buttons on back-office:
$params['global_icons_class'] = '';
}
$Table = new Table( $params['table_layout'] );
// Table ID - fp> needs to be handled cleanly by Table object
if( isset( $WidgetContainer->ID ) && ( $WidgetContainer->ID > 0 ) )
{
$widget_container_id = 'wico_ID_'.$WidgetContainer->ID;
$add_widget_url = regenerate_url( '', 'action=new&wico_ID='.$WidgetContainer->ID.'&container='.$widget_container_id );
$destroy_container_url = url_add_param( $admin_url, 'ctrl=widgets&action=destroy_container&wico_ID='.$WidgetContainer->ID.'&'.url_crumb('widget_container') );
}
else
{
$wico_code = $WidgetContainer->get( 'code' );
$widget_container_id = 'wico_code_'.$wico_code;
$add_widget_url = regenerate_url( '', 'action=new&wico_code='.$wico_code.'&container='.$widget_container_id );
$destroy_container_url = url_add_param( $admin_url, 'ctrl=widgets&action=destroy_container&wico_code='.$wico_code.'&'.url_crumb('widget_container') );
}
if( $mode == 'customizer' )
{
$destroy_container_url .= '&mode='.$mode;
}
if( $WidgetContainer->get_type() != 'main' )
{ // Allow to destroy sub-container when it is not included into the selected skin:
$destroy_btn_title = ( $WidgetContainer->main ? T_('Destroy container') : T_('Destroy sub-container') );
$Table->global_icon( $destroy_btn_title, 'delete', $destroy_container_url, '', 0, 0, array( 'onclick' => 'return confirm( \''.TS_('Are you sure you want to destroy this container?').'\' )') );
}
$widget_container_name = T_( $WidgetContainer->get( 'name' ) );
if( $mode == 'customizer' )
{ // Customizer mode:
$Table->title = '<span class="container_name" data-wico_id="'.$widget_container_id.'">'.$widget_container_name.'</span>';
if( ! empty( $WidgetContainer->ID ) )
{ // Link to edit current widget container:
$Table->global_icon( T_('Edit widget container'), 'edit', $admin_url.'?ctrl=widgets&blog='.$Blog->ID.'&action=edit_container&wico_ID='.$WidgetContainer->ID.'&mode='.$mode, T_('Edit widget container'), 0, 0 );
}
}
else
{ // Normal/back-office mode:
if( ! empty( $WidgetContainer->ID ) )
{
$widget_container_name = '<a href="'.$admin_url.'?ctrl=widgets&blog='.$Blog->ID.'&action=edit_container&wico_ID='.$WidgetContainer->ID.( $mode == 'customizer' ? '&mode='.$mode : '' ).'">'.$widget_container_name.'</a>';
if( $WidgetContainer->get_type() == 'page' )
{ // Display additional info for Page Container:
$ItemCache = & get_ItemCache();
if( $widget_Item = & $ItemCache->get_by_ID( $WidgetContainer->get( 'item_ID' ), false, false ) )
{ // If Item is found by ID:
$widget_container_name .= ' '.sprintf( /* TRANS: widget container position On specific Item(Widget Page) */T_('on %s'), $widget_Item->get_title( array(
'title_field' => 'short_title,title',
'link_type' => 'edit_view_url',
) ) );
}
else
{ // Not found Item by ID:
$widget_container_name .= ' <span class="red">'.sprintf( T_('on nonexistent Item #%s'), $WidgetContainer->get( 'item_ID' ) ).'</span>';
}
}
}
$Table->title = '<span class="dimmed">'.$WidgetContainer->get( 'order' ).'</span> '
.'<span class="container_name" data-wico_id="'.$widget_container_id.'">'.$widget_container_name.'</span> '
.'<span class="dimmed">'.$WidgetContainer->get( 'code' ).'</span>';
if( get_default_widgets_by_container( $WidgetContainer->get( 'code' ) ) !== false )
{ // Action icon to remove all widgets and replace with default widgets of the container from config:
$Table->global_icon( T_('Reload container widgets'), 'reload',
$admin_url.'?ctrl=widgets&blog='.$Blog->ID.'&action=reload_container&wico_ID='.$WidgetContainer->ID.'&skin_type='.get_param( 'skin_type' ).'&'.url_crumb( 'widget_container' ),
'', 0, 0, array( 'onclick' => 'return confirm( \''.TS_('Do you want to reload the default widgets for this container?').'\n'.TS_('THIS CANNOT BE UNDONE!').'\n'.TS_('YOU MAY LOSE SOME CUSTOMIZATIONS!').'\' )' ) );
}
$add_widget_link_params = array();
if( $mode == 'customizer' )
{ // Set special url to add new widget on customizer mode:
$add_widget_url = $admin_url.'?ctrl=widgets&blog='.$Blog->ID.'&skin_type='.$Blog->get_skin_type().'&action=add_list&container='.urlencode( $WidgetContainer->get( 'name' ) ).'&container_code='.urlencode( $WidgetContainer->get( 'code' ) ).'&mode=customizer';
}
else
{ // Add id for link to initialize JS code of opening modal window only for not customizer mode,
// because in customizer mode we should open this as simple link in the same left customizer panel:
$add_widget_link_params['id'] = 'add_new_'.$widget_container_id;
}
$Table->global_icon( T_('Add a widget...'), 'new', $add_widget_url, '', 0, 0, $add_widget_link_params );
}
if( $params['table_layout'] == 'accordion_table' )
{ // Set ID for current widget container for proper work of accordion style:
$params['group_item_id'] = 'container_'.$widget_container_id;
}
$Table->display_init( array_merge( array(
'list_start' => '<div class="panel panel-default">',
'list_end' => '</div>',
), $params ) );
$Table->display_list_start();
// TITLE / COLUMN HEADERS:
$Table->display_head();
if( $params['table_layout'] == 'accordion_table' )
{ // Start of accordion body of current item:
$is_selected_widget_container = empty( $params['selected_wico_ID'] ) || empty( $WidgetContainer ) || $WidgetContainer->ID != $params['selected_wico_ID'];
echo '<div id="'.$params['group_item_id'].'" class="panel-collapse '.( $is_selected_widget_container ? 'collapse' : '' ).'">';
}
// BODY START:
echo '<ul id="container_'.$widget_container_id.'" class="widget_container">';
/**
* @var WidgetCache
*/
$WidgetCache = & get_WidgetCache();
$widgets_SQL = new SQL( 'Get widgets of container #'.$WidgetContainer->ID );
$widgets_SQL->SELECT( 'wi_ID, wi_wico_ID, wi_order, wi_enabled, wi_type, wi_code, wi_params' );
$widgets_SQL->FROM( 'T_widget__widget' );
$widgets_SQL->WHERE( 'wi_wico_ID = '.$DB->quote( $WidgetContainer->ID ) );
$widgets = $DB->get_results( $widgets_SQL, ARRAY_A );
if( ! empty( $widgets ) )
{
$widget_count = 0;
// Load all container widgets once:
$WidgetCache->load_list( array_column( $widgets, 'wi_ID' ) );
foreach( $widgets as $widget )
{
$widget_count++;
$wrong_widget = false;
if( ! ( $ComponentWidget = & $WidgetCache->get_by_ID( $widget['wi_ID'], false, false ) ) )
{ // This is a broken widget, but we should display this in list in order to allow to delete it:
$ComponentWidget = new ComponentWidget();
$ComponentWidget->ID = $widget['wi_ID'];
$ComponentWidget->wico_ID = $widget['wi_wico_ID'];
$ComponentWidget->type = 'wrong';
$ComponentWidget->code = $widget['wi_code'];
$ComponentWidget->params = $widget['wi_params'];
$ComponentWidget->order = $widget['wi_order'];
$ComponentWidget->enabled = $widget['wi_enabled'];
$ComponentWidget->icon = 'warning';
$wrong_widget = true;
}
$enabled = $ComponentWidget->get( 'enabled' );
$disabled_plugin = ( $ComponentWidget->type == 'plugin' && $ComponentWidget->get_Plugin() == false );
if( $ComponentWidget->get( 'code' ) == 'subcontainer' )
{
$container_code = $ComponentWidget->get_param( 'container' );
if( ! isset( $embedded_containers[$container_code] ) ) {
$embedded_containers[$container_code] = true;
}
}
// START Widget row:
echo '<li id="wi_ID_'.$ComponentWidget->ID.'" class="draggable_widget">';
// Checkbox:
if( $mode != 'customizer' )
{ // Don't display on customizer mode:
echo '<span class="widget_checkbox'.( $enabled ? ' widget_checkbox_enabled' : '' ).'">'
.'<input type="checkbox" name="widgets[]" value="'.$ComponentWidget->ID.'" />'
.'</span>';
}
// State:
echo '<span class="widget_state">';
if( $disabled_plugin )
{ // If widget's plugin is disabled:
echo get_icon( 'warning', 'imgtag', array( 'title' => T_('Inactive / Uninstalled plugin') ) );
}
elseif( $wrong_widget )
{ // If widget is wrong, e.g. widget has an old code:
echo get_icon( 'warning', 'imgtag', array( 'title' => T_('Wrong widget / Invalid code') ) );
}
else
{ // If this is a normal widget or widget's plugin is enabled:
echo '<a href="#" onclick="return toggleWidget( \'wi_ID_'.$ComponentWidget->ID.'\' );">'
.get_icon( ( $enabled ? 'bullet_green' : 'bullet_empty_grey' ), 'imgtag', array( 'title' => ( $enabled ? T_('The widget is enabled.') : T_('The widget is disabled.') ) ) )
.'</a>';
}
echo '</span>';
// Name:
$ComponentWidget->init_display( array() );
echo '<span class="widget_title">'
.'<a href="'.regenerate_url( 'blog', 'action=edit&wi_ID='.$ComponentWidget->ID.( $mode == 'customizer' ? '&mode=customizer' : '' ) ).'" class="widget_name"'
.( $mode == 'customizer' ? '' : ' onclick="return editWidget( \'wi_ID_'.$ComponentWidget->ID.'\' )"' )
.'>'
.$ComponentWidget->get_desc_for_list()
.'</a> '
.$ComponentWidget->get_help_link()
.'</span>';
// Cache:
if( $mode != 'customizer' )
{ // Don't display on customizer mode:
echo'<span class="widget_cache_status">';
$widget_cache_status = $ComponentWidget->get_cache_status( true );
switch( $widget_cache_status )
{
case 'disallowed':
echo get_icon( 'block_cache_disabled', 'imgtag', array( 'title' => T_( 'This widget cannot be cached.' ), 'rel' => $widget_cache_status ) );
break;
case 'denied':
echo action_icon( T_( 'This widget could be cached but the block cache is OFF. Click to enable.' ),
'block_cache_denied',
$admin_url.'?ctrl=coll_settings&tab=advanced&blog='.$Blog->ID.'#fieldset_wrapper_caching', NULL, NULL, NULL,
array( 'rel' => $widget_cache_status ) );
break;
case 'enabled':
echo action_icon( T_( 'Caching is enabled. Click to disable.' ),
'block_cache_on',
regenerate_url( 'blog', 'action=cache_disable&wi_ID='.$ComponentWidget->ID.'&'.url_crumb( 'widget' ) ), NULL, NULL, NULL,
array(
'rel' => $widget_cache_status,
'onclick' => 'return toggleCacheWidget( \'wi_ID_'.$ComponentWidget->ID.'\', \'disable\' )',
) );
break;
case 'disabled':
echo action_icon( T_( 'Caching is disabled. Click to enable.' ),
'block_cache_off',
regenerate_url( 'blog', 'action=cache_enable&wi_ID='.$ComponentWidget->ID.'&'.url_crumb( 'widget' ) ), NULL, NULL, NULL,
array(
'rel' => $widget_cache_status,
'onclick' => 'return toggleCacheWidget( \'wi_ID_'.$ComponentWidget->ID.'\', \'enable\' )',
) );
break;
}
echo '</span>';
}
// Actions:
echo '<span class="widget_actions">';
// Edit:
if( $mode != 'customizer' )
{ // Don't display on customizer mode:
echo action_icon( T_('Edit widget settings!'),
'edit',
regenerate_url( 'blog', 'action=edit&wi_ID='.$ComponentWidget->ID ), NULL, NULL, NULL,
array( 'onclick' => 'return editWidget( \'wi_ID_'.$ComponentWidget->ID.'\' )', 'class' => '' )
);
}
// Duplicate:
echo action_icon( T_('Duplicate'),
'duplicate',
regenerate_url( 'blog', 'action=duplicate&wi_ID='.$ComponentWidget->ID.'&'.url_crumb( 'widget' ) ), NULL, NULL, NULL,
array( 'onclick' => 'return duplicateWidget( \'wi_ID_'.$ComponentWidget->ID.'\', \''.$mode.'\' )', 'class' => '' )
);
// Remove:
echo action_icon( T_('Remove this widget!'),
'delete',
regenerate_url( 'blog', 'action=delete&wi_ID='.$ComponentWidget->ID.'&'.url_crumb( 'widget' ) ), NULL, NULL, NULL,
array( 'onclick' => 'return deleteWidget( \'wi_ID_'.$ComponentWidget->ID.'\' )', 'class' => '' )
)
.'</span>';
// END Widget row:
echo '</li>';
}
}
// BODY END:
echo '</ul>';
if( $params['table_layout'] == 'accordion_table' )
{ // End of accordion body of current item:
echo '</div>';
}
$Table->display_list_end();
}
/**
* Display containers
*
* @param string Skin type: 'normal', 'mobile', 'tablet', 'alt'
* @param string Container type: 'main', 'sub', 'page', 'shared', 'shared-sub'
* @param array Params
*/
function display_containers( $skin_type, $container_type, $params = array() )
{
global $Blog, $DB;
$WidgetContainerCache = & get_WidgetContainerCache();
$WidgetContainerCache->clear();
$containers = array();
switch( $container_type )
{
case 'main':
// Get main/skin containers:
$coll_containers = $Blog->get_main_containers( $skin_type );
foreach( $coll_containers as $container_code => $container_data )
{
$WidgetContainer = & $WidgetContainerCache->get_by_coll_skintype_code( $Blog->ID, $skin_type, $container_code );
if( ! $WidgetContainer )
{ // If widget container doesn't exist in DB but it is detected in skin file:
$WidgetContainer = new WidgetContainer();
$WidgetContainer->set( 'code', $container_code );
$WidgetContainer->set( 'name', $container_data[0] );
$WidgetContainer->set( 'coll_ID', $Blog->ID );
$WidgetContainer->set( 'skin_type', $skin_type );
}
$containers[] = $WidgetContainer;
}
break;
case 'sub':
// Get sub-containers:
$containers = $WidgetContainerCache->load_where( 'wico_coll_ID = '.$Blog->ID.'
AND wico_skin_type = '.$DB->quote( $skin_type ).'
AND wico_main = 0
AND wico_item_ID IS NULL' );
break;
case 'page':
// Get page containers:
$containers = $WidgetContainerCache->load_where( 'wico_coll_ID = '.$Blog->ID.'
AND wico_skin_type = '.$DB->quote( $skin_type ).'
AND wico_main = 1
AND wico_item_ID IS NOT NULL' );
break;
case 'shared':
// Get shared main containers:
$containers = $WidgetContainerCache->load_where( 'wico_coll_ID IS NULL
AND wico_skin_type = '.$DB->quote( $skin_type ).'
AND wico_main = 1
AND wico_item_ID IS NULL' );
break;
case 'shared-sub':
// Get shared sub-containers:
$containers = $WidgetContainerCache->load_where( 'wico_coll_ID IS NULL
AND wico_skin_type = '.$DB->quote( $skin_type ).'
AND wico_main = 0
AND wico_item_ID IS NULL' );
break;
}
foreach( $containers as $WidgetContainer )
{ // Display each found container:
display_container( $WidgetContainer, $params );
}
}
/**
* Callback function to sort widget containers array by fields order and name
*
* @param array Widget data
* @param array Widget data
*/
function callback_sort_widget_containers( $a, $b )
{
if( $a[0]->get( 'order' ) == $b[0]->get( 'order' ) )
{ // Sort by name if orders are equal:
return strnatcmp( $a[0]->get( 'name' ), $b[0]->get( 'name' ) );
}
else
{ // Sort by order if they are different:
return $a[0]->get( 'order' ) > $b[0]->get( 'order' );
}
}
/**
* Display action buttons to work with sereral widgets in list
*
* @param object Form
*/
function display_widgets_action_buttons( & $Form )
{
echo '<span class="btn-group">';
$Form->button( array(
'value' => get_icon( 'check_all' ).' '.T_('Check all'),
'id' => 'widget_button_check_all',
'tag' => 'button',
'type' => 'button'
) );
$Form->button( array(
'value' => get_icon( 'uncheck_all' ).' '.T_('Uncheck all'),
'id' => 'widget_button_uncheck_all',
'tag' => 'button',
'type' => 'button'
) );
echo '</span>';
echo '<span class="btn-group">';
$Form->button( array(
'value' => get_icon( 'check_all' ).' '.get_icon( 'bullet_green' ).' '.T_('Check Active'),
'id' => 'widget_button_check_active',
'tag' => 'button',
'type' => 'button'
) );
$Form->button( array(
'value' => get_icon( 'check_all' ).' '.get_icon( 'bullet_empty_grey' ).' '.T_('Check Inactive'),
'id' => 'widget_button_check_inactive',
'tag' => 'button',
'type' => 'button'
) );
echo '</span>';
echo ' '.T_('With checked do:');
echo '<span class="btn-group">';
$Form->button( array(
'value' => get_icon( 'bullet_green' ).' '.T_('Activate'),
'name' => 'actionArray[activate]',
'tag' => 'button',
'type' => 'submit'
) );
$Form->button( array(
'value' => get_icon( 'bullet_empty_grey' ).' '.T_('Deactivate'),
'name' => 'actionArray[deactivate]',
'tag' => 'button',
'type' => 'submit'
) );
echo '</span>';
}
/**
* Get current layout
*
* @return string|NULL Widget layout | NULL - if widget has no layout setting
*/
function get_widget_layout( $params = array() )
{
if( isset( $params['layout'] ) )
{
return $params['layout'];
}
if( isset( $params['thumb_layout'] ) )
{
return $params['thumb_layout'];
}
return NULL;
}
/**
* Get start of layout
*
* @param array Parameters
* @return string
*/
function get_widget_layout_start( $params = array() )
{
switch( get_widget_layout( $params ) )
{
case 'grid':
// Grid / Table layout:
return $params['grid_start'];
case 'flow':
// Flow block layout:
return $params['flow_start'];
case 'rwd':
// RWD block layout:
return $params['rwd_start'];
default:
// List layout:
return $params['list_start'];
}
}
/**
* Get end of layout
*
* @param integer Cell index (used for grid/table layout)
* @param array Parameters
* @return string
*/
function get_widget_layout_end( $cell_index = 0, $params = array() )
{
switch( get_widget_layout( $params ) )
{
case 'grid':
// Grid / Table layout:
$r = '';
$nb_cols = isset( $params['grid_nb_cols'] ) ? $params['grid_nb_cols'] : 1;
if( $cell_index && ( $cell_index % $nb_cols != 0 ) )
{
$r .= $params['grid_colend'];
}
$r .= $params['grid_end'];
return $r;
case 'flow':
// Flow block layout:
return $params['flow_end'];
case 'rwd':
// RWD block layout:
return $params['rwd_end'];
default:
// List layout:
return $params['list_end'];
}
}
/**
* Get item start of layout
*
* @param integer Cell index (used for grid/table layout)
* @param boolean TRUE if current item/cell is selected
* @param string Prefix for param
* @param array Parameters
* @return string
*/
function get_widget_layout_item_start( $cell_index = 0, $is_selected = false, $disp_param_prefix = '', $params = array() )
{
switch( get_widget_layout( $params ) )
{
case 'grid':
// Grid / Table layout:
$r = '';
$nb_cols = isset( $params['grid_nb_cols'] ) ? $params['grid_nb_cols'] : 1;
if( $cell_index % $nb_cols == 0 )
{
$r .= $params['grid_colstart'];
}
$r .= $params['grid_cellstart'];
return $r;
case 'flow':
// Flow block layout:
return $params['flow_block_start'];
case 'rwd':
// RWD block layout:
$r = $params['rwd_block_start'];
if( isset( $params['rwd_block_class'] ) )
{ // Replace css class of RWD block with value from widget setting:
$r = str_replace( '$wi_rwd_block_class$', $params['rwd_block_class'], $r );
}
return $r;
default:
// List layout:
if( $is_selected )
{
return $params[$disp_param_prefix.'item_selected_start'];
}
else
{
return $params[$disp_param_prefix.'item_start'];
}
}
}
/**
* Get item end of layout
*
* @param integer Cell index (used for grid/table layout)
* @param boolean TRUE if current item/cell is selected
* @param string Prefix for param
* @param array Parameters
* @return string
*/
function get_widget_layout_item_end( $cell_index = 0, $is_selected = false, $disp_param_prefix = '', $params = array() )
{
switch( get_widget_layout( $params ) )
{
case 'grid':
// Grid / Table layout:
$r = $params['grid_cellend'];
$nb_cols = isset( $params['grid_nb_cols'] ) ? $params['grid_nb_cols'] : 1;
if( $cell_index % $nb_cols == 0 )
{
$r .= $params['grid_colend'];
}
return $r;
case 'flow':
// Flow block layout:
return $params['flow_block_end'];
case 'rwd':
// RWD block layout:
return $params['rwd_block_end'];
default:
// List layout:
if( $is_selected )
{
return $params[$disp_param_prefix.'item_selected_end'];
}
else
{
return $params[$disp_param_prefix.'item_end'];
}
}
}
?>
|
Sopron County
Sopron (German: Ödenburg) was an administrative county (comitatus) of the Kingdom of Hungary in present-day eastern Austria and northwestern Hungary. The capital of the county was Sopron.
Geography
Sopron county shared borders with the Austrian land Lower Austria and the Hungarian counties Moson, Győr, Veszprém and Vas. The Lake Neusiedl (Hungarian: Fertő tó, German: Neusiedler See) lay in the county. Its area was 3,241 km² around 1910.
History
The Sopron comitatus arose as one of the first comitatus of the Kingdom of Hungary.
In 1920, by the Treaty of Trianon the western part of the county became part of the Austrian state of Burgenland, while the eastern part became a part of Hungary. In 1921, it was decided by referendum that the city of Sopron would join Hungary instead of Austria.
After World War II, Sopron county merged with Győr-Moson-Pozsony to form Győr-Sopron county. This county was renamed to Győr-Moson-Sopron county in the early 1990s. A small part of Sopron county went to Vas county.
Demographics
1900
In 1900, the county had a population of 279,796 people and was composed of the following linguistic communities:
Total:
Hungarian: 136,616 (48.8%)
German: 109,369 (39.1%)
Croatian: 31,317 (11.2%)
Slovak: 505 (0.2%)
Romanian: 22 (0.0%)
Serbian: 12 (0.0%)
Ruthenian: 4 (0.0%)
Other or unknown: 1,951 (0.7%)
According to the census of 1900, the county was composed of the following religious communities:
Total:
Roman Catholic: 235,390 (84.1%)
Lutheran: 33,924 (12.1%)
Jewish: 9,736 (3,5)
Calvinist: 641 (0.2%)
Greek Catholic: 53 (0.0%)
Greek Orthodox: 26 (0.0%)
Unitarian: 15 (0.0%)
Other or unknown: 11 (0.0%)
1910
In 1910, the county had a population of 283,510 people and was composed of the following linguistic communities:
Total:
Hungarian: 141,011 (49.7%)
German: 109,160 (38.5%)
Croatian: 31,004 (10.9%)
Slovak: 397 (0.1%)
Romanian: 33 (0.0%)
Serbian: 15 (0.0%)
Ruthenian: 4 (0.0%)
Other or unknown: 1,886 (0.7%)
According to the census of 1910, the county was composed of the following religious communities:
Total:
Roman Catholic: 239,578 (84.5%)
Lutheran: 34,820 (12.3%)
Jewish: 8,192 (2,9)
Calvinist: 743 (0.3%)
Greek Catholic: 93 (0.0%)
Greek Orthodox: 50 (0.0%)
Unitarian: 27 (0.0%)
Other or unknown: 7 (0.0%)
Subdivisions
In the early 20th century, the subdivisions of Sopron county were:
Eisenstadt, Mattersburg, Rust and Oberpullendorf are now in Austria.
References
Category:1920 disestablishments
Category:Counties in the Kingdom of Hungary
Category:States and territories established in the 12th century
Category:Győr-Moson-Sopron County
Category:Sopron
Category:Eisenstadt-Umgebung District
Category:Eisenstadt
Category:Mattersburg District
Category:Oberpullendorf District
Category:Vas County |
package org.nutz.mock.servlet.multipart.inputing;
import java.io.IOException;
public class VoidInputing implements Inputing {
public void close() throws IOException {}
public void init() throws IOException {}
public int read() throws IOException {
return -1;
}
public long size() {
return 0;
}
}
|
Doing Game Gravity Right - Charles__L
http://www.niksula.hut.fi/~hkankaan/Homepages/gravity.html
======
ori_b
This is still Euler integration, which has poor accuracy whenever the
derivative varies with time. The standard numerical integration method is 4th
order Runge Kutta. RK4 is also popular for solving many forms of differential
equations.
A good summary is here: <http://gafferongames.com/game-physics/integration-
basics/>
~~~
hyperlogic
Correct me if I'm wrong, there is no reason to numerically integrate this.
This is not a differential equation. The integral solution is a simple
function that can just be evaluated.
~~~
walrus
Leaving it as a differential equation gives you some room to experiment more
easily. For example, suppose you want to add a swimming mechanic to your game:
you might end up with a completely different closed form solution, but if you
left it as a differential equation it could just be a couple extra additive
terms.
------
tlarkworthy
you are still doing it wrong. dt should not be affected by framerate.
<http://gafferongames.com/game-physics/fix-your-timestep/>
use an accumulator to have a fixed dt no matter the framerate. With a variable
step size you risk all kinds of weird bugs linked to the hard to debug
rendering context. The size of dt should be consider a system parameter, tuned
for your game and __fixed in concrete __.
~~~
rorrr
So what happens when the OS doesn't return to your process in _dt_ time?
The whole point of _dt_ is to deal with variable framerate.
~~~
paulhodge
When your game does regain control, it can run the simulation for N steps
(however many it usually does for the given dt), then finally render the scene
using the latest state. (so the game will appear to pause, then skip ahead).
Or it can try to play catch-up, it does 1 tick and render at a time, but with
a reduced delay between frames until it's "caught up". (so the game will
pause, then appear fast-forwarded for a bit).
Either way Tlark is right, you really don't want the game logic to be affected
by framerate.
------
JabavuAdams
This is still basically wrong for general game physics. I.e. you should _not_
blindly follow the author's suggestion to use it for all forces.
It _happens_ to be an exact solution for one very specific situation -- the
case of a constant force that is always applied. In this case, unvarying
gravity with no air resistance.
This is typically one of the first things you learn in a Classical Mechanics
course, because they can teach it using just Kinematics (the definitions of
displacement, velocity, and acceleration) before introducing Dynamics
(forces).
To prove it, you can just integrate the definition of acceleration twice and
recognize that the integration constants are your initial position and
velocity.
If the time-step changes or if forces are due to input, or other changing
factors then this is still a pretty terrible method.
Ah ... I should clarify ... the method is not so terrible, but rather the
author's explanation and rationale are. Basically, it slightly improves on one
little piece of the puzzle, and completely ignores the real issues like fixed
time steps, render/physics/network/game logic loop decoupling, and stiff
systems.
FWIW, I shipped two hit games this year that only used Euler integration and
worse hacks. It made life painful, though.
------
tzs
Udacity has a course, "Differential Equations in Action", that's about
numerical solutions of equations of motion and other differential equations
from physics, biology, and so on.
<http://www.udacity.com/overview/Course/cs222/CourseRev/1>
~~~
pvarangot
I'm between doing that course or doing this one:
[http://ocw.mit.edu/courses/mathematics/18-03sc-
differential-...](http://ocw.mit.edu/courses/mathematics/18-03sc-differential-
equations-fall-2011/)
Anyone has any insight into the strenghts and weaknesses of each one? I've
been unable to find any comprehensive review online about them. I don't have
time to do both simultaneously, but can do one first and the other later or
alternate between them.
I don't have a strong calculus background though I'm above the average
"programmer" or compsci graduate. I'm interested in simulation and numerical
problems (specially finite element method) but theoretical background is
welcome when its not overwhelming (i.e. when its there for you to understand
but its not the focus of the course).
~~~
EliRivers
The Python necessary for the Udacity one is a bit of a pig if you've never
coded in Python before. They help out a lot by essentially presenting complete
programmes with you needing only to fill out some extra calculations, so you
can concentrate on the important bit, but nonetheless if you're used to being
able to identify the type of an object by looking at its creation point it's a
bit of a mystery to begin with, especially since the first module uses 2D
arrays to represent location and velocity - there are some handy Python
functions to turn them into distances/vectors from various points, but if
you're not familiar with them you'll spend too much time wrestling with Python
instead of thinking about the DEs.
There's also the occasional big gap here and there between the video lecture
and what you're expected to do (indeed, sometimes it's actually quite tricky
to just work out what you're expected to do, despite the helpful comments in
the code - I've found that the hardest aspect is not solving the problem, but
getting a clear picture of the question being asked and translating the
solution into python). For language reference, I am an experienced coder in C
and C-related languages (C++ and non-Cocoa Obj-C).
Still, it's early days and I expect these things will be ironed out over time.
------
brianchu
For other simple methods of numerical integration, look at the Trapezoidal
Rule and Simpson's Rule, two staples of high school (or college) calculus.
Since we're talking about gaming, it bears noting that Box2D (and most physics
engines, for that matter) uses the Semi-implicit Euler method
(<http://en.wikipedia.org/wiki/Symplectic_Euler_method>). The author of Box2D
mentions that this is a better method than Verlet integration because
calculating friction requires knowing velocity.
------
Xcelerate
This same thing is used in molecular dynamics simulations. For instance, there
is an algorithm called RESPA that is used to break integrations of different
types of particle interactions into appropriate timestep intervals. Bond
vibrations must be calculated much more frequently than non-bonded
interactions.
The algorithm (reversible RESPA) is formally derived from the Liouville
operator (which governs the time evolution of any property):
A(t) = exp(iLt) * A(0)
For instance, A(t) can be position or momentum. The Liouville operator must be
symmetric in order to generate a reversible numerical integration algorithm.
The result of all this is basically that:
p(t + ∆t/2) = p(t) + ∆t/2 F(r(t))
r(t + ∆t) = r(t) + ∆t p(t + ∆t/2)
p(t + ∆t) = p(t + ∆t/2) + ∆t/2 F(r, t + ∆t)
where p is momentum, r is position, and F is force.
~~~
zbyszek
This was also colloquially known as the "leapfrog" algorithm and is the
simplest of a class of integrators that are symmetric (in simulation time) and
symplectic which are crucial properties for some simulations. I take it that
RESPA is the partitioning of the time evolution operator into components with
different force gradients, and the application of different integration
schemes to those components. One can also generalise leapfrog to integrate the
momentum (or some part) with n steps of dt/n.
The metric used to describe their accuracy is the degree to which they violate
the conservation of energy, which can be shown to be an odd integral power of
the timestep dt per step [0]. The error in leapfrog goes like the 3rd power.
Higher order integration schemes can be derived e.g. [1]. They may not be
useful in practice, depending on the cost of computing the individual terms
and the accumulation of finite precision errors. But the known scaling
behaviour provides a nice way of verifying the calculation of the evolution
operators. Another nice thing to do is to compute the "round trip", i.e.
integrate forwards in time, and then backwards. With a symmetric integrator
you should end up where you started in terms of position, momentum and energy,
regardless of step size, so computing a suitable difference and seeing how it
scales with trajectory length can be informative. (e.g. one can compute a
Lyapunov exponent from such round-trips to see if the underlying dynamics are
chaotic).
[0] McLachlan and Atela, Nonlinearity 5 (1992)
<http://www.massey.ac.nz/~rmclachl/si.ps> (PS) [1] M. Creutz, A. Gocksch;
Phys. Rev. Lett. 63 (1989) <http://thy.phy.bnl.gov/~creutz/mypubs/pub106.pdf>
(PDF)
------
chrismorgan
This is known as the midpoint method.
<http://en.wikipedia.org/wiki/Midpoint_method>
------
podperson
It's an interesting post, but perhaps a simpler way of looking at the whole
thing is you should be using average velocity over the time elapsed rather
than the just-calculated new velocity.
This becomes:
velocity_new = velocity_old + acceleration * time_elapsed
position_new = position_old + (velocity_old + velocity_new) * 0.5 *
time_elapsed
It makes immediate, intuitive sense (at least it does to me) and doesn't
require even thinking about differential equations (at least for constant
forces).
------
lnanek2
His improved graph actually still doesn't hit the peak at all frame rates. The
right way to do things from the usability perspective would be the calculate
the peak and make sure the player can hit exactly that at some point.
Otherwise areas that are supposed to be reachable may not be, as he says. The
code for that wold be a lot more complex, though, so it may be the wrong thing
from a business perspective, spending large amounts of your dev time on a
small edge case of users and user situations.
------
ww520
TIL that I have been doing acceleration calculation all wrong over the years.
Thanks for the insight.
~~~
hyperlogic
I'm a gamedev and I actually use this as in interview question. Getting people
to understand this distinction is the difference between pass and fail.
------
Strilanc
You can cut down the amount of error even further by not iterating. Instead of
iteratively updating the height, just store the initial position, velocity and
time. You still compute the current position as pi + vi * dt - a * dt * dt/2,
but intermediate results are discarded to avoid compounding floating point
errors.
Of course, you will need to update the initial position/velocity/time whenever
the jump is interrupted or modified. The reduction in error is also quite
small.
~~~
dalke
That assumes that there are no other forces. Your solution doesn't handle
momentum changes (throwing an object, or taking a bullet, or being close to an
explosion) while in the air, and it assumes that there's no maximum or
terminal velocity in the game. It also becomes trickier to compute when your
objects hit other objects.
You say that "you will need to update the initial [state vector] whenever the
jump is interrupted or modified" - that's exactly what numerical integration
does. So your solution seems like it would use a closed-form solution for some
cases, and numerical integration for others, which would make the dynamics
code easily twice as complicated.
While switching from Euler to leapfrog integration is a couple of lines of
change, for a better approximation.
------
pfisch
Why does this even matter? If you have a large delta time then your game is
fucked anyway. Collision detection will likely also be broken and the game is
unplayably choppy anyway so it doesn't even matter.
~~~
robertfw
I remember a car trick (do a barrel roll) in GTA San Andreas that for the life
of me I could not accomplish. I found out that this variable physics was
likely the problem - I dropped the graphics settings to minimum, and I was
able to do the trick.
This is on a quad core, 8GB ram, 1GB video card machine - it's no slouch - but
the subtle difference was enough to make my task impossible.
~~~
pfisch
Is this worth making the whole game run slower all the time for everyone? That
is what you are talking about here.
~~~
ncallaway
This is incorrect. The suggested approach makes the game significantly more
accurate adding 3 multiplications and an addition. This does not make the game
noticeably slower. If you're concerned about 3 multiplications and an addition
you're going to need to show me some profiler data that shows this as a
specific bottle-neck in the game-logic.
~~~
pfisch
No, you are talking about adding all of these operations per object in the
game world.
It doesn't stop at gravity either. Virtually everything in the game world is
moving via acceleration. If you were going to do this in a consistent manner
you would need to do this for every single physics calculation for every
single game world object.
You are correct that you would have to profile it to determine how much of an
issue it would be but it sounds like potentially a lot of deadweight to add to
the game. Especially since when games slow down it is often due to having a
lot of objects in the gameworld simultaneously.
------
Trufa
What id don't understand is, wouldn't this be only half more correct? I'm not
really sure if my question makes sense.
~~~
jws
It isn't that they cut the interval by half. It happens that for constant
acceleration, this midpoint happens to lay on the actual solution. Notice that
there is only one summing of position, and two of velocity.
------
jpatokal
This isn't exactly a new development, as the article in question was first
posted on May 13th, 2000.
~~~
mikevm
Even if something was first published in 1969, some of us are seeing it for
the first time. Anyhow, no one was claiming that this was a "new development".
------
raldi
Can someone explain the jumping parabola graphs? I can't make sense of the
description.
~~~
Garoof
X is time, Y is height. So something like, X time after hitting the jump
button, the guy is Y above the ground.
(Or you can pretend that the guy is moving towards the right at constant
speed, and jumping, and the points in the graphs are the different positions
he'll be at :)
(Edit: I'm not very sure about the pictures to the left though. Maybe higher
jumps/longer time or somethingsomething.)
~~~
raldi
Yeah, I don't get the difference between the left and right sides of the two
graphs either.
~~~
njharman
I believe the only difference is in units. Left showing delta time. right
showing FPS.
~~~
Garoof
Yeah, but shouldn't a delta of 1/3s be the same as 3fps? But the 1/3s to the
left does not look like the 3fps to the right.
And it does say that the picture to the right is just like in Quake. So I was
guessing that maybe the one to the left is not. Like, it has higher initial
velocity and max height, and longer time spent in the air. Like the picture to
the right is a jump that lasts for <1s while the one to the left is a way
longer one.
Would be nice to have like axes with labels and things on them.
------
snake_plissken
right vs left sided delta summations. calc 1.
------
martinced
There are several ways to do "game gravity right" and not just one answer.
For example some games have entirely reproducible game states which depends on
only two things: the seed given to the PRNG and the inputs made the player
(and the time at which they happened).
There are a lot of games (probably most of them) which have gravity but which
aren't "real" physics simulation and/or which do definitely not need a "real"
physics simulation to be, well, fun games.
Some of them do simply use integer-math and precomputed "gravity lookup
tables" entirely consisting of integers. You then use the time elapsed to know
where you should look in your table and you can of course compute a value
"between two lookup indices".
The advantage of integer math (either using gravity lookup table or not),
compared to floating-point math, is that your game engine can stay
deterministic even if the floating-point numbers implementation vary from one
platform / virtual machine to the other.
|
Q:
Convert I2C Sensor (DS1624) reading into number
First off, sorry for the confusing title. It's pretty late here and I wasn't able to come up with a better one.
So, I have a I2C temperature sensor that outputs the current temperature as a 16 bit word. Reading from LEFT to RIGHT, the 1st bit is the MSB and the 13th bit is the LSB, so 13 bits are payload and the last 3 bits are zeros. I want to read out that sensor with a Raspberry Pi and convert the data.
The first byte (8 bits) are the integer part of the current temperature. If and only if the temperature is negative, the two's complement of the entire word has to be built.
the second byte is the decimal part which has to be multiplied by 0.03125.
So, just a couple of examples (TEMP DIGITAL OUTPUT (Binary) / DIGITAL OUTPUT (Hex), taken from the data sheet here http://datasheets.maximintegrated.com/en/ds/DS1624.pdf)
+125˚C | 01111101 00000000 | 7D00h
+25.0625˚C | 00011001 00010000 | 1910h
+½˚C | 00000000 10000000 | 0080h
0˚C | 00000000 00000000 | 0000h
-½˚C | 11111111 10000000 | FF80h
-25.0625˚C | 11100110 11110000 | E6F0h
-55˚C | 11001001 00000000 | C900h
Because of a difference in endianness the byte order is reversed when reading the sensor, which is not a problem. For example, the first line would become 0x007D instead of 0x7D00, 0xE6F0 becomes F0E6, and so on...
However, once I build the two's complement for negative values I'm not able to come up with a correct conversion.
What I came up with (not working for negative values) is:
import smbus
import time
import logging
class TempSensor:
"""
Class to read out an DS1624 temperature sensor with a given address.
DS1624 data sheet: http://datasheets.maximintegrated.com/en/ds/DS1624.pdf
Usage:
>>> from TempSensor import TempSensor
>>> sensor = TempSensor(0x48)
>>> print "%02.02f" % sensor.get_temperature()
23.66
"""
# Some constants
DS1624_READ_TEMP = 0xAA
DS1624_START = 0xEE
DS1624_STOP = 0x22
def __init__(self, address):
self.address = address
self.bus = smbus.SMBus(0)
def __send_start(self):
self.bus.write_byte(self.address, self.DS1624_START);
def __send_stop(self):
self.bus.write_byte(self.address, self.DS1624_STOP);
def __read_sensor(self):
"""
Gets the temperature data. As the DS1624 is Big-endian and the Pi Little-endian,
the byte order is reversed.
"""
"""
Get the two-byte temperature value. The second byte (endianness!) represents
the integer part of the temperature and the first byte the fractional part in terms
of a 0.03125 multiplier.
The first byte contains the value of the 5 least significant bits. The remaining 3
bits are set to zero.
"""
return self.bus.read_word_data(self.address, self.DS1624_READ_TEMP)
def __convert_raw_to_decimal(self, raw):
# Check if temperature is negative
negative = ((raw & 0x00FF) & 0x80) == 0x80
if negative:
# perform two's complement
raw = (~raw) + 1
# Remove the fractional part (first byte) by doing a bitwise AND with 0x00FF
temp_integer = raw & 0x00FF
# Remove the integer part (second byte) by doing a bitwise AND with 0XFF00 and
# shift the result bits to the right by 8 places and another 3 bits to the right
# because LSB is the 5th bit
temp_fractional = ((raw & 0xFF00) >> 8) >> 3
return temp_integer + ( 0.03125 * temp_fractional)
def run_test(self):
logging.basicConfig(filename='debug.log', level=logging.DEBUG)
# Examples taken from the data sheet (byte order swapped)
values = [0x7D, 0x1019, 0x8000, 0, 0x80FF, 0xF0E6, 0xC9]
for value in values:
logging.debug('value: ' + hex(value) + ' result: ' + str(self.__convert_raw_to_decimal(value)))
def get_temperature(self):
self.__send_start();
time.sleep(0.1);
return self.__convert_raw_to_decimal(self.__read_sensor())
If you run the run_test() method you'll see what i mean. All negatives values are wrong.
The results I get are:
DEBUG:root:value: 0x7d result: 125.0
DEBUG:root:value: 0x1019 result: 25.0625
DEBUG:root:value: 0x8000 result: 0.5
DEBUG:root:value: 0x0 result: 0.0
DEBUG:root:value: 0x80ff result: 1.46875
DEBUG:root:value: 0xf0e6 result: 26.03125
DEBUG:root:value: 0xc9 result: 55.96875
So, I've been banging my head for hours on this one, but it seems I'm lacking the fundamentals of bit-wise operations. I believe that the problem is the masking with the logical AND when values are negative.
EDIT: There are a couple of implementations on the web. None of them works for negative temperatures. I tried it by actually putting the sensor in ice water. I haven't tried the Arduino C++ version yet, but from looking at the source code it seems it doesn't build the two's complement at all, so no negative temperatures either (https://github.com/federico-galli/Arduino-i2c-temperature-sensor-DS1624/blob/master/DS1624.cpp).
A:
Two things, you've got your masks turned around, raw & 0x00ff is the fractional part, not the integer part, and second, this is my solution, given the inputs in your table, this seems to work for me:
import struct
def convert_temp (bytes):
raw_temp = (bytes & 0xff00) >> 8
raw_frac = (bytes & 0x00ff) >> 3
a, b = struct.unpack('bb', '{}{}'.format(chr(raw_temp), chr(raw_frac)))
return a + (0.03125 * b)
The struct module is really nifty when working with more basic data types (such as signed bytes). Hope this helps!
Edit: ignore the comment on your masks, I see my own error now. You can switch around the bytes, should be no problem.
Struct explanation:
Struct.(un)pack both take 2 arguments, the first is a string that specified the attributes of your struct (think in terms of C). In C a struct is just a bunch of bytes, with some information about their types. The second argument is the data that you need decoded (which needs to be a string, explaining the nasty format()).
I can't seem to really explain it any further, I think if you read up on the struct module, and structs in C, and realize that a struct is nothing more then a bunch of bytes, then you should be ok :).
As for the two's complement, that is the regular representation for a signed byte, so no need to convert. The problem you where having is that Python doesn't understand 8-bit integers, and signedness. For instance, you might have a signed byte 0x10101010, but if you long() that in Python, it doesn't interpret that as a signed 8-bit int. My guess is, it just puts it inside and 32-bit int, in which case the sign bit gets interpretted as just the eighth bit.
What struct.unpack('b', ...) does, is actually interpret the bits as a 8-bit signed integer. Not sure if this makes it any clearer, but I hope it helps.
|
/**
* Copyright 2009-2019 the original author or authors.
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package org.apache.ibatis.type;
import static org.junit.jupiter.api.Assertions.assertEquals;
import static org.mockito.Mockito.never;
import static org.mockito.Mockito.verify;
import static org.mockito.Mockito.when;
import org.junit.jupiter.api.Test;
class StringTypeHandlerTest extends BaseTypeHandlerTest {
private static final TypeHandler<String> TYPE_HANDLER = new StringTypeHandler();
@Override
@Test
public void shouldSetParameter() throws Exception {
TYPE_HANDLER.setParameter(ps, 1, "Hello", null);
verify(ps).setString(1, "Hello");
}
@Override
@Test
public void shouldGetResultFromResultSetByName() throws Exception {
when(rs.getString("column")).thenReturn("Hello");
assertEquals("Hello", TYPE_HANDLER.getResult(rs, "column"));
verify(rs, never()).wasNull();
}
@Override
public void shouldGetResultNullFromResultSetByName() throws Exception {
// Unnecessary
}
@Override
@Test
public void shouldGetResultFromResultSetByPosition() throws Exception {
when(rs.getString(1)).thenReturn("Hello");
assertEquals("Hello", TYPE_HANDLER.getResult(rs, 1));
verify(rs, never()).wasNull();
}
@Override
public void shouldGetResultNullFromResultSetByPosition() throws Exception {
// Unnecessary
}
@Override
@Test
public void shouldGetResultFromCallableStatement() throws Exception {
when(cs.getString(1)).thenReturn("Hello");
assertEquals("Hello", TYPE_HANDLER.getResult(cs, 1));
verify(cs, never()).wasNull();
}
@Override
public void shouldGetResultNullFromCallableStatement() throws Exception {
// Unnecessary
}
} |
China disrupts some websites linked to US content delivery network
It's no surprise when China censors a site with anti-government content, but starting last week the country has potentially cut access to scores of non-political sites with a block on U.S. content delivery network EdgeCast Networks.
The "Great Firewall of China" has begun filtering out more sites and networks connected to EdgeCast customers, preventing the services from appearing in the country, the Verizon-owned company said in a blogpost Monday.
"This week we've seen the filtering escalate with an increasing number of popular web properties impacted," it said. "and even one of our many domains being partially blocked...with no rhyme or reason as to why."
EdgeCast didn't mention which specific services had been affected. But from Beijing, sites from its customers including Mercedes-Benz, Sony and humor website Break.com all appeared to be blocked.
"We can say that only a subset of our customers were impacted," Edgecast said in an email. The company has a "number of methods" to mitigate the problems and has given its customers access to them, Edgecast added without elaborating. It has business with over 6,000 companies.
Censorship monitoring group GreatFire.org said that starting on Nov. 12 China had begun disrupting EdgeCast's service, with a block on edgecastcdn.net.
Other sites that appear to be affected include The Atlantic, developer platform Drupal and art showcasing site deviantART, GreatFire added in a Tuesday blogpost..
China, already infamous for its online censorship, has never said why certain sites are blocked, only suggesting that they broke the law in some way. The country has typically targeted Internet services with the potential to spread politically sensitive posts, and blocked access to Facebook, Twitter and YouTube.
Starting this year, however, China has become more aggressive in cutting access to foreign Internet services. In late May, the country began blocking all Google services. Later, the censors went after messaging apps including Line and photo-sharing app Instagram.
The block on EdgeCast may have been an attempt to cut access to one particular site, but ended up affecting several others.
GreatFire.org, which opposes the country's censorship, has been setting up mirror sites so that Chinese users can circumvent the censors and access banned services such as Google search.
These mirror sites work by hosting them on major cloud platforms from Amazon Web Services and EdgeCast, and using an encrypted domain. To block the mirror sites, China would have to cut access to the entire domain.
"In the case of EdgeCast, the authorities have chosen to block access to their service altogether," GreatFire said in its blogpost.
Copyright 2016 IDG Communications. ABN 14 001 592 650. All rights reserved. Reproduction in whole or in part in any form or medium without express written permission of IDG Communications is prohibited. |
// 32feet.NET - Personal Area Networking for .NET
//
// InTheHand.Net.Bluetooth.BLUETOOTH_DEVICE_INFO
//
// Copyright (c) 2003-2008 In The Hand Ltd, All rights reserved.
// This source code is licensed under the MIT License
using System;
using System.Runtime.InteropServices;
#if WinXP
using InTheHand.Win32;
using System.Text;
using System.Diagnostics;
#endif
namespace InTheHand.Net.Bluetooth.Msft
{
#if WinXP
[StructLayout(LayoutKind.Sequential, CharSet=CharSet.Unicode)]
#endif
internal struct BLUETOOTH_DEVICE_INFO
{
internal int dwSize;
internal long Address;
internal uint ulClassofDevice;
#if WinXP
[MarshalAs(UnmanagedType.Bool)]
#endif
internal bool fConnected;
#if WinXP
[MarshalAs(UnmanagedType.Bool)]
#endif
internal bool fRemembered;
#if WinXP
[MarshalAs(UnmanagedType.Bool)]
#endif
internal bool fAuthenticated;
#if WinXP
internal SYSTEMTIME stLastSeen;
//[MarshalAs(UnmanagedType.ByValArray, SizeConst = 16, ArraySubType = UnmanagedType.U1)]
internal SYSTEMTIME stLastUsed;
[MarshalAs(UnmanagedType.ByValTStr, SizeConst=248)]
#endif
internal string szName;
public BLUETOOTH_DEVICE_INFO(long address)
{
dwSize = 560;
this.Address = address;
ulClassofDevice = 0;
fConnected = false;
fRemembered = false;
fAuthenticated = false;
#if WinXP
stLastSeen = new SYSTEMTIME();
stLastUsed = new SYSTEMTIME();
// The size is much smaller on CE (no times and string not inline) it
// appears to ignore the bad dwSize value. So don't check this on CF.
System.Diagnostics.Debug.Assert(Marshal.SizeOf(typeof(BLUETOOTH_DEVICE_INFO)) == dwSize, "BLUETOOTH_DEVICE_INFO SizeOf == dwSize");
#endif
szName = "";
}
public BLUETOOTH_DEVICE_INFO(BluetoothAddress address)
{
if (address == null) {
throw new ArgumentNullException("address");
}
dwSize = 560;
this.Address = address.ToInt64();
ulClassofDevice = 0;
fConnected = false;
fRemembered = false;
fAuthenticated = false;
#if WinXP
stLastSeen = new SYSTEMTIME();
stLastUsed = new SYSTEMTIME();
// The size is much smaller on CE (no times and string not inline) it
// appears to ignore the bad dwSize value. So don't check this on CF.
System.Diagnostics.Debug.Assert(Marshal.SizeOf(typeof(BLUETOOTH_DEVICE_INFO)) == dwSize, "BLUETOOTH_DEVICE_INFO SizeOf == dwSize");
#endif
szName = "";
}
#if WinXP
internal DateTime LastSeen
{
get
{
return stLastSeen.ToDateTime(DateTimeKind.Utc);
}
}
internal DateTime LastUsed
{
get
{
return stLastUsed.ToDateTime(DateTimeKind.Utc);
}
}
#endif
//--------
#if !NETCF
internal static BLUETOOTH_DEVICE_INFO Create(BTH_DEVICE_INFO deviceInfo)
{
Debug.Assert(0 != (deviceInfo.flags & BluetoothDeviceInfoProperties.Address),
"BTH_DEVICE_INFO Address field flagged as empty!: " + deviceInfo.address.ToString("X12"));
BLUETOOTH_DEVICE_INFO bdi0 = new BLUETOOTH_DEVICE_INFO(deviceInfo.address);
//
if (0 != (deviceInfo.flags & BluetoothDeviceInfoProperties.Cod)) {
bdi0.ulClassofDevice = deviceInfo.classOfDevice;
}
byte[] nameUtf8 = deviceInfo.name;
if (0 != (deviceInfo.flags & BluetoothDeviceInfoProperties.Name)) {
int end = Array.IndexOf<byte>(nameUtf8, 0);
if (end != -1) {
string name = Encoding.UTF8.GetString(nameUtf8, 0, end);
bdi0.szName = name;
}
}
bdi0.fAuthenticated = 0 != (deviceInfo.flags & BluetoothDeviceInfoProperties.Paired);
bdi0.fConnected = 0 != (deviceInfo.flags & BluetoothDeviceInfoProperties.Connected);
bdi0.fRemembered = 0 != (deviceInfo.flags & BluetoothDeviceInfoProperties.Personal);
//
return bdi0;
}
#endif
}
}
|
Transcript for Turkish Airlines makes emergency landing at JFK Airport
Back at home, the emergency landing at JFK in New York. More than two dozen passengers and crew injured by severe turbulence. The shaking so violent, some passengers afraid they weren't going to make it. A crew member even breaking his leg. Here's Zachary kiesch. Reporter: It was less than an hour before landing when the turbulence hit. Turkish 1, unable to maintain personal space due to turbulence. Reporter: The passenger who took this video said there was no warning. And that the shaking lasted more than five minutes, causing serious injuries. I see people starting to, like, fly in the plane. Then seeing blood all over. Reporter: A bloody handprint, visible, as passengers tried to steady themselves. Some were slashed on the head and back. One flight attendant broke her leg. The severity clear in this exchange with the tower. Do you have a doctor onboard? We do. He's helping her right now. But we're going to need assistance after the landing. Reporter: A passenger told us, although the seat belt light was on, many were standing to stretch after a long flight. A lot of people jerked up, some people hit the ceiling. Some people hit the sides of the it really just came out of nowhere. It was pretty dramatic, and you could definitely feel the zero gravity sense of dropping. Reporter: The flight was met by ambulances at JFK, and 30 were taken to the hospital. A crew member seen here limping off the flight. Many put on stretchers. Most of the passengers have been released. Five are still in the hospital with non-life threatening injuries. Now, the plane was inspected, determined to be okay, and put back in service. Tom? Zachary, thank you.
This transcript has been automatically generated and may not be 100% accurate. |
Transparency Market Research has released a new market report titled “Solder Paste Market (Product, Application, and Region) – Global Industry Analysis, Size, Share, Growth, Trends, and Forecast -– 2017–2025.” According to the report, the global flexographic printing inks market was valued at US$ 6,560.4 Mn in 2016 and is projected to reach US$ 10,919.4 Mn by 2025, expanding at a CAGR of 5.8% from 2017 to 2025.
Flexographic printing is one of the most important conventional printing processes. It uses flexible printing plates to print on various substrates. Historically, flexographic printing was known as aniline printing, primarily because flexographic printing presses used inks based on aniline dyes. The flexographic printing process is used mostly on flexible materials including corrugated boxes, paper and plastic bags, folding cartons, milk cartons, disposable cups, tags and labels. Printing plates used in printing processes are made up of plastic, rubber or photopolymer. This assures high flexibility and elevated longevity. Flexographic printing plates have raised images, which are rubbed against the substrate to produce the necessary image on it. Flexographic ink is supplied to ink rolls through the ink reservoir. These rolls further supply the ink to anilox rolls, which meter the ink and apply the necessary quantity of ink to the cylinder containing flexographic plates. These plates are pressed against the substrate to produce the required image on the substrate.
Stringent regulations related to VOC emissions have forced ink manufacturers to comply with environmental, health, and safety standards during the production of printing inks. The U.S. Environmental Protection Agency (EPA) developed the EPA test method 24 as a standard test to determine the amount of VOCs in inks. Usage of inorganic solvents and toxic metals such as cadmium, hexavalent chromium, lead, and mercury in printing inks adversely affects the environment.
Volatility in crude oil prices currently prevailing in the market is a key factor likely to affect the flexographic printing inks market. Crude oil is one of the major raw materials used in printing inks. Its prices have been fluctuating significantly for the last few years, which has adversely affected the prices of inks used in the publication industry. Other factors such as rising GDP and growing population of young consumers and continuously changing lifestyles are likely to boost the demand for packaged consumer products. This, in turn, is anticipated to propel the packaging industry and therefore the flexographic printing inks market across the globe.
Global flexographic printing inks market has been segmented into three categories: product, application, and region. Asia Pacific is expected to remain a highly attractive region for the flexographic printing inks market. Given that more than half the global population and emerging markets are in the region, international players have increased their focus on Asia Pacific.
Market for flexographic printing inks in North America and Europe are more mature when compared to Asia Pacific, Middle East & Africa, and Latin America.
Asia Pacific dominated the global flexographic printing inks market, accounting for more than 37.2% of the total market volume in 2016. The region is expected to offer significant potential for the flexographic printing inks market in the near future. Increased investments in China, India, and ASEAN are likely to boost the demand for them in the next few years. In Asia Pacific, several established players are estimated to enter into strategic alliances with local players to consolidate their market share. Various companies engaged in the printing inks business are focusing on ways to ease the availability of raw materials for the production of printing ink-based products.
Flexographic printing ink is a highly fragmented market with several manufacturers/ vendors/ suppliers. Some companies have a limited market presence in Middle East & Africa and Latin America. This offers them the prospect to establish research & development facilities in these regions in order to offer better solutions to customers. Furthermore, manufacturers could expand their distribution network with the addition of local distributors and sales offices. Exporting products to these regions could also provide ample growth opportunities for manufacturers based in North America and Europe.
Thus, companies in Middle East & Africa and Latin America, operating in the flexographic printing ink market need to focus on increasing their share among the existing end-users. Product improvement, growth in sales force, and competitive pricing are factors estimated to help them strengthen their position.
In Latin America, rise in ad spending, personalization, outdoor advertising, and packaging offers growth opportunities to the flexographic printing inks market. Digital transformation and office initiatives are predicted to remain at the forefront of business aspirations in the next few years in Middle East & Africa.
Transparency Market Research (TMR) is a global market intelligence company providing business information reports and services. The company’s exclusive blend of quantitative forecasting and trend analysis provides forward-looking insight for thousands of decision makers. TMR’s experienced team of analysts, researchers, and consultants use proprietary data sources and various tools and techniques to gather and analyze information.
TMR’s data repository is continuously updated and revised by a team of research experts so that it always reflects the latest trends and information. With extensive research and analysis capabilities, Transparency Market Research employs rigorous primary and secondary research techniques to develop distinctive data sets and research material for business reports. |
Q:
Search Wildcard('<', '>'), count it and get the position in java
I want to search Wildcard('<', '>') in a string, count them and get their positions in java. My string is like below
Peter <5554>, John <5556>,
which function should I use? Thank you.
A:
You should use Pattern and Matcher:
Pattern pattern = Pattern.compile("<[^>]*>");
Matcher matcher = pattern.matcher("Peter <5554>, John <5556>,");
while (matcher.find()) {
System.out.println("index="+matcher.start()+" - "+matcher.group());
}
Output:
index=6 - <5554>
index=19 - <5556>
|
Question-focused dataset
A question-focused dataset (QFD) is a subset of data that is derived from one or more parent data sources and substantively transformed in order to answer a specific analytic question or small set of questions. Since by definition a QFD is designed with a specific question in mind, it should perform much better at answering the question that the parent repository.
References
See also
Analytic induction
Case study
Content analysis
Critical theory
Sensemaking
Focus group
Grounded theory
Evidential reasoning approach
Quantitative research
Qualitative research
Sampling (case studies)
Category:Qualitative research |
/*
* Copyright 2004,2006 The Poderosa Project.
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
*
* $Id: TerminalUtil.cs,v 1.2 2011/10/27 23:21:58 kzmi Exp $
*/
using System;
using System.IO;
using System.Net;
using System.Net.Sockets;
using System.Text;
using System.Windows.Forms;
using Poderosa.ConnectionParam;
using Poderosa.Util;
namespace Poderosa.Terminal {
/// <summary>
///
/// </summary>
/// <exclude/>
public enum TerminalMode {
Normal,
Application
}
/// <summary>
///
/// </summary>
/// <exclude/>
public class TerminalUtil {
public static char[] NewLineChars(NewLine nl) {
switch (nl) {
case NewLine.CR:
return new char[1] { '\r' };
case NewLine.LF:
return new char[1] { '\n' };
case NewLine.CRLF:
return new char[2] { '\r', '\n' };
default:
throw new ArgumentException("Unknown NewLine " + nl);
}
}
//TODO staticにしたほうがいい？ うっかり破壊が怖いが
public static byte[] NewLineBytes(NewLine nl) {
switch (nl) {
case NewLine.CR:
return new byte[1] { (byte)'\r' };
case NewLine.LF:
return new byte[1] { (byte)'\n' };
case NewLine.CRLF:
return new byte[2] { (byte)'\r', (byte)'\n' };
default:
throw new ArgumentException("Unknown NewLine " + nl);
}
}
public static NewLine NextNewLineOption(NewLine nl) {
switch (nl) {
case NewLine.CR:
return NewLine.LF;
case NewLine.LF:
return NewLine.CRLF;
case NewLine.CRLF:
return NewLine.CR;
default:
throw new ArgumentException("Unknown NewLine " + nl);
}
}
//有効なボーレートのリスト
public static string[] BaudRates {
get {
return new string[] {
"110", "300", "600", "1200", "2400", "4800",
"9600", "14400", "19200", "38400", "57600", "115200"
};
}
}
//秘密鍵ファイル選択
public static string SelectPrivateKeyFileByDialog(Form parent) {
using (OpenFileDialog dlg = new OpenFileDialog()) {
dlg.CheckFileExists = true;
dlg.Multiselect = false;
dlg.Title = "Select Private Key File";
dlg.Filter = "Key Files(*.bin;*)|*.bin;*";
if (dlg.ShowDialog(parent) == DialogResult.OK) {
return dlg.FileName;
}
return null;
}
}
}
//これと同等の処理はToAscii APIを使ってもできるが、ちょっとやりづらいので逆引きマップをstaticに持っておく
internal class KeyboardInfo {
public static char[] _defaultGroup;
public static char[] _shiftGroup;
public static void Init() {
_defaultGroup = new char[256];
_shiftGroup = new char[256];
for (int i = 32; i < 128; i++) {
short v = Win32.VkKeyScan((char)i);
bool shift = (v & 0x0100) != 0;
short body = (short)(v & 0x00FF);
if (shift)
_shiftGroup[body] = (char)i;
else
_defaultGroup[body] = (char)i;
}
}
public static char Scan(Keys body, bool shift) {
if (_defaultGroup == null)
Init();
//制御文字のうち単品のキーで送信できるもの
if (body == Keys.Escape)
return (char)0x1B;
else if (body == Keys.Tab)
return (char)0x09;
else if (body == Keys.Back)
return (char)0x08;
else if (body == Keys.Delete)
return (char)0x7F;
if (shift)
return _shiftGroup[(int)body];
else
return _defaultGroup[(int)body];
}
}
}
|
Introduction {#sec1}
============
Worldwide potato production is hindered by a complex of insect pests. In Quebec, Canada, the Colorado potato beetle, *Leptinotarsa decemlineata* (Say) (Coleoptera: Chrysomelidae), the green peach aphid, *Myzus persicae* (Sulzer) (Hemiptera: Aphididae), and the potato aphid, *Macrosiphum euphorbiae* (Thomas), constitute the major pests in potato fields ([@bibr56]). While *L. decemlineata* adults and larvae are voracious defoliators of potato leaves, *M. persicae* and *M. euphorbiae* are important vectors of the two most damaging potato viruses (i.e. the potato leaf roll virus and the potato virus Y) ([@bibr06]; [@bibr08]). Pests which are normally of secondary importance such as the potato flea beetle, *Epitrix cucumeris* (Harris) (Coleoptera: Chrysomelidae), the potato leafhopper, *Empoasca fabae* (Harris) (Hemiptera: Cicadellidae), and the Buckthorn aphid, *Aphis nasturtii* (Hemiptera: Aphididae) may also occasionally cause serious damages and yield loss ([@bibr59]; [@bibr56]; [@bibr33]).
Development of insecticide resistance ([@bibr07]; [@bibr70]) and public awareness of possible health problems associated with pesticides ([@bibr62]) increased the interest for the development of alternative and sustainable control strategies for potato pests. One strategy that has received much attention is the development of insect-resistant potato cultivars ([@bibr16]; [@bibr56]). In addition to the development of genetically modified plants, researchers have focused mainly on hybridization programs between commercially cultivated potato cultivars and related wild *Solanum* species resistant to several potato pests ([@bibr16]) and diseases ([@bibr10]).
Laboratory and field experiments have identified many *Solanum* accessions as resistant to either one or a few potato pests ([@bibr16]; [@bibr38]). Resistance mechanisms have been classified as either antibiosis (changes in insect biology and demographic parameters) or antixenosis (changes in insect behavior leading to low or non acceptance of the host plant) ([@bibr39]). In *Solanum* spp., antibiosis relies mainly on glycoalkaloids present in leaves ([@bibr67]; [@bibr24]; [@bibr27], [@bibr28]; [@bibr37]; [@bibr40]). For example, some species such as *Solanum pinnatisectum* Dunal (Solanales: Solanaceae) and *S. polyadenium* Greenmam have a high level of α-tomatine ([@bibr24]; [@bibr65]; [@bibr13]), which is known to hinder *L. decemlineata* growth ([@bibr36]) and lower *M. euphorbiae* reproductive rate ([@bibr27]). High levels of α-chaconine and α-solanine also have negative impacts on *M. persicae* adults, lowering feeding and fecundity, and increasing mortality ([@bibr17]). Antixenosis-based resistance may be conferred by glandular trichomes ([@bibr21], [@bibr22]; [@bibr68]; [@bibr69]; [@bibr45]; [@bibr57]; [@bibr71]; [@bibr01]; [@bibr54]). Glandular trichomes are known to alter the ability of many herbivores to colonize, forage, and survive on the plant. For example, glandular trichomes reduce the proportion of *L. decemlineata* larvae feeding on *S. polyadenium* and *S. berthaultii* leaves and increase larval mortality ([@bibr23]; [@bibr44]).
Pest resistant plants may also have a negative impact on the third trophic level ([@bibr51]; [@bibr47]). For example, glandular trichomes are known to hinder the foraging abilities of many insect predators ([@bibr02]; [@bibr15]; [@bibr06]; [@bibr48]; [@bibr42]; [@bibr19]; [@bibr64]) and parasitoids ([@bibr48]; [@bibr64]). Moreover, chemicals responsible for antibiosis may also affect predators ([@bibr51]; [@bibr18]) and parasitoids ([@bibr03]; [@bibr04], [@bibr05]).
On the other hand, certain plant characters conferring pest resistance are thought to have positive impacts on some natural enemies ([@bibr47]). For example, the ladybird beetle *Coleomegilla maculata* ([@bibr25], [@bibr26]) lays eggs preferentially on plant species bearing glandular trichomes, and oviposition of the aphidophagous midge *Aphidoletes aphidimyza* is positively correlated with *S. tuberosum* trichome density ([@bibr41]). Obrycki and Tauber ([@bibr49]) also observed positive relationship between ladybird eggs (unidentified species) and trichome abundance. For both ladybirds and *A. aphidimyza*, the preference for oviposition on trichome bearing plants may be associated with a lower predation risk of the most susceptible life stages on those plants ([@bibr41]; [@bibr25], [@bibr26]).
Studying the impact of *Solanum* spp. candidates on both pests and natural enemies is of importance for breeding programs, as natural enemies are known to contribute to aphid ([@bibr50]; [@bibr34]; [@bibr35]) and *L. decemlineata* ([@bibr30]; [@bibr09]; [@bibr35]) biocontrol. The exclusion of natural enemies from resistant plants could provide an enemy-free space to herbivores adapted to resistant plants ([@bibr19]).
Fields experiments are required in many different geographical areas since the expression of resistance characters may be lower in the field than in the laboratory ([@bibr68]; [@bibr48]) and vary with environmental conditions ([@bibr20]; [@bibr46]). As such, resistant plants may have a different impact in the field than in controlled conditions, both on pests and on their natural enemies ([@bibr48]). Only a few field studies have tested the impact of resistant *Solanum* accessions on natural enemies.
To address that question, two experiments were done in Southern Quebec field conditions. The first compared the capacity of the aphids *M. persicae* and *M. euphorbiae* to thrive on six caged *Solanum* accessions and on caged potato plants. The second sampled and compared potato pest and natural enemy occurrence on two *Solanum* accessions and on potato plants.
Materials and Methods {#sec2}
=====================
The experiments were performed from 2004 to 2007 on a commercial farm located at Saint-Paul d\'Abbotsford (45.4127° N, 72.8598° W), Quebec, Canada. No insecticides, fungicides, or herbicides were applied to the experimental field.
Plants were previously grown in a greenhouse located at the Horticulture Research and Development Center, Agriculture and Agri-Food Canada, Saint-Jean-sur-Richelieu, Qc, Canada. Wild *Solanum* species seeds were obtained from the USDA Potato Introduction Project (Sturgeon Bay, Wisconsin, U.S.A.). The seeds were sown in early April in 25 × 50 cm plastic containers. Three weeks later, 30 seedlings of each variety were transplanted into pots (15 cm diameter). Potato plants *S. tuberosum* cv. *Désirée* were grown from tubers.
Aphids (*M. persicae* and *M. euphorbiae*) were reared on *S. tuberosum* cv. *Désirée*. One rearing unit was located at the Horticulture Research and Development Center, and the other was located at the University of Quebec in Montreal.
Experiment 1 --- Impact of six wild *Solanum* accessions on *Myzus persicae* and *Macrosiphum euphorbiae* colony development {#sec2a}
----------------------------------------------------------------------------------------------------------------------------
The experiment was conducted in 2004 and 2005. The accessions used in 2004 were *S. pinnatisectum* PI 186553, *S. polyadenium* PI 230463, *S. tarijense* Hawkes PI 414150, *S. infundibuliforme* Philippi PI 458322, *S. oplocense* Hawkes PI 473368, and *S. stoloniferum stoloniferum* Schlechted and Bouché PI 201855. In 2005, only *S. pinnatisectum, S. polyadenium*, and *S. tarijense* were used due to time limitation. Both years, the commercially cultivated potato plant *Solanum tuberosum* cv. *Désirée* was used as a control.
Plantlets were transferred from the greenhouse to the field in early June both years, and were first placed in a shaded area to allow adaptation to field conditions. Three days later, nine plants of each accession and nine potato plants were transplanted in the field. Each plant species was transplanted in the field in three groups (a group consisted of 3 plantlets transplanted on a row). Both row spacing and planting distance on a row were set to 0.90 m. A muslin cage (Height: 1 m, Diameter: 0.60 m) was placed above each plant. The muslin at the base of each cage was buried in the soil at a depth of 20--30 cm and a lateral entry closed by a metal clip allowed access to the plant.
On 16 July 2004 and 13 July 2005 (i.e. four weeks after their transplantation in the field) each plant was infested with about 30 laboratory-reared apterous aphids (mixed instars). For each plant species, four plants were infested with *M. persicae*, and four plants were infested with *M. euphorbiae*. Infestation was done by placing 4 aphidinfested potato leaves on each plant.
Sampling started one week following aphid infestation. In 2004, all *Solanum* species were sampled weekly for four weeks. *Solanum pinnatisectum, S. polyadenium, S. tarijense*, and *S. tuberosum* cv. *Désirée* were sampled further for two weeks for a total of six weeks. In 2005, all plants were sampled weekly for six consecutive weeks. At each sampling date, the numbers of apterous and alate aphids were counted separately. All other insects found on the plants were removed.
Experiment 2 --- Impact of two wild *Solanum* accessions on aphids, *Leptinotarsa decemlineata, Epitrix cucumeris, Empoasca fabae*, and natural enemies {#sec2b}
-------------------------------------------------------------------------------------------------------------------------------------------------------
Experiment 2 was performed in 2007. It aimed at evaluating the natural occurrence of potato pests and natural enemies on *S. tarijense* PI 414150, *S. polyadenium* PI 230463, and *S. tuberosum* cv. *Désirée* in Southern Quebec field conditions. The accessions used were the same as in experiment 1.
Plantlets were transferred from the greenhouse to the field on 18 June 2007 and planted on 20 June 2007. The three accessions were planted in nine monospecific patches (three patches by plant species) laid out in a latin square. Each patch consisted of 7 × 7 plants. The distance between each patch was 1.80 m. The distance between plants corresponded to a typical plantation layout in southern Quebec, i.e. 0.30 m between plants on a row and 0.90 m between rows. Weeds were manually removed once or twice a week.
***Leptinotarsa decemlineata* survey.** On 29 June, 3 July, 6 July, 10 July, and 11 July 2007 all plants were inspected and all observed *L. decemlineata* eggs, larvae, and adults were removed. Eggs and adults were counted.
**Destructive sampling.** On 27 July 2007, 15 plants per patch were cut, individually enclosed in plastic bags, brought to the laboratory, and put in a freezer until inspection. Plants were carefully inspected and every insect collected was put in 70% alcohol for future identification. Specimens were identified in the laboratory using a dissecting microscope and a field guide.
Statistical analysis {#sec2c}
--------------------
Data was analyzed using the statistical software JMP ([@bibr63]). Experiment 1: Data were rank-transformed and a MANOVA for repeated measures was applied followed by contrast analysis (between each pairs). In 2004 the analysis was done for four weeks in order to allow comparisons between the seven accessions tested, and then for six weeks for comparisons between *S. tuberosum* cv. *Désirée, S. pinnatisectum, S. polyadenium*, and *S. tarijense*. In 2005, the analysis was done for six weeks. Plants with missing data were excluded from the analysis (therefore, 1--4 plants/accession were compared for each analysis).
Experiment 2: For the *L. decemlineata* survey, the numbers of egg clutches and adults per row were compared (rows were used as experimental units). For the destructive sampling the numbers of individuals per plant were compared (individual plants were used as experimental units). This statistical methodology was used since the number of patches by accession was low (3 by accessions). Data were compared between accessions using Kruskal-Wallis tests and Tukey-type posthoc tests for non parametric data ([@bibr72]).
Results {#sec3}
=======
Experiment 1 --- Impact of wild *Solanum* accessions on *Myzus persicae* and *Macrosiphum euphorbiae* colony development *Macrosiphum euphorbiae*. {#sec3a}
--------------------------------------------------------------------------------------------------------------------------------------------------
In 2004, considering only the first four weeks, *M. euphorbiae* densities differed between the seven *Solanum* species ([Figure 1a](#f01){ref-type="fig"}: F = 4.46; d.f. = 6, 18; P \< 0.0001). *Solanum polyadenium* hosted the lowest *M. euphorbiae* density. Considering the whole experimental period, *M. euphorbiae* densities were significantly different between the four species present during the six sampling weeks ([Figure 1b](#f01){ref-type="fig"}: F = 8.52; d.f. = 3, 8; P = 0.0003). Again, *S. polyadenium* had the lowest *M. euphorbiae* density.
In 2005, *M. euphorbiae* densities were significantly different between the four species ([Figure 1c](#f01){ref-type="fig"}: F = 1.78; d.f. = 3, 12; P = 0.0053). *Solanum pinnatisectum* hosted significantly more aphids than *S. tuberosum* cv. *Désirée, S. tarijense*, and *S. polyadenium*, which were not significantly different from each other. Peak *M. euphorbiae* densities were much lower in 2005 than in 2004.
{#f01}
***Myzus persicae*.** In 2004, considering only the first four weeks, there was a significant difference in the number of *M. persicae* between the seven *Solanum* species considered ([Figure 2a](#f02){ref-type="fig"}: F = 10.23; d.f. = 6, 20; P \< 0.0001). *Solanum polyadenium* had the lowest density, while *S. tuberosum* cv. *Désirée, S. pinnatisectum, S. oplocense*, and *S. infundibuliforme* had the highest densities. *Solanum stoloniferum* and *S. tarijense* hosted intermediate aphid densities. For the whole experimental period, *M. persicae* densities were significantly different between the four species present during the six sampling weeks ([Figure 2b](#f02){ref-type="fig"}: F = 16.52; d.f. = 3, 7; P = 0.0001). *Solanum polyadenium* had the lowest density, while *S. tuberosum* cv. *Désirée* and *S. pinnatisectum* had the highest. *Solanum tarijense* hosted intermediate *M. euphorbiae* density.
{#f02}
In 2005, *M. persicae* densities were significantly different between the four species ([Figure 2c](#f02){ref-type="fig"}: F = 4.59; d.f. = 3, 12; P \< 0.0001). *Solanum polyadenium* and *S. tarijense* had the lowest densities, while *S. pinnatisectum* hosted the highest density. Peak *M. persicae* densities were much lower in 2005 than in 2004.
Except for the *M. euphorbiae* analysis of 2005 and for the six week analysis of *M. euphorbiae* in 2004 (P \> 0.05), Wilk\'s Lamda test indicated P \< 0.05 for "accession by time interaction". However, Roy\'s Max Root test indicated P \< 0.05 for all analysis.
**Experiment 2 --- Impact of two wild *Solanum* accessions on aphids, *Leptinotarsa decemlineata, Epitrix cucumeris, Empoasca fabae*, and natural enemies *Leptinotarsa decemlineata* survey.** On most sampling dates, more egg clutches and adults were collected on *S. tuberosum* cv. *Désirée* than on *S. poyadenium* and *S. tarijense* ([Table 1](#t01){ref-type="table"}). There were no significant differences between *S. polyadenium* and *S. tarijense* regarding egg clutch and adult densities.
######
Mean (± SE) numbers of *Leptinotarsa decemlineata* egg clutches and adults per row per patch (i.e. 7 plants) on *Solanum tuberosum* cv. *Désirée*, *S. polyadenium*, and *S. tarijense* collected on 6 different dates in 2007.
**Destructive sampling.** Results of the destructive sampling are presented in [Table 2](#t02){ref-type="table"}. Although only a few *E. cucumeris* adults were observed, all were found on *S. tuberosum* cv. *Désirée* (Kruskal-Wallis: χ^2^ = 33.41, d.f. = 2, P \< 0.0001). The low number of individuals collected (19) suggest however that this result should be interpreted cautiously.
A total of 156 leafhoppers (both nymphs and adults) were collected, and 155 of those leafhoppers were collected on *S. tuberosum* cv. *Desirée*, while only 1 occurred on *S. polyadenium* (Kruskal-Wallis: χ^2^ = 68.88, d.f. = 2, P \< 0.0001). No leafhoppers were found on *S. tarijense*. Most leafhoppers were identified as *E. fabae* (94.2%), the remaining being too damaged to be formally identified.
During the destructive sampling, the distribution of the 1656 recovered *L. decemlineata* eggs significantly differed with 99.2% sampled on *S. tuberosum* cv. *Désirée*, 0.8% on *S. polyadenium*, and none on *S. tarijense* (Kruskal-Wallis: χ^2^ = 35.28, d.f. = 2, P \< 0.0001). Similar results were obtained for *L. decemlineata* 1^st^ instars (228 individuals, 97.4% on *S. tuberosum*, 2.6% on *S. polyadenium*) and second instars (233 individuals, 99.1% on *S. tuberosum*, 0.4% on *S. tarijense*, and 0.4% on *S. polyadenium*) (Kruskal-Wallis: χ^2^~L1~ = 27.21, d.f. = 2, P \< 0.0001; χ^2^~L2~ = 27.03, d.f. = 2, P \< 0.0001). The higher proportion of third instar larvae on *S. tuberosum* cv. *Désirée* was not as pronounced than for the first and second instar larvae (28 individuals, 89.3% on *S. tuberosum* and 10.7% on *S. polyadenium*), and even though there was a global significant difference (Kruskal-Wallis: χ^2^ = 13.79, d.f. = 2, P = 0.0010), posthoc tests found no significant difference between *Solanum* species. The fourth instar larvae distribution did not differ between the three *Solanum* species: out of the 11 individuals collected 72.7% were from *S. tuberosum* cv. *Désirée* and 27.3% from *S. polyadenium* (Kruskal-Wallis: χ^2^ = 4.14, d.f. = 2, P = 0.1263). The lower number of third and fourth instar larvae collected is probably the results of the *L. decemlineata* survey that ended only 16 days before the destructive sampling. During that sampling, all *L. decemlineata* eggs observed were removed and thus *L. decemlineata* population had only 16 days to build up again before the destructive sampling.
Aphids were sampled on 63 plants (21 plants by plant species). A total of 230 apterous aphids, all species confounded, were observed; 41.7% on *S. tuberosum* cv. *Désirée*, 41.7% on *S. polyadenium*, and 16.5% on *S. tarijense. Solanum tarijense* had significantly less apterous aphids than the two other species (Kruskal-Wallis: χ^2^ = 7.12, d.f. = 2, P = 0.0285). Most apterous aphids were too damaged (possibly because of either frost or alcohol) to be identified (68.3%).
######
Mean abundance of potato pests on *Solanum tuberosum* cv. Désirée, *S. polyadenium*, and *S. tarijense*.
Natural enemy densities were very low in this study. A total of 74 spiders, 11 predaceous hemipteran nymphs, 3 predaceous hemipteran adults, and 1 coccinellid larva were collected from all three *Solanum* species.
Discussion {#sec4}
==========
Keeping aphids at low densities on potato plants is of primary importance as Mowry ([@bibr43]) demonstrated that damages caused to tubers by PLRV are linearly correlated to *M. persicae* densities. The two experiments performed in this study showed that *S. polyadenium* and *S. tarijense* were generally more resistant than *S. tuberosum* cv. *Désirée* to the two most important aphid species present in Quebec, i.e. *M. persicae* and *M. euphorbiae*. As suggested by laboratory experiments ([@bibr38], [@bibr39]), *S. stoloniferum* was also more resistant than *S. tuberosum* cv. *Désirée* to *M. persicae* in the field, but not to *M. euphorbiae*. On the other hand, *S. pinnatisectum* was found to be as susceptible to, or more susceptible than, *S. tuberosum* cv. *Désirée* to aphids. This contrast with Pelletier and Clark ([@bibr52]) that demonstrated, in laboratory conditions, that the same accession of *S. pinnatisectum* was resistant to *M. euphorbiae*. This difference is possibly due to the impact of the environment on some resistance factors ([@bibr68]; [@bibr48]; [@bibr20]; [@bibr46]) and highlights the importance of field experiments when evaluating pest resistance.
*Solanum tarijense* and *S. polyadenium* also had negative impacts on potato flea beetle and leafhopper populations. Apart from showing that *S. tarijense* is resistant to the flea beetle *E. cucumeris*, the results indicate that the observed resistance *of S. polyadenium* to *E. cucumeris*, and of *S. polyadenium* and *S. tarijense* to the leafhopper *E. fabae* ([@bibr66]; [@bibr68]; [@bibr16]; [@bibr56]) also occurs in Quebec field condition.
More importantly, Colorado potato beetle, *L. decemlineata*, laid significantly less eggs on both *S. tarijense* and *S. polyadenium* than on *S. tuberosum* cv. *Desirée*. Again, the resistance of many *Solanum* species to *L. decemlineata* has previously been reported in other geographic areas, notably in New Brunswick, Canada ([@bibr55]; [@bibr54]). Pelletier and Tai ([@bibr53]) reported that the resistance mechanism of *S. polyadenium* PI 230463 (the same accessions) was mainly antibiosis as *L. decemlineata* laid more eggs on this species than on *S. tarijense* and other species. However, we observed significantly more *L. decemlineata* egg clutches on *S. tuberosum* cv. *Désirée* than on *S. polyadenium*, suggesting an antixenosis-based resistance in the wild *S. polyadenium*. Both experiments were done in field conditions but in different geographic areas, so the difference observed could be due to different growing or field conditions inducing differences in resistance factors.
For both *S. tarijense* and *S. polyadenium*, the difference in pest density was mainly conferred by the plant resistance characteristics since natural enemies\' density was very low. This low density is not surprising as previous studies demonstrated that the density of most natural enemies in potato fields closely follows that of *M. persicae* and *M. euphorbiae* ([@bibr34]; [@bibr32]). The relative capacity of pests and natural enemies to adapt and become able to exploit resources on resistant plant should be evaluated: should the pest adapt more rapidly, resistant plant would become an enemy-free space plant on which pests could thrive ([@bibr19]). Particularly, *L. decemlineata* shows a strong adaptation capacity to locally abundant *Solanum* species ([@bibr31]).
This study therefore supports the use of *S. tarijense* and *S. polyadenium* as candidate plants for hybridization with *S. tuberosum* in Quebec field conditions. However, further field experiments are still required to evaluate resistance in years of severe infestations of aphids or other pest species. Recently established in North America, *Aphis glycines* (Matsumura) has been reported to transmit potyvirus Y to potato plants ([@bibr11], [@bibr12]). Future breeding programs should then evaluate resistance against this aphid species. Moreover, resistance factors to the most damaging bacteria, virus, and root-nod nematodes, as well as traits linked to vigour, have to be researched ([@bibr29]). Finally, the impact of pests on yields should be studied as some resistant hybrids suffer more yield losses, even though pest densities are higher on susceptible varieties ([@bibr14]).
In conclusion, these field experiments demonstrated the importance of *S. polyadenium* PI 230463 and & *tarijense* PI 414150 for breeding programs aiming at developing new pest resistant potato varieties. It also demonstrated the importance of field experiments in different geographic areas as resistance mechanisms may differ between field and laboratory conditions, and between geographic area.
We would like to thank Guy Boulet, Thibaud Gérard, Pierre Lemoyne, Alice Sander, Jenny Therriault, and Martin Trudeau for technical assistance. We are also grateful to Michel Auger for access to his farm and Jacques Lasnier (Co-Lab R & D, Granby, Qc, Canada) for help in logistics. Accessions seeds were furnished by Max W. Martin from the USDA Potato Introduction Project (Sturgeon Bay, Wisconsin, U.S.A.). This project was a partnership co-financed by Agriculture and Agri-Food Canada Mil-program between Cavendish Farms, Comité Nord Plants de Pomme de Terre (France), and Université de Picardie Jules Verne (Amiens, France).
[^1]: **Associate Editor:** TX Liu was editor of this paper.
|
Dolebury Warren
Dolebury Warren (also known as Dolebury Camp) is a biological Site of Special Scientific Interest (SSSI) and ancient monument near the villages of Churchill and Rowberrow in North Somerset, part of South West England. It is owned by the National Trust, who acquired the freehold in 1983, and managed by the Avon Wildlife Trust.
Standing on a limestone ridge on the northern edge of the Mendip Hills, it was made into a hill fort during the Iron Age and was occupied into the Roman period. The extensive fort covers with single or double defensive ramparts around it. The name Dolebury Warren comes from its use during the medieval or post medieval periods as a rabbit warren. The topography and differing soil types provide a habitat for an unusually wide range of plants, attracting a variety of insects, including several species of butterfly.
Geology and location
The site is at the top of a Carboniferous Limestone ridge on the northern edge of the Mendip Hills. It forms part of the Black Down Pericline where the limestone has been exposed because of erosion of the overlying Triassic dolomitic conglomerate. The soil depth varies considerably, owing to the slope within the site and the effects of its exposure to the wind.
Dolebury Warren overlooks the villages of Churchill and Rowberrow and provides good visibility across the surrounding lower lying areas as far as the Bristol Channel. The highest point, at the eastern end of the site is OD, with the hillfort being up to below this. It is the starting point for the Limestone Link, a long-distance footpath which ends at Cold Ashton in Gloucestershire.
Description
The fort covers an area of and commands views over the surrounding countryside. The hill fort is bivallate on three sides and a single rampart on the southern side which is protected by a steep slope. It is almost rectangular with the longest axis from east to west being long and from north to south, surrounded by a rampart which is around high and wide. It was protected by a limestone rampart with a ditch and counterscarp on all sides but the south. There is an inturned entrance on the west and an annexe of protecting the easier eastern approach.
History
Etymology
The name Dolebury means the idol hill from the Old English dwol and beorg.
Early
Various artefacts have been uncovered representing the long period of occupation of the site at Dolebury Warren. These include flintwork from the Palaeolithic, bronze spearheads, Bronze Age pottery, and Roman pottery and coins. There is evidence of occupation of the site during the Iron Age. The defences and Celtic field systems there date back to the 7th century−3rd century BCE, though they might mask earlier developments. The hillfort was occupied until approximately 100BC, though it is possible that it was reoccupied in the Roman and post-Roman periods. The archeological consultant Peter Leach has suggested there may even have been a Roman Temple built within the hillfort, while aerial photographs suggest the probable remains of an Iron Age or Roman coaxial field system. Local historian Robin Atthill also suggests that Dolebury may have re-emerged as an important centre of population in the 5th century.
Medieval
In the medieval or post-medieval period, the remains of the hillfort were used as a rabbit warren which was used to breed rabbits, providing valuable meat and fur. Many warrens were surrounded by banks or walls to prevent the rabbits from escaping; escaped rabbits caused damage to nearby farmland and meant a loss in profit. The warren at Dolebury is completely enclosed by the substantial ramparts of the Iron Age hill fort and thus provided an ideal location to breed rabbits. The presence of pillow mounds and vermin traps demonstrate man's management of the site for husbandry. Ridge and furrow agriculture has also been identified, from aerial photographs, within the fort. Some of these structures, along with earlier Iron Age features, have been damaged by subsequent quarrying which may have been for lead, ochre or calamine. The site was described by John Leland in the 16th century. A three-storey building, believed to be the warrener's house and possibly a watch tower, surrounded by a garden, was in ruins by 1830.
19th and 20th centuries
The site was visited in the early 19th century by John Skinner and surveyed in 1872 by Charles William Dymond. In 1906 the Mendip Lodge Estate, which included Dolebury Warren, was sold. It was first scheduled as an ancient monument in 1929. In 1935 Dolebury Camp was bought by Miss V. Wills of the W.D. & H.O. Wills tobacco company to prevent development. Dolebury Warren was notified as a Site of Special Scientific Interest in 1952. The freehold of was acquired by the National Trust in 1983 from A. G. Gosling, D. F. Gosling and J. M. Kent, and is managed by the Avon Wildlife Trust.
Ecology
The site of the fort and warren is now grassy slopes which attract a wide range of wild flowers and butterflies. The differing soil types provide suitable habitats for both acid- and lime-loving plants. Kidney vetch (Anthyllis vulneraria), harebell (Campanula rotundifolia) and woolly thistle (Cirsium eriophorum) thrive on the dry stony soils. Heath bedstraw (Galium saxatile) and wood sage (Teucrium scorodonia) are found in more acidic areas. The higher areas support bell heather (Erica cinerea), western gorse (Ulex gallii) and common heather (Calluna vulgaris). Trees and shrubs include the wayfaring tree (Viburnum lantana), guelder rose (Viburnum opulus), whitebeam (Sorbus aria), privet (Ligustrum vulgare) and dogwood (Cornus sanguinea).
Scarce plants found at the warren include knotted pearlwort (Sagina nodosa), and slender bedstraw (Galium pumilum). Butterflies recorded here include the small blue (Cupido minimus), marbled white (Melanargia galathea), dingy skipper (Erynnis tages), grizzled skipper (Pyrgus malvae), small pearl-bordered fritillary (Boloria selene), and wall brown (Lasiommata megera).
See also
List of hill forts and ancient settlements in Somerset
References
Bibliography
Category:Hill forts in Somerset
Category:History of Somerset
Category:Mendip Hills
Category:Sites of Special Scientific Interest in North Somerset
Category:Sites of Special Scientific Interest notified in 1952
Category:Nature reserves in Somerset
Category:National Trust properties in Somerset
Category:Former populated places in Somerset
Category:Scheduled Ancient Monuments in North Somerset |
Tag Archives: Air Force
August 24, 2016Financial Report, NewsComments Off on August 24 Market Close: GovCon Index Down on McKesson Decline as Health Losses Weigh on US Markets
Executive Mosaic’s GovCon Index traded lower Wednesday with McKesson Corp. (NYSE: MCK) the worst net performer at more than double the decline of second-lowest Lockheed Martin (NYSE: LMT) as losses in healthcare shares dragged U.S. stocks into negative territory. General Dynamics was the only GovCon Index-S&P 500 company to record a gain, while McKesson was …
August 22, 2016Contract Awards, NewsComments Off on Lockheed Secures Potential $10B IDIQ for Air Force C-130J Production Support
The U.S. Air Force has awarded Lockheed Martin (NYSE: LMT) a potential 10-year, $10.02 billion indefinite-delivery/indefinite-quantity contract to support the military branch’s C-130J Super Hercules production effort. The sole-source contract also includes foreign military sales, the Defense Department said Friday. DoD expects Lockheed’s aeronautics segment in Marietta, Georgia to finish contract work Aug. 18, …
August 15 – August 19 2016 Click here to see Real-Time GovCon Sector Quotes A Note From Our President & Founder Jim Garrettson The long-awaited, much-anticipated and well-documented merger of Leidos into the now former Lockheed Martin information technology and technical services business completed on Tuesday. As if GovCon observers needed reminding, Leidos doubles to $10 …
August 19, 2016Contract Awards, NewsComments Off on 5 Firms Win Spots on $78M Air Force Weapon, C4I Systems Support IDIQ
The U.S. Air Force has awarded five companies positions on a potential three-year, $78.4 million contract to provide information technology support for the military branch’s weapons and command, control, communications, computers and intelligence systems. The Defense Department said Thursday the indefinite-delivery/indefinite-quantity contract also covers project management, intelligence, security, staff support, system engineering and subject matter …
August 15, 2016Financial Report, NewsComments Off on August 15 Market Close: GovCon Index Hits Record Close Again as Defense Primes Rise
Executive Mosaic’s GovCon Index closed at another all-time high Monday with 28 out of 30 companies including all 11 S&P 500-listed stocks in green and middle- to large-tier defense contractors as the session’s top advancers. L-3 Communications (NYSE: LLL) led all net gainers after the military technology maker was selected by Drexel Hamilton …
United Technologies Corp.‘s (NYSE: UTX) Pratt & Whitney subsidiary has received a three-year, $151.7 contract modification from the U.S. Navy to provide a range of F-35 Lightning II aircraft supplies and services. The Defense Department said Wednesday the modification covers initial spare modules, engine system trainers, support equipment and depot activation services and supplies …
August 9, 2016Contract Awards, NewsComments Off on Space News: Air Force to Award Contract to ULA for Delta 4 Rockets
The U.S. Air Force plans to award a sole-source contract to United Launch Alliance for two Delta 4 rockets to launch National Reconnaissance Office, Space News reported Monday. Mike Gruss writes the NRO missions covered under the contract are scheduled to launch in 2020 and 2023. The Air Force opted for a sole-source contract …
August 5, 2016News, Weekly Round-upComments Off on Weekly Roundup August 1 – August 5 2016: Leidos Further Details Post-Merger Picture & more
August 1 – August 5 2016 Click here to see Real-Time GovCon Sector Quotes A Note From Our President & Founder Jim Garrettson Government contracting’s M&A and financial aspects took center stage again this week and GovCon Wire hit on all the major events as Executive Mosaic’s home of market-moving news for the sector. …
August 5, 2016Contract Awards, NewsComments Off on Johnson & Johnson to Supply Dental, Medical Equipment to US Armed Forces
The Defense Logistics Agency has awarded Johnson & Johnson (NYSE: JNJ) a five-year, $60 million contract to supply medical and dental equipment to all four military service branches. Johnson & Johnson’s healthcare systems sector will deliver the products to the U.S. Army, Navy, Air Force and Marine Corps through Aug. 3, 2021 under the indefinite-delivery/indefinite-quantity contract, the Defense Department …
August 1, 2016Press ReleasesComments Off on DynCorp to Provide Transient Aircraft, Base Operation Support Under AFCAP IV Task Orders
TYSONS CORNER, VA, Aug. 1, 2016 — DynCorp International has received three task orders from the U.S. Air Force to deliver transient aircraft support and base operation services under the Air Force Contract Augmentation Program IV contract, ExecutiveBiz said Friday. The company said Thursday it received a $29 million task order for personnel, …
Sponsor
Sponsor
Sponsor
Sponsor
Sponsor
Sponsor
Sponsor
Sponsor
Sponsor
Sponsor
Microsoft
Deltek Leader Board
About GovConWire
The premier source of breaking business news for the government contracting industry, GovCon Wire provides informative, to-the-point stories of the most significant contract awards, top-level executive moves, M&A activities and financial results of the sector’s most notable players.
GovCon Wire is always on top of the most recent contracting sector activity and is updated in real time as the news breaks. |
These days, the big issues of our time are digested and disseminated by cable news, internet blogs, and tweets—and repeated by everyday people in our common conversations. But the choices about how that digestion happens—about how big stories are packaged into little sound-bytes that people spread—are strategic decisions loaded with political power. Consider:
Along with our opposable thumbs, human beings are unique in our narrative nature. We are narrative animals who process our experiences through the lens of story, and pass on our stories through memes: symbols, rituals, songs, or images. Memes are self-replicating units of culture that morph over time and spread without attributing authorship—from rituals like putting candles on your birthday cake or tying a yellow ribbon around the oak tree to sound-bytes that shape the political debate, like “Too Big to Fail” or “Green Jobs.”
Effectively framing for change means intentionally setting the terms of
the debate, and shifting power and possibility in the story.
The creation of potent memes has been always been central to the work of shifting the dominant culture: whether its using symbols like the peace sign, teaching new practices like recycling, or packaging new ideas for a better world—like “living wage” or “fair trade.” As a meme spreads it often carries a specific framing. A frame is the overarching perspective or larger idea that shapes our interpretation. You can think of the frame as the edges of the television screen or the rims of the eyeglasses—it’s what defines what and who is in the story and what it all means. What is left out of the frame is as important as what is inside the frame. And most importantly for those of us working for justice and change, the frame defines who has power in the story.
Collective, cultural stories are embedded with powerful frames that define cultural norms and shape common perceptions of what’s possible. The mythologies and memes of Plymouth Rock, Manifest Destiny, 40 Acres and a Mule, and the American Dream are the narratives of the past—but they continue to haunt our political discourse today. When we are working to change the dominant stories about racism, immigration, war, and protecting the planet, these narratives are already in peoples’ minds, acting as filters to social change messages, and often limiting a collective sense of possibility.
Effectively framing for change means intentionally setting the terms of the debate, and shifting power and possibility in the story. Perhaps our framing amplifies the perspective of previously marginalized characters, reveals hidden impacts, or highlights a better alternative. As a new story is told, the meaning shifts and people draw different conclusions...
As the old advertising industry mantra says, “People can only go somewhere that they have already been in their minds.” The same is true for social change stories. Effective framing often foreshadows a specific future, subtly defining or redefining what is politically acceptable. The power holder’s side of the story often relies on the belief that change can’t happen, and the status quo is the only way. Former British Prime Minister Margaret Thatcher even coined an acronym to define this tactic: TINA—There Is No Alternative.
What better way to challenge this common myth then making the abundance of alternatives real and visible? Framing for change is often as simple as manifesting the changes we need: The residents’ occupation of the public housing office transforms it into a day care center… The abandoned city lot becomes a community garden… The site of the planned juvenile prison becomes a playground…
Framing for change is often as simple as manifesting the changes we need.
In the place of the failed narratives of U.S. empire, assimilation, and corporate monoculture, a multitude of new stories are taking root. Inspiring campaigns of resistance and transformation are underway in countless communities, and social movements are quite literally changing the stories that structure our lives, and thereby changing the story of our future. Around the world, there is a contest to frame the story—will the dominant narratives justify exploitation, destruction and conquest, or encourage ordinary people to take the side of the Earth, humanity and hope?
All of us have a part to play in these ongoing framing efforts. As we discuss the events of the day and spread our stories of positive change, it is up to all of us to chose our memes wisely, and to tell the story that reflects our values and frames the future we really want. Humanity’s greatest gift is our power to create images and frame ideas so let’s be smart about how use it…Psst, Pass it on!
Interested?
: As our society approaches major transitions ahead, we may welcome or
resist the changes … How we react will rest partly on how we frame
those changes. |
Is v even?
True
Suppose -10*l = -2*l - 10512. Does 9 divide l?
True
Is ((-15)/(-10))/((-12)/(-5624)) a multiple of 19?
True
Suppose -13*x + 8*x - 580 = 0. Let r = x + 267. Is 44 a factor of r?
False
Suppose 3*v + 5*a - 834 = 259, -5*v + 5*a = -1835. Suppose x + 110 = 2*x - 4*q, 0 = -3*x + 3*q + v. Does 14 divide x?
True
Let z = 206 + -114. Suppose -4*b = -0*b - z. Is b a multiple of 2?
False
Let n(u) = 3*u. Let m be n(-1). Suppose -4*v = 6*v - 16*v. Let z = v - m. Is z a multiple of 3?
True
Let d = 171 - 111. Does 3 divide d?
True
Let i = -10 - -11. Suppose c + 5 = -2*q + i, q - 4 = c. Suppose 2*r + r - 18 = q. Is 3 a factor of r?
True
Let t = -123 + 195. Does 17 divide t?
False
Suppose 69 = -2*q + 869. Is q a multiple of 10?
True
Let v(o) = o**3 + 15*o**2 - 4*o - 18. Suppose i - 3*i = 30. Is v(i) a multiple of 11?
False
Let k = 2 - -43. Let c = -9 + k. Does 4 divide (-6)/(-8) - (-333)/c?
False
Suppose -v - 4 = -11. Let a(g) = g**2 - 6*g + 17. Does 6 divide a(v)?
True
Suppose 3*u = -u - 5*b + 1283, b - 1303 = -4*u. Suppose 3*r - 229 = 2*i - 3*i, -4*r = -3*i - u. Is r a multiple of 24?
False
Suppose -133 = -4*q + r, 0*q + 5*r + 87 = 3*q. Let k = -16 - q. Let p = -20 - k. Is p a multiple of 10?
True
Suppose -1 - 7 = -4*v. Let d(t) = -t**3 + 3*t**2 - 3*t + 1. Let c be d(v). Let r(o) = -8*o**3. Is r(c) a multiple of 8?
True
Let h be ((-8)/(96/9))/((-3)/8). Suppose -f = h*f - 105. Is f a multiple of 17?
False
Suppose s = -1 - 12. Let b be 1/(3/(-1 - s)). Is 14 a factor of (-7 + b)*1 + 17?
True
Let o = 846 - 678. Is 5 a factor of o?
False
Suppose -2*y - 3*y + 15 = 0. Suppose 0 = 3*t - 29 - 7. Suppose 0 = -y*w + 18 + t. Does 10 divide w?
True
Is (-116)/1218 + (-11344)/(-42) a multiple of 11?
False
Let s(o) = o**3 - 3*o**2 - 3*o - 5. Let y be s(-3). Let j = 126 + y. Is 19 a factor of j?
True
Is 25 a factor of 7/1 + (0 - -813)?
False
Let m = 2595 - 1431. Does 4 divide m?
True
Suppose -5*s = -3*s - 6. Let a(v) = 24*v - 4. Let t(k) = -24*k + 3. Let m(j) = s*a(j) + 2*t(j). Does 18 divide m(3)?
False
Suppose 3*l + 5*x = -3, 3*x = -2*l + 2*x + 5. Let b = -47 - -67. Suppose -7 = p - y - 47, l*y - b = 0. Does 17 divide p?
False
Suppose 3*l - 15 = 8*l. Suppose -s = -4*f + 3, 3*f = 8*f + 4*s - 30. Does 2 divide -2*(f + l) - -3?
False
Let t = -114 - -72. Let p = 203 - 99. Let b = p + t. Is 22 a factor of b?
False
Let m be (-44)/(-10) + 6/(-15) - -3. Let b(k) = -k + 28. Is b(m) a multiple of 3?
True
Let j(y) = 46*y + 10. Let i(m) = m**2 + 6*m + 7. Let w be i(-5). Does 34 divide j(w)?
True
Suppose 82 = o + 5*r, 0 = 5*o - 7*o - 4*r + 158. Does 10 divide o?
False
Let r(i) = -33*i + 12. Is 52 a factor of r(-29)?
False
Suppose -15 = -5*a, 40 = 2*t - 5*a + 9. Let d = t + -20. Suppose 83 = d*b - 205. Is 24 a factor of b?
True
Suppose 3164 = -v + 29*v. Is v a multiple of 22?
False
Let a = -3 + 10. Let n(g) = g**2 - 2*g + 1. Let b be n(a). Let x = b + -22. Does 11 divide x?
False
Let o(y) = y**3 - 10*y**2 + 10*y - 5. Let v be o(9). Let u be v/(12/(-27)*-3). Suppose 480 = -u*s + 8*s. Is 16 a factor of s?
True
Suppose 2145 = -17*u + 5545. Is u a multiple of 40?
True
Let c(o) = 2*o**2 - 10*o. Suppose 3*l - a = 23, -2*l + 13 = l + a. Let b be c(l). Let g(d) = -d**3 + 13*d**2 - 10*d + 3. Is 4 a factor of g(b)?
False
Let m(c) = -37 - c**2 - 41 + 24 - 1 + c. Let v be m(0). Let j = -29 - v. Is 26 a factor of j?
True
Suppose 551 = 4*x - 893. Suppose 3*c = 2*w + 218, 0*c + w + x = 5*c. Does 18 divide c?
True
Suppose 0*b = -7*b + 994. Suppose -6*l + l + 3*r + 285 = 0, -b = -3*l - 4*r. Is l a multiple of 18?
True
Let v(j) = j - 12. Let m be v(12). Suppose m = -r - 2*r + 3*n + 174, -r - 5*n = -52. Suppose 4*p - r = p. Does 13 divide p?
False
Let o(j) = -2*j + 4. Let g(s) = s**2 + 6*s - 13. Let n(a) = 4*g(a) + 11*o(a). Let d be n(-4). Suppose -v = v - d. Does 9 divide v?
False
Let a = -1 + 6. Suppose -2*g + 760 = 3*g + a*l, 0 = -2*g - l + 306. Suppose 5*s = -4*i + 3*s + g, 185 = 5*i + s. Is i a multiple of 30?
False
Suppose 3*d - 5*p - 527 = 0, 4*d - 3*d - 174 = 2*p. Suppose -5*f = -5*n - 30, -f - 42 = 4*n - 28. Suppose b - 91 = -5*c + d, 110 = f*c + b. Does 16 divide c?
False
Let o(r) = r**2 - 6*r - 2. Let f be 9 + 3*(-8)/12. Let k be o(f). Suppose -105 = -10*i + k*i. Does 4 divide i?
False
Let f = 57 - 40. Suppose 0 = 14*w - f*w + 30. Suppose 7*k - w*k = -114. Is k a multiple of 16?
False
Let o(c) = 7*c + 9. Let p(q) = q + 4*q - 11*q - 10 - 2*q. Let t(i) = 3*o(i) + 4*p(i). Is t(-4) a multiple of 31?
True
Let f(m) be the third derivative of m**6/120 + m**5/5 - 5*m**4/6 - 25*m**3/6 + 6*m**2. Is 12 a factor of f(-13)?
False
Let f(t) = -6*t - 6. Let b be f(-4). Let r(k) = -k**3 + 19*k**2 - 18*k + 24. Let i be r(b). Does 3 divide ((-60)/i)/(1/(-2))?
False
Suppose -3*s = -2*s - 3*c - 80, 0 = -s - 4*c + 80. Suppose -f - f = -12. Suppose -2*q - 5*k = -s, -180 = -4*q - f*k + k. Does 17 divide q?
False
Let u(t) = -t**2 - 24*t - 11. Suppose 72 = k + 89. Does 27 divide u(k)?
True
Suppose -3540 = -22*g - 878. Does 14 divide g?
False
Is 11 a factor of ((-96)/(-80))/(9/2850)?
False
Let v(u) be the third derivative of u**4/2 - u**2. Let q be 1/(-1 - -2 - 0). Is v(q) a multiple of 6?
True
Suppose -5*v = -4*m + 3*m, 10 = -5*v. Let u(a) = -a**2 - 13*a + 6. Is u(m) a multiple of 12?
True
Let o = -23 + 42. Let y = 4 + -15. Let v = y + o. Does 8 divide v?
True
Let x(a) = 3*a - 2. Suppose -4*u = -5*t + 18, t = 4*u + 4*t + 2. Let c be (-1)/(u/8) + 2. Does 9 divide x(c)?
False
Let q = -71 - -181. Let l = 167 - q. Is l a multiple of 18?
False
Suppose r - 6 = -3*q + 2, 0 = 4*q - 4*r - 16. Suppose 4*l = q*o - 173, 0*l + o - 208 = 5*l. Let j = l - -101. Is j a multiple of 16?
False
Is 12 a factor of 27/((-6)/(-24*1))?
True
Suppose 15*i - 9*i = 12. Let k(g) = 10*g**2 + 3*g + 1. Let p be k(-3). Suppose 2*z + 2*z = -i*h + p, -h - z = -41. Is 17 a factor of h?
False
Let m be (-4)/(-6)*(0 - -6). Let g = 9 - m. Suppose 0*k - g*k + 90 = 0. Is k a multiple of 14?
False
Suppose -36*o = -32*o - 24. Let p = 104 - 29. Suppose p = -w + o*w. Does 5 divide w?
True
Let v be (-85)/(-4) + 9/12. Let z be v + 4/8*4. Let k = z + -11. Does 13 divide k?
True
Let b(v) be the third derivative of v**6/120 - 11*v**5/60 + 7*v**4/24 + v**3/3 - 3*v**2. Let u be b(11). Does 10 divide 2/10 + u/5?
False
Let a(y) = -115*y + 30. Is a(-6) a multiple of 18?
True
Let k(w) = -4*w**3 + 9*w + 0 + 10*w**2 - 9 + 5*w**3. Suppose 4*c + 18 = 2*c + 4*y, -2*c - 5*y - 9 = 0. Is 25 a factor of k(c)?
True
Is (-84)/(-63)*14/4*93 a multiple of 10?
False
Let u(x) = -x**3 - 8*x**2 - 15*x - 9. Is 30 a factor of u(-8)?
False
Suppose -3*p - f = f - 60, -5*f - 39 = -3*p. Let u = p + -8. Is u a multiple of 5?
True
Suppose -14509 = -25*n + 37091. Is 48 a factor of n?
True
Let g(c) = c**2 - 8*c - 11. Let u be g(9). Is u + -7 + 6 - (-1 + -10) a multiple of 3?
False
Suppose -10*w = -9*w + h - 1460, 3*w = 2*h + 4400. Does 22 divide w?
False
Let j be (-3)/(9/6*-1). Suppose j*v = 8*v - 384. Does 15 divide v?
False
Is (-51 + 16)*51/(-15) a multiple of 7?
True
Let v = -38 + 28. Let p(t) = t**2 + 11*t + 15. Let l be p(v). Is 3 a factor of -3 + 15/l*5?
True
Let w(u) be the third derivative of 11*u**6/30 + u**5/60 - u**4/8 + u**3/2 + 3*u**2. Is 9 a factor of w(1)?
True
Let j(v) = -587*v - 10. Let a be j(-14). Is a/52 - (-6)/39 a multiple of 21?
False
Let i(f) = -2*f**2 + 18*f + 6 + 3*f**2 - 20*f. Is 8 a factor of i(4)?
False
Let q = -6 - 49. Let b be ((-18)/(-2))/((-5)/q). Suppose 5*z = -o + 255, 0*z - o = 2*z - b. Is z a multiple of 13?
True
Let g(q) be the first derivative of q**5/60 - q**4/6 - 3*q**3/2 + 9*q**2/2 - 10. Let m(t) be the second derivative of g(t). Is 12 a factor of m(7)?
True
Let p be 6/57 + (-312)/76. Let g = 84 + p. Is 16 a factor of g?
True
Let d(j) = -j**3 + 9*j**2 - 16*j - 6. Let s be d(7). Is 1 + s/12 + 924/9 a multiple of 17?
True
Suppose -122 - 19 = -n. Is 47 a factor of n?
True
Let y = -226 - -1767. Is 41 a factor of y?
False
Suppose 33*u + 15 = 36*u. Suppose -48 - 137 = -u*x. Does 32 divide x?
False
Suppose 0 = 2*o - 126 + 28. Suppose 4*p - 104 = -4*m, -5*p + 214 = -2*m + o. Is p a multiple of 9?
False
Let d = -3218 + 5292. Does 61 divide d?
True
Let o(l) = -19*l - 7*l**2 - 5*l**2 + 3 + 10*l**2. Does 9 divide o(-8)?
True
Let y = 2825 + -1670. Suppose |
A new technique of upper eyelid blepharoplasty using the orbicularis muscle flap.
Blepharoplasty of the upper eyelids is one of the most commonly performed procedures in aesthetic plastic surgery. The orbicularis muscle flap technique provides good results for patients with atonic skin and an atonic orbicularis muscle when there is excessive fullness in the lateral aspect of the upper lid. This flap also can be used to contain a prominent lacrimal gland or retro-orbicularis oculi fat (ROOF) without dangerous removal of the last one. A total of 30 patients underwent upper lid blepharoplasty through a supratarsal incision approach. Dissection of the orbicularis muscle flap was made 5-8 mm above the supratarsal fold. Before the muscle flap suspension, the excess skin and fat pad were removed. The flap suspension was achieved with its rotation and motion of a tunnel in the suborbicularis plane, which anchored it on the periosteum of the orbital lateral rim of the frontal bone with a permanent suture. This technique restores the sharp and crisp tarsal folds and pretarsal show with deepening of the orbitopalpebral sulcus. The orbicularis muscle flap also can be proposed for cases with a ptosis of the lateral upper lid. The authors believe this technique reduces the risk for "rounding" of the eyelid and produces better contact of the lid with the ocular globe. The orbicularis muscle flap procedure is a feasible technique that can be used reliably to reshape the lateral upper lid. It would be a useful addition to the armamentarium of the plastic surgeon who is called on to perform upper blepharoplasty. |
Q:
What is a simple way of drawing sprites without OpenGL?
We are developing simple arcade game for android now and we are interested in adding some visual effects to it. Like disappearing or appearing animation and so on. Is there a simple way to do it without OpenGL for example just using some improvements to ImageView?
A:
You could use the BitmapFactory and Bitmap Class to perform simple manipulations on images. Check out the http://developer.android.com/reference/android/graphics/Bitmap.html for what you can do with this class. It supports simple stuff like reloading, fading out, creating ScaledMaps and manipulating images on the screen on basic level.
For some simple instructions and examples see:
http://developer.android.com/guide/topics/graphics/index.html
http://www.anddev.org/resize_and_rotate_image_-_example-t621.html
Chapter 6 in "Android Developers cookbook" : http://www.informit.com/store/product.aspx?isbn=0321741234
|
Q:
Inline UIPicker Implementation
I'm attempting to implement an inline UIPicker inside a table-view cell, similar to both this and this SO question. I believe I'm close in my implementation, but at the moment, no picker is displayed when I select the appropriate cell. Can anyone point me in the right direction in regards to what I'm doing wrong? Thank you!
Below is where I determine what rows occur in each section:
- (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath
{
switch (indexPath.section) {
case NotificationsSection:
return [self tableView:tableView cellForAreaOneRowAtIndexPath:indexPath];
break;
case RedZoneSection:
return [self tableView:tableView cellForAreaTwoRowAtIndexPath:indexPath];
break;
case TimeOfDaySection:
return [self tableView:tableView cellForAreaThreeRowAtIndexPath:indexPath];
break;
default:
return nil;
break;
}
}
Below is where I check the number of rows in each section. I suspect my problem may lie here, but I am not completely sure.
- (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section
{
switch (section) {
case AreaOneSection:
return AreaOneRows;
break;
case AreaTwoSection:
return TotalAreaTwoRows;
break;
case AreaThreeSection:
return TotalAreaThreeRows;
break;
default:
return 0;
break;
}
}
Below is where I return the height for each row:
- (CGFloat)tableView:(UITableView *)tableView heightForRowAtIndexPath:(NSIndexPath *)indexPath {
CGFloat rowHeight = self.tableView.rowHeight;
// if (indexPath.section == TimeOfDaySection && indexPath.row == HourTimeZoneRow && self.timePickerIsShowing == NO){
return rowHeight;
}
Finally, below is where I check if the user selected the index path that I want to insert the UIPicker cell below. If they did, then I call a method to show the the picker.
- (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath
{
[self.tableView deselectRowAtIndexPath:indexPath animated:YES];
if (indexPath.section == SectionThree && indexPath.row == RowOne && self.timePickerIsShowing == NO){
[tableView beginUpdates];
[self showTimePicker];
[tableView endUpdates];
} else{
[self hideTimePicker];
[self.tableView deselectRowAtIndexPath:indexPath animated:YES];
}
}
Finally, below is where I show and hide the UIPicker.
- (void)showTimePicker
{
self.timePickerIsShowing = YES;
self.timePicker.hidden = NO;
//build the index path to where the picker should be inserted here
NSIndexPath *indexPath = [NSIndexPath indexPathForRow:HourTimeZoneRow + 1 inSection:TimeOfDaySection];
static NSString *CellIdentifier = @"TimePickerCell";
UITableViewCell *cell = (UITableViewCell*)[self.tableView dequeueReusableCellWithIdentifier:CellIdentifier];
if (!cell) {
cell = [[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:CellIdentifier];
}
_timePicker = [[UIPickerView alloc] initWithFrame:CGRectMake(0, 0, self.tableView.bounds.size.width, 160)];
[cell.contentView addSubview:self.timePicker];
[self.tableView insertRowsAtIndexPaths:@[indexPath] withRowAnimation:UITableViewRowAnimationFade];
[self.tableView reloadData];
self.timePicker.alpha = 0.0f;
[UIView animateWithDuration:0.25 animations:^{
self.timePicker.alpha = 1.0f;
}];
}
- (void)hideTimePicker {
self.timePickerIsShowing = NO;
self.timePicker.hidden = YES;
[self.tableView reloadData];
[UIView animateWithDuration:0.25
animations:^{
self.timePicker.alpha = 0.0f;
}
completion:^(BOOL finished){
self.timePicker.hidden = YES;
}];
}
A:
In your showPicker function, you don't seem to do anything? You create a cell, do things with it then it dies when that function ends. The cell is not added anywhere from what I can see?
You need to add the picker inside cellForRowAtIndexPath, for the index path you know needs a picker.
What I do requires very little coding. I create a prototype cell in interface builder which contains a picker view. In my case I also add a toolbar above the picker which I can put buttons in to allow Cancel and Done. Add suitable properties to pass in the current values for the picker to show initially. Add a delegate to use to inform the creator (your tableView) of changes in picker values. You can wait for it to finish picking, or use it to update live the cell its editing values for by reloading the cell being edited every time the value changes. I prefer that the picker can pick a value and you can commit it or cancel it.
When a cell needs edited, I update my data model to insert an editing entry then call [tableView reload]. In my case selecting a cell starts editing, clicking cancel/done ends editing.
The table view at this point will start asking for cells. This time one of those will be your new picker cell, which will be for editing the cell it is below. When you create it you pass it the data model reference for the data it is to edit.
So you can achieve all this by simply adding a new prototype cell type and creating it inside cellForRowAtIndexPath when required.
You have a choice as to how to remove the picker. In my case I have Cancel/Done buttons which just removes the entry from the data model and reloads the table again, resulting in it never being created. You could also make the mode as being click on a cell to add and click again to remove. Again you just update the data model and reload. See how the time picker works on the Calander app for a new appointment.
You may be thinking this is a lot of reloads. However it only affects what is on screen and I found it to be easier than trying to figure out the affected cells all the time. Its also very smooth. When it is working you can always optimize the code.
Use constraints in the cell to make sure it has the layout you want.
|
UPDATE: The Boston Police Department is asking for the public’s help with an ongoing investigation relative to a fatal motor vehicle collision that occurred in East Boston two days ago. Investigators wish to speak with several concerned citizens who were observed rendering assistance and aid to the victims on scene prior to the arrival of responding units, and any witnesses to the collision and events after the collision. Anyone with information is strongly encouraged to contact the BPD Fatal Collision Investigative Team at (617) 343-6135.
The original facts and circumstances surrounding the incident are as follows: At about 1:15 AM, on Sunday, May 5, 2019, officers from District A-7 (East Boston) responded to a motor vehicle collision involving a motor vehicle roll-over in the area of 1025 Bennington Street in East Boston. On arrival, officers observed one car, described as a gray motor vehicle, lying on its roof with extensive damage. According to Boston EMS personnel already on scene, one occupant, who has since been identified as Amber Pelletier, 20, of Central Falls, Rhode Island, had been declared deceased while a second occupant was transported to an area hospital with non-life-threatening injuries. The operator of the vehicle, considered occupant #3, had fled the scene and was gone before police arrived. That individual was later located, arrested and arraigned on multiple charges.
Community members wishing to assist the investigation anonymously can call the CrimeStoppers Tip Line at 1(800)494-TIPS or text TIP to CRIME (27463). The Boston Police Department stringently protects the identities of those who wish to remain anonymous. |
Tymochtee Dolomite
The Tymochtee Formation is a geologic formation in Ohio. It preserves fossils dating back to the Silurian period.
See also
List of fossiliferous stratigraphic units in Ohio
References
Category:Silurian Ohio
Category:Silurian southern paleotemperate deposits |
Introduction
============
Genome sequencing projects have dramatically increased in number and complexity in recent years. The first complete bacterial genome, *Haemophilus influenzae*, appeared in 1995, and today the public GenBank database contains over 27,000 prokaryotic and 1,600 eukaryotic genomes. Although many of these are draft genomes that contain gaps in their sequences, over 3,000 of the prokaryotic genomes are listed as complete, meaning that every nucleotide is present with no gaps.
The recent dramatic growth in microbiome research has been driven not only by the falling cost of sequencing, but by this large and growing set of known genomes. The large set of completed genomes makes it possible to identify, usually with high confidence, the species present in a sample of DNA taken from a site on the human body. The accuracy of microbiome analysis is critically dependent on the accuracy of the previously-sequenced microbial genomes. The vast majority of these sequences are accurate, but any errors may be amplified by efforts to search for the presence of unusual or unexpected species. This paper describes the finding of unexpected contaminants in two published genomes and the methods used to identify them.
Each genome sequencing project begins with a DNA source, which varies depending on the species. For animals, blood is a common source, while for smaller organisms such as insects the entire organism or a population of organisms may be required to yield enough DNA for sequencing. Throughout the process of DNA isolation and sequencing, contamination remains a possibility. Computational filters applied to the raw sequencing reads are usually effective at removing common laboratory contaminants such as *E. coli*, but other contaminants may be more difficult to identify. Human DNA is another common contaminant, presumably from the scientists who handle the samples at various times during the process of extraction through sequencing ([@ref-5]).
The current project was initiated when we learned that a microbiome project studying samples collected from domestic cows (*Bos taurus*) had identified the presence of a possible human pathogen that does not infect cows. As we investigated further, we discovered, first, that some of the original *Bos taurus* sequences were actually bacteria, and second, that some sequences from a published genome of *Neisseria gonorrhoeae* were actually cow and sheep DNA.
Methods
=======
We began by using microbiome sequence analysis software to analyze the genome of the domestic cow, *Bos taurus*, for signs of microbial contamination. The *Bos taurus* genome was originally assembled from 35 million Sanger reads ([@ref-10]). The vast majority of the assembly (version UMD 3.1) was mapped onto chromosomes, but a small fraction remained unmapped, as is common with all draft genomes. When we began our investigation, the UMD 3.1 assembly had 3,286 unmapped contigs containing 9,499,556 nucleotides.
To analyze the unplaced contigs from the *Bos taurus* genome, we used the Kraken system ([@ref-9]) to classify each contig. Kraken is a very fast method for identifying the species represented by a DNA sequence, using exact matching of short subsequences of length *k*, called *k*-mers. The software uses a specialized database of *k*-mers (where *k* = 31 by default) that can be constructed from any set of genomes. For our study, we built a database containing all bacteria, archaea, and viruses. To classify a new sequence *S*, Kraken looks up every *k*-mer in *S* to determine if it exists in any known species. If a *k*-mer occurs in more than one species, Kraken assigns it to the lowest common ancestor (LCA) of those species. After looking up every *k*-mer, Kraken then uses a weighted voting scheme to determine the species or higher-order clade assignment for *S*.
Our Kraken database contained 2,757 bacterial and archaeal genomes and 2,335 viral genomes from the RefSeq database at NCBI ([@ref-7]). The Kraken software (<http://ccb.jhu.edu/software/kraken/>) includes an automated program that will download all these genomes directly from NCBI and build a local database. It also includes instructions on how to build a database using a customized set of species.
After using Kraken to process the 3,286 unmapped *Bos taurus* contigs, we ran a second analysis looking at the protein translations of these contigs. For this analysis, we created a database with all protein sequences from the 2,757 complete microbial genomes and used BLASTX ([@ref-1]) to align each contig to the database. As a quality control step, we also ran Kraken on most of the mapped contigs, using all sequences from chromosomes 1 through 10. All experiments were run on a computer with 256 GB of RAM and four 2.1 GHz, 12-core AMD Opteron processors. Kraken processed the 3,286 unplaced contigs (9.5 megabases) in just 3.98 s.
Results and Discussion
======================
After removing low-complexity contigs (some of which contained nothing other than a series of dinucleotide repeats), 138 contigs from the *Bos taurus* UMD 3.1 assembly were identified as bacterial in origin. The BLASTX search, which was far slower but more sensitive, confirmed these 138 and identified 35 additional contaminants including both bacteria and viruses, for a total of 173 contaminant contigs. [Table S1](#supp-1){ref-type="supplementary-material"} lists all the contigs with the closest matching microbial species for each one. The most common contaminants found belonged to the genera *Acinetobacter* (29 contigs), *Pseudomonas* (35 contigs), and *Stenotrophomonas* (27 contigs). Note that additional microbial species might still be present but undetectable, if they derive from organisms that are not similar to any sequenced species.
One interesting finding from the unplaced contigs was Bovine herpesvirus 6, isolate Pennsylvania 47, a cattle-specific virus that causes multiple diseases. Because this is a retrovirus, we considered the possibility that it had actually inserted itself into the host genome---i.e., that it was part of the genome and not a contaminant--- in which case we would expect parts of the sequence to appear in the chromosomal contigs.
To evaluate this hypothesis, we used the nucmer program from the MUMmer package ([@ref-3]; [@ref-4]) to align the entire bovine herpesvirus genome against the entire *Bos taurus* assembly. This alignment yielded the same five contigs ([Table S1](#supp-1){ref-type="supplementary-material"}, contigs 149--153) we had found in our original scan, indicating that the virus was not integrated into the chromosomal DNA but rather an infection in the original animal.
To reflect these findings, we created a new release of the *Bos taurus* assembly, numbered 3.1.1, available as Bos_taurus_UMD_3.1.1 at NCBI (Accession [GCF_000003055.5](http://www.ncbi.nlm.nih.gov/assembly/GCF_000003055.5)) and also available from [www.ccb.jhu.edu/bos_taurus_assembly.shtml](www.ccb.jhu.edu/bos_taurus_assembly.shtml).
We then used Kraken to search all of the sequences placed on chromosomes 1 through 10, as a quality check on our method. We did not expect any of these contigs to match bacteria, but we unexpectedly found 2,885 small contigs that seemed to align in part to a single bacterial genome, *Neisseria gonorrhoeae*, strain TCDC-NG08107 ([@ref-2]). This bacterium is a human-specific pathogen, and it seemed highly unlikely that it had contaminated the original DNA used for sequencing.
Upon further investigation, we found that every contig aligned to one of just four locations on the TCDC-NG08107 strain, shown in [Table 1](#table-1){ref-type="table"}. The aligned regions ranged in length from 200 to 634 bp. When we extracted these sequences and aligned them separately to all sequences in GenBank, all of the matching sequences were from *Bos taurus*.
10.7717/peerj.675/table-1
######
Locations of foreign DNA in *Neisseria gonorrhoeae* TCDC-NG08107 genome. E-values in column 4 were computed by the BLAST program in a search against the NCBI comprehensive sequence database.
Genome coordinates Length True species BLAST E-Value
-------------------- -------- -------------- ---------------
499351--499709 359 Cow 3 × 10^−168^
1267185--1267393 209 Cow 1 × 10^−71^
1371560-- 1371932 373 Cow 2 × 10^−130^
1635755--1635954 200 Cow 3 × 10^−93^
2118014--2118647 634 Sheep 0.0
In an effort to determine the source of these foreign sequences in the TCDC-NG08107 genome (Genbank accession [CP002440](CP002440)), we examined the original publication ([@ref-2]) and the GenBank entry, and found that although the genome was listed as complete in GenBank, [@ref-2] described an assembly that comprised 180 contigs. Neither the publication nor the GenBank entry contained any information that the gaps had been filled. We concluded that sequence was erroneously uploaded as a finished genome, with all contigs simply concatenated together, and that the cow and sheep sequences represented accidental contaminants, presumably inserted computationally.
We then used the nucmer program ([@ref-4]) to align TCDC-NG08107 to its two closest relatives among the complete bacterial genomes, strains FA1090 and NCCP11945 (GenBank accessions [AE004960](AE004960) and [CP001050](CP001050)), which were also used by [@ref-2] to order and orient their original set of 180 contigs. These alignments indicated 181 separate alignments, in close agreement with the publication. We also found 67 small segments that did not align to either of the related strains. Normally, these would represent sequences that are insertions in TCDC-NG08107 as compared to other strains, a common finding when comparing bacterial genomes. However, these small segments included the regions that had matched the cow genome ([Table 1](#table-1){ref-type="table"}). As a further check, we aligned all 67 segments to the NCBI comprehensive nucleotide database. As shown in [Table 1](#table-1){ref-type="table"}, four of these segments matched *Bos taurus*, and a fifth segment aligned to *Ovis aries* (sheep). Not surprisingly, none of these five mammalian DNA fragments matched any other microbial species.
After removing the contaminated contigs, we used our alignments to re-order the remaining contigs using both NCCP11945 and FA1090. We removed 11 contigs that were fully contained within other contigs. This process yielded a reconstructed draft genome of TCDC-NG08107 with a total of 165 contigs, available in the [Supplemental Information](#supp-2){ref-type="supplementary-material"}. However, because we did not have access to the original TCDC-NG08107 data and because the original submitters did not respond to any requests for data, we cannot be confident that these contigs are the best representation of the genome. As a result of our findings, GenBank has temporarily suppressed the entry for this genome.
Contaminants in other genomes
-----------------------------
As a test of whether these findings might apply to other publicly available genomes, we randomly selected eight additional genomes from the NCBI database and ran Kraken on each of them. The eight genomes range in size from 75 to 700 Mbp and include animals, plants, and fungi. We also performed BLAST searches for each of the sequences that Kraken identified as contaminants ([Table 2](#table-2){ref-type="table"}), all of which were confirmed as microbial species. Three of the eight genome assemblies contained just 2--4 contaminant contigs, and one (*C. reinhardtii*) had 227, roughly similar to the number we found in *Bos taurus*.
10.7717/peerj.675/table-2
######
Results of screening 8 publicly available draft genomes for microbial contaminants. GenBank accession numbers are shown for each genome along with the number of contigs and the size of the draft assembly. The last column shows the sequencing technology used for each project.
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Genome \# of contaminant\ Total contaminant\ Range of\ Total \# of\ Genome size\ Technology
contigs length (bp) E-values contigs (Mbp)
--------------------------------------------------------------------------- -------------------- -------------------- ------------- -------------- -------------- ----------------------
*Schistosoma haematobium*\ 4 9,415 4E-71--0.0 49,195 35 Illumina
([GCA_000699445.1](http://www.ncbi.nlm.nih.gov/assembly/GCA_000699445.1))
*Cynoglossus semilaevis*\ 2 904 1E-6--5E-22 62,912 470 Illumina
([GCA_000523025.1](http://www.ncbi.nlm.nih.gov/assembly/GCA_000523025.1))
*Caenorhabditis brenneri*\ 2 19,677 0.0 13,373 190 ABI solid sequencing
([GCA_000143925.2](http://www.ncbi.nlm.nih.gov/assembly/GCA_000143925.2))
*Chlamydomonas reinhardtii*\ 227 254,869 0.0 11,385 120 Sanger
([GCA_000002595.2](http://www.ncbi.nlm.nih.gov/assembly/GCA_000002595.2))
*Citrus clementina*\ 0 0 N/A 8,962 301 Sanger
([GCA_000493195.1](http://www.ncbi.nlm.nih.gov/assembly/GCA_000493195.1))
*Anopheles darlingi*\ 0 0 N/A 13,857 174 454
([GCA_000211455.3](http://www.ncbi.nlm.nih.gov/assembly/GCA_000211455.3))
*Auricularia delicata* TFB-10046 SS5\ 0 0 N/A 4,884 75 Illumina
([GCA_000265015.1](http://www.ncbi.nlm.nih.gov/assembly/GCA_000265015.1))
*Schmidtea mediterranea*\ 0 0 N/A 118,433 701 Illumina
([GCA_000691995.1](http://www.ncbi.nlm.nih.gov/assembly/GCA_000691995.1))
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Conclusion
==========
These results illustrate the importance of performing a thorough search for contamination before submitting a genome sequence to a public archive. The rapidly growing number of draft genomes represents both a valuable resource and also, as we show here, a cautionary tale. Perhaps most problematic was the presence of foreign DNA in *N*. *gonorrhoeae* TCDC-NG08107, a genome that was submitted to GenBank as complete. If scientists cannot assume that the sequence of a species truly comes from that species, then analyses that use this data may be fundamentally flawed. Contamination from other species may masquerade as lateral gene transfer ([@ref-8]), an event that is relatively common between some bacteria but extremely rare otherwise. In particular, the transfer of bacterial DNA directly into a mammalian genome has been suggested previously, based on compositional analysis, but never proven ([@ref-6]). The presence of erroneously labelled DNA causes particular problems for microbiome analysis, in which the primary goal is the identification of which species are present in a sample. These findings highlight the importance of careful screening of DNA sequence data both at the time of release and, in some cases, for many years after publication.
Supplemental Information
========================
10.7717/peerj.675/supp-1
###### Supplementary Table S1
173 contigs from the *Bos taurus* assembly identified as possible contaminants. The closest matching bacterial, archaeal, or viral species is shown. Sequence ID refers to the original identifier in the *Bos taurus* UMD 3.1 assembly. All contigs belonged to the unmapped set; none were mapped onto chromosomes. The final column shows the BLAST E-value from an alignment of each contig against the comprehensive DNA sequence database "nr" at NCBI.
######
Click here for additional data file.
10.7717/peerj.675/supp-2
###### This file contains the sequences, in FASTA format, of the 165 re-ordered contigs that comprise the reconstruction of the *Neisseria gonorrhoeae* genome
######
Click here for additional data file.
10.7717/peerj.675/supp-3
###### This file contains the sequences, in FASTA format, of the five segments of DNA from the *N. gonorrhoeae* TCDC-NG08107 genome that were identified as cow and sheep sequences
######
Click here for additional data file.
Additional Information and Declarations
=======================================
The authors declare there are no competing interests.
[Samier Merchant](#author-1){ref-type="contrib"} performed the experiments, analyzed the data, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.
[Derrick E. Wood](#author-2){ref-type="contrib"} performed the experiments, analyzed the data, contributed reagents/materials/analysis tools, reviewed drafts of the paper.
[Steven L. Salzberg](#author-3){ref-type="contrib"} conceived and designed the experiments, performed the experiments, analyzed the data, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.
|
Adaptive analysis of fMRI data.
This article introduces novel and fundamental improvements of fMRI data analysis. Central is a technique termed constrained canonical correlation analysis, which can be viewed as a natural extension and generalization of the popular general linear model method. The concept of spatial basis filters is presented and shown to be a very successful way of adaptively filtering the fMRI data. A general method for designing suitable hemodynamic response models is also proposed and incorporated into the constrained canonical correlation approach. Results that demonstrate how each of these parts significantly improves the detection of brain activity, with a computation time well within limits for practical use, are provided. |
/* tslint:disable:readonly-keyword */
/// <reference types="sinon" />
declare global {
export namespace NodeJS {
export interface Global {
sandbox: sinon.SinonSandbox;
}
}
var sandbox: sinon.SinonSandbox;
}
export {}; |
"""
Copyright 2017-present Airbnb, Inc.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
"""
from streamalert.shared.logger import get_logger
from streamalert_cli.terraform.generate import terraform_generate_handler
from streamalert_cli.terraform.helpers import terraform_runner
from streamalert_cli.utils import CLICommand, set_parser_epilog, add_clusters_arg
LOGGER = get_logger(__name__)
class KinesisCommand(CLICommand):
description = 'Update AWS Kinesis settings and run Terraform to apply changes'
@classmethod
def setup_subparser(cls, subparser):
"""Add kinesis subparser: manage.py kinesis [options]"""
set_parser_epilog(
subparser,
epilog=(
'''\
Example:
manage.py kinesis disable-events --clusters corp prod
'''
)
)
actions = ['disable-events', 'enable-events']
subparser.add_argument(
'action',
metavar='ACTION',
choices=actions,
help='One of the following actions to be performed: {}'.format(', '.join(actions))
)
# Add the option to specify cluster(s)
add_clusters_arg(subparser)
subparser.add_argument(
'-s',
'--skip-terraform',
action='store_true',
help='Only update the config options and do not run Terraform'
)
@classmethod
def handler(cls, options, config):
"""Main handler for the Kinesis parser
Args:
options (argparse.Namespace): Parsed arguments
config (CLIConfig): Loaded StreamAlert config
Returns:
bool: False if errors occurred, True otherwise
"""
enable = options.action == 'enable-events'
LOGGER.info('%s Kinesis Events', 'Enabling' if enable else 'Disabling')
for cluster in options.clusters or config.clusters():
if 'kinesis_events' in config['clusters'][cluster]['modules']:
config['clusters'][cluster]['modules']['kinesis_events']['enabled'] = enable
config.write()
if options.skip_terraform:
return True # not an error
if not terraform_generate_handler(config):
return False
return terraform_runner(
config,
targets=[
'module.{}_{}'.format('kinesis_events', cluster) for cluster in config.clusters()
]
)
|
Vladimir Velebit
Vladimir "Vlatko" Velebit, PhD (19 August 1907 – 29 August 2004) was a Yugoslav communist who joined the Partisans in 1941, reaching the rank of Major-General. A lawyer by profession, after the war he became a diplomat and historian.
Among his notable post-World War II appointments were the Yugoslav Ambassador to Rome as well as the Court of St. James's and World Bank. Additionally, he was Yugoslav Deputy Minister of Foreign Trade, and UNECE Executive Secretary from 1960 to 1967.
Early life and education
Born in Zadar, Austria-Hungary to Serbian father Ljubomir Velebit and Slovenian-Croatian mother Olga Šeme, Vladimir's family had a long military tradition. His father Ljubomir was an officer in the Austro-Hungarian Army, fighting on the Russian front during World War I and later becoming brigadier-general in the Royal Yugoslav Army, while Vladimir's paternal grandfather Dušan Velebit was a general in the Austrian Army who married Elisabeth Marno von Eichenhorst, daughter of another Austrian general Adolf Marno von Eichenhorst. Even Vladimir's great grandfather Ilija Velebit was an officer in the Austrian army.
His male ancestors were Serbs originating from the village of Gornja Pastuša near Petrinja in the Banija region that was part of the Austrian-created Military Frontier. They were recruited into the Austrian army, eventually achieving high ranks.
Velebit began his formal education in Timișoara in German language. His family left the city just after the outbreak of World War I and went to Trieste while his father was off in Russia fighting for the Austro-Hungarians. Young Vladimir was soon moved again, this time to Vienna where he got enrolled in private school that held classes in French language. Following the end of the war in 1918 and final break-up of Austria-Hungary, the family moved to Zagreb that was now part of newly created Kingdom of Serbs, Croats and Slovenes. At this point, 11-year-old Vladimir spoke very little Serbo-Croatian and had to study hard in order to be able to communicate in school. Due to his father's (who was now in the Royal Yugoslav Army) job, the family then moved to Čakovec and later to Varaždin, which is where Vladimir graduated high school in 1925.
He started studies at the University of Zagreb's Faculty of Law and then went to Paris for specialization, before returning to Zagreb to graduate in 1931. He earned his PhD two years later in 1933 from the same university.
Legal career and communist activities on the side
After passing the lawyer's and judge's exams, Velebit began working as legal assistant at the District Court in Niš. Accused of having leftist political leanings during his student days he got transferred to Leskovac. Once there he hooked up with Communist Party (KPJ) members (a political party that was at the time an underground organization because of the ban on its activities in the Kingdom of Yugoslavia) and took part in starting the newspaper Leskovačke nedeljne novine that wasn't openly communist, but supported political opposition to the ruling coalition and by proxy to King Alexander I Karađorđević. Because of this Velebit got transferred again, this time to Priština where he was a judge in the County Court. The continual career demotion didn't deter Velebit from continuing with leftist activity; in Priština he started a readers' group that met clandestinely in his room to read Marxist literature and discuss politics. When authorities caught wind of this, the county sheriff ordered his room to be searched, but nothing incriminating was found. Velebit then became the chief of County Court in Kičevo, and later got transferred to Šid where he established contact with more KPJ members among whom was Herta Haas (at the time a student at Economics High School in Zagreb, later to become Josip Broz Tito's wife).
By 1937 Velebit had enough of being a judge, and moved to Zagreb where he established a law practice. Already deeply involved with the communists, in parallel with his legal practice he became a courier for the underground movement. Due to the nature of his job and a considerable network of professional connections, he was perfectly suitable for carrying messages to foreign countries. On one of those trips to Istanbul in 1939, 32-year-old Velebit met 47-year-old Josip Broz Tito who was KPJ's general secretary at the time. Being impressed with Velebit's guile, skills, and intelligence, Tito immediately offered him membership in the party. After becoming a full-fledged member Velebit began working as assistant to Josip Kopinič, Comintern's agent in Zagreb. In 1940 Velebit obtained and set up a radio station used to establish daily contact with Moscow - the station was never discovered and was functional throughout the war.
World War II
Following April 1941 Nazi invasion and dismemberment of the Yugoslav Kingdom, Velebit stayed in Zagreb that became capital of the newly created Nazi client, Ustaše-run puppet state entity Independent State of Croatia (NDH). He operated as an underground collaborator of the KPJ-established People's Liberation Front. While working underground he used the alias name Vladimir Petrović, although due to being a well known and respected lawyer before the war he experienced no trouble with NDH authorities.
During March 1942 Velebit left Zagreb and joined the Partisans who mounted a guerrilla resistance to the Nazis and domestic collaborationists. Right away Tito included him in the army's Supreme Command where he mostly worked on establishing some sort of military court authority. Due to his education and knowledge of foreign languages, along with Koča Popović and Milovan Đilas, Velebit was part of the Partisan delegation in Gornji Vakuf and Zagreb at the controversial March 1943 German-Partisan negotiations while the Battle of Neretva raged several hundred kilometers to the south. Velebit and Đilas conducted the negotiations under pseudonyms Vladimir Petrović and Miloš Marković, respectively, while Koča Popović gave his real name.
In June 1943, Velebit became the point of contact for foreign military missions in their dealings with the Partisans. Following the death of Ivo Lola Ribar (member of Supreme Command and the chief of Partisan first military mission) on 27 November 1943, Velebit took over his duties. Following the Teheran Conference where the Allies agreed on backing the Partisan resistance exclusively over the Chetnik one, Velebit was sent to the Near East with lieutenant-colonel Miloje Milojević for negotiations over the details and scope of the support. After establishing first contact with the Allies in Cairo, he was on his way to London for further negotiations. Once there, Velebit had meetings with British envoys Fitzroy Maclean and William Deakin over the formal recognition of the People's Liberation Front as a new state entity. In May 1944 Velebit met with Winston Churchill and was also present in Caserta near Naples during Churchill's meeting with Tito on 12 August 1944.
Post-war diplomatic career
Right after the end of World War II Velebit continued his diplomatic activity.
In the Democratic Federal Yugoslavia's provisionary government that got formed on the basis of British-brokered Treaty of Vis and later the Belgrade Agreement, he was the deputy to the Foreign Affairs Minister. He then became one of the chief members of the secret Yugoslav diplomatic mission to Washington, negotiating the terms and scope of the American help to Yugoslavia. After returning home to the country that was in the meantime re-constituted as a Stalinist communist state called Federal People's Republic of Yugoslavia, he became deputy to Foreign Affairs Minister Stanoje Simić. In that role, Velebit negotiated with the Allies during the Trieste Crisis.
In March 1948, after Soviet accusation that he was a British spy, Velebit was forced into resigning his post at the Yugoslav Foreign Affairs Ministry and got moved to the Tourist and Service Industry Committee. During the 1948 Cominform resolution and the fallout of subsequent Tito-Stalin split, Velebit was on more than one occasion cited by the Soviets as a spy who works for the British.
In 1951, Velebit became Yugoslav ambassador to Italy, while a year later he got the same job in the United Kingdom. During March 1953, he prepared Tito's first official state visit to a Western country. Tito thus became the first communist leader to visit the UK.
In 1960, on invitation from the United Nations general-secretary Dag Hammarskjöld, Velebit became executive secretary at the UN European Economic Commission (UNECE) in Geneva. He performed this job up until his retirement in 1967. Known in Western circles as a skilled diplomat, his last assignment was as an emissary of the Carnegie Foundation in the Israeli-Palestinian conflict.
In the early 1990s during the Yugoslav breakup and the beginning stages of the Yugoslav Wars, Velebit moved from London to Zagreb due to nationalist threats. Once back he divided his time between Zagreb and Mali Lošinj.
In 1992, Velebit was a contributor for the Radio Television of Serbia documentary series entitled Yugoslavia in War 1941-1945.
During retirement he wrote two books 1983's Sećanja (Memories) and 2002's Tajne i zamke Drugog svetskog rata (World War II's Secrets and Traps).
He died on 29 August 2004 at the Rebro clinical center in Zagreb. He was buried at the city's Mirogoj Cemetery on 3 September 2004.
Vladimir Velebit is mentioned in the 2009 book A Rat Hole to be Watched by American historian Coleman Armstrong Mehta as the point of contact between Frank Wisner (head of the Central Intelligence Agency's Directorate of Plans) and Yugoslav communist government during the early 1950s. Wisner apparently contacted Velebit because he was known to be the leading proponent of the idea that Yugoslav state should be oriented towards the West. According to Mehta's book that's based upon recently declassified American intelligence documents, the Wisner-Velebit contact, which occurred in the wake of Tito-Stalin split, eventually resulted in intelligence cooperation agreement between the United States and Federal People's Republic of Yugoslavia. The agreement enabled the Americans to get their hands on recently developed and deployed MiG-15 Soviet fighter plane, which was delivered to them by the Josip Broz Tito's Yugoslav government in 1951.
Personal
Velebit married Vera Becić, a woman of Croatian ethnicity, the daughter of Croatian painter Vladimir Becić. They had two sons: Vladimir Jr. and Dušan.
See also
Socialist Federal Republic of Yugoslavia
Yugoslav People's Army
Titoism
Communism
References
Category:1907 births
Category:2004 deaths
Category:People from Zadar
Category:People from the Kingdom of Dalmatia
Category:Anti-fascists
Category:Yugoslav communists
Category:Yugoslav guerrillas
Category:Yugoslav Partisans members
Category:Yugoslav diplomats
Category:Serbs of Croatia
Category:Government ministers of Yugoslavia
Category:Ambassadors of Yugoslavia to Italy
Category:Ambassadors of Yugoslavia to the United Kingdom |
Infrastructure In Cambodia
How Developed Is Cambodia's Infrastructure?
Due to decades of strife and civil war, Cambodia’s infrastructure is weak and far behind the standards of its Southeast Asia neighbors. Port, air, roadway, and railway infrastructure are all poor, but plans are underway to renovate and modernize them all.
While Cambodia only has three airports that offer regular commercial flights, the country serves as an excellent base within Asia. Located smack-dab in the center of Southeast Asia, Cambodia offers you easy and cheap flights to Thailand, Myanmar, Vietnam, Malaysia, and Laos (each for about US$30). All these countries can be reached by bus, as well, for about US$15.
Conveniences Westerners are used to including golf courses, shopping malls, and high-quality international schools are springing up throughout the country with increasing regularity.
Recently whole swathes of Phnom Penh have been redeveloped, old French-colonial buildings are being restored, and magnificent public spaces—first conceived by the French city planners— are again opening up. Phnom Penh’s long, snaking riverfront has been completely revitalized. It was a lengthy, troubled enterprise but the result is worth it. The project has created a vast, welcoming community area… and again revealed the ingenuity of the city’s colonial planners.
At least in Phnom Penh, the road infrastructure has been massively improved and most of the key thoroughfares now are in decent shape. Traffic gets heavy on the main routes at rush hour, but is still far lighter than what you would find in Bangkok, Ho Chi Minh City, or Yangon. |
The Importance of Fitness
Posted By: JaCory Marshall ,NESTA On: July 24, 2017
The Importance of Fitness
According to the World Health Organization, about 80% of people in the world are not active (physically) enough. (1) One of the reasons why people are not as active as they should be is the fact that they are not aware of the importance of fitness.
Fitness is a term used to describe the condition of being physically healthy and fit. Fitness is all about having sufficient energy levels to complete all the tasks through the day. It is important to mention that both diet and physical exercise are crucial for fitness. Now let’s highlight the reasons why it is so important to become and stay fit.
Fewer diagnoses of disease and illness
First of all, fitness is all about keeping the body in a positive and/or perfect shape. In case you are not taking care of fitness, you put your body at risk. Some of the most common diseases related to lack of fitness include cancer, hypertension, heart disease and type 2 diabetes.
Increased energy levels
Having the required levels of energy to conduct daily activities is crucial not only for success, but also for happiness. Physical activity and fitness can help you get the proper amount of energy.
Less stress
Regular physical activity can help you de-stress. Stress is one of the most common causes of health problems and deaths in the United States. (2)
In addition, fitness is important for the quality of sleep and even for your self-confidence.
How to get fit?
Even if you are out of shape for a long time, you should know that there is more than one way to get fit. According to many experts, in home training is one of the best options, especially in-home training with a personal trainer. Here’s a short list of the benefits you can expect.
In-home training
It’s convenient
First and foremost, on-site training is convenient. There are many people who simply don’t have time to go to the local gym. Other people have physical limitations or injuries. All these things can be avoided thanks to in-home training. So, just do some research and identify the best traveling trainers KC solutions and choose one of them.
It saves time
We have already mentioned that this type of training for fitness allows people to organize and use their time in the best possible way. Once you find the best personal training KC option, you can talk to them about the optimal time when you would like to exercise. There is no need to travel to a gym and follow the working hours of the gym – you can choose to exercise whenever it suits you.
Privacy
The fact is that most people dislike the atmosphere in the gym. These places can get too crowded too. If you choose to have a trainer that will come to your home, you will avoid these unpleasant situations. No one will watch you and you will feel more comfortable.
You’ll get the necessary attention
With the right KC in-home training solution, you can rest assured that you will get the necessary attention for optimal results. These trainers will do their best to help you follow a training program that promises the best results for you – a program tailored to your needs and abilities. |
Q:
Convergence of stochastic process sample path to deterministic function
Suppose we have a sequence of stochastic processes $\{X_{n,t}; t\geq 0\}_{n\in\mathbb N}$ such that $\mathsf E(X_{n,t})=f_n(t)=ng(t)$ where $n$ is some parameter and $g$ is just a function of $t$ (i.e. no dependence on $n$ for $g$). Furthermore assume that $\mathsf{Var}(X_{n,t}/n)\rightarrow 0$ as $n\rightarrow\infty.$ So we have that, for each fixed $t$, $X_{n,t}/n$ converges to $g(t)$ in probability as $n\rightarrow\infty.$ If it helps, we can also assume that there is a bound $|X_{n,t}|<M$ surely for all $n$ and $t.$
Question: Can we in any sense justify saying that:
$$``X_{n,t} \text{ converges to } f_n(t)"$$
even if $X_{n,t}$ and $f_n(t)$ grow unboundedly for fixed $t$ values?
Maybe
$$d(X_{n,t},f_n(t))=\frac{\sup_{t\geq0}|X_{n,t}-f_n(t)|}{n}$$
or
$$d(X_{n,t},f_n(t))=\int_0^\infty \frac{(X_{n,t}-f_n(t))^2}{n^2} \ dt$$
or something else can serve as a metric so that $d(X_{n,t},f_n(t))$ converges to zero in probability? Is this idea of mixing metrics and probabilistic convergence a bit absurd?
The idea is that the graphs of $X_{n,t}$ and $f_n(t)$ as functions of $t$ are quite distinct for small $n$ and are visibly indistinguishable for large $n$, even though the maximal extent of the range of both graphs grows unboundedly in $n$.
The motivating example is radioactive decay, where $n$ is the initial number of particles that decay at rate $\alpha$. Let $X_{n,t}$ represent this stochastic process (for fixed $n$ and $t$, $X_{n,t}$ is just a binomial for $n$ trials and probability of success $e^{-\alpha t}$). In some sense, for a large number of initial particles $X_{n,t}$ is 'close' to $ne^{-\alpha t}.$ Is there an appropriate way to define this 'closeness' or is scaling by $n$ the only reasonable way to go?
A:
The idea of convergence in distribution of random functions is standard. The classical example is Donsker's theorem which probably does not contain the exact solution to your problem but does give a taste of the kind of thing involved. There are two interlocking key steps. You have to pick a function space for your random elements live in, and you have to check a condition called "tightness", which involves (loosely speaking) a probabilistic bound on how wiggly the random functions can be. The details are technical, and vary from problem to problem. A classical (and readable) book on the subject is Billingsley's Convergence of Probability Measures.
That being said, your notions about scaling are naive. You seem to be looking for a result of form "$a_n$ converges to $b_n$" when you really want a result of form "$a_n/f(n)$ has such-and-such a limit", or "$(a_n-b_n)/g(n)$ has such-and-such a limit".
|
1 Suggested Answer
Hi,
A 6ya expert can help you resolve that issue over the phone in a minute or two.
Best thing about this new service is that you are never placed on hold and get to talk to real repairmen in the US.
The service is completely free and covers almost anything you can think of (from cars to computers, handyman, and even drones).click here to download the app (for users in the US for now) and get all the help you need. Good luck!
Tell us some more! Your answer needs to include more details to help people.You can't post answers that contain an email address.Please enter a valid email address.The email address entered is already associated to an account.Login to postPlease use English characters only.
Attachments: Added items
Related Questions:
Your maytag washer tub and basket assembly sits on a base counter balanced by 6 springs. Is is possible to move the tub around by hand. The best test is to start a spin with the unit empty of cloths, allow the tub to reach speed for a few seconds, lift the lid and check the tub position after it stops, if the tub is off center with the lid opening, re center the tub and run spin again. If your tub returns to an off center stopped position you most likely will need the base kit replaced. The base kit replaces the entire bottom of the unit along with new springs, and snubber, if so packaged per your application. Maytag experienced a defective stamping dye when these bases were stamped, thus they were stamped crooked. This test is performed with the machine it's self relatively level on the floor. If the tub assy leans and favors any one direction while you are trying to center it with the lid open, you may have a rusted or broken counter spring in side the unit. Pleazer Appliance...
Hi Roxanne:
The goal is to get all four of your pawns around the board and into
your home space. You move around the board by drawing cards and
following the instructions on the card. If you land on the same space as
another player's pawn, you send it back to start. The main difference
in Sorry Spin is that the board is made up of 5 gears (a large center
gear and 4 smaller home gears) and sometimes you draw a card or land on a
space with allows you to "spin" the gears 1/4 of the way around. Doing
this may move you closer to your home gear or send another player right
past their home, making them go all the way around again.
The goal is to get all four of your pawns around the board and into
your home space. You move around the board by drawing cards and
following the instructions on the card. If you land on the same space as
another player's pawn, you send it back to start.
The main difference
in Sorry Spin is that the board is made up of 5 gears (a large center
gear and 4 smaller home gears) and sometimes you draw a card or land on a
space with allows you to "spin" the gears 1/4 of the way around. Doing
this may move you closer to your home gear or send another player right
past their home, making them go all the way around again.
Hi Tammy:The goal is to get all four of your pawns around the board and into
your home space. You move around the board by drawing cards and
following the instructions on the card. If you land on the same space as
another player's pawn, you send it back to start.
The main difference
in Sorry Spin is that the board is made up of 5 gears (a large center
gear and 4 smaller home gears) and sometimes you draw a card or land on a
space with allows you to "spin" the gears 1/4 of the way around. Doing
this may move you closer to your home gear or send another player right
past their home, making them go all the way around again.
I would RMA the card if the fan refused to come on. When it is not on and you begin testing the card, does the fan come on at that point? How do you make the fan come on other than turning on your computer? If the fan isn't on to begin with, but comes on when you start playing a graphics intensive game I would not RMA the card unless Nvidia support suggests it.
If its still under warranty, and the seal hasn't been cracked, contact Microsoft.
Try what hijackthis1 suggested, if that doesn't fix it, try this.
Since you have the 360 apart, and the top cover off of the dvd drive, here we go...
There's a circular cut-out that's glued to the top cover that you removed from the dvd drive, right below the sticker with all of the drive information. I was able to pop out the cut-out. After that you now have (3) pieces in your hand, the cover, cut-out, and a plastic piece.
Connected the dvd drive back in the 360 with the top cover off.
Put a game or movie in the drive, don't hit the eject botton, just put the disc in the tray.
Now with the disc in the tray, put the plastic piece in the center of the disc. Its magnetic, so it should kind of lock in to place.
Connect the power/av cords in the 360 and turn her on.
You should see the disc try to spin. (It may spin once or a couple times around, but it will stop). When you see the disc start to spin, GENTLE, spin/turn the disc in the direction in wants to go. It should load the game or dvd with no problems.
Reassemble the cover and put back on the dvd drive.
Now use the eject botton, and try games and dvds.
If disc fails to spin, do process over again.
I've done this with one of my 360's with no problems.
The drive I used was an Hitachi 0059DJ. |
Stocks having surprisingly strong year
By Bernard Condon
Associated Press
Published: Friday, June 29 2012 10:00 p.m. MDT
NEW YORK — For all the scary headlines — a bailout of Spanish banks, JPMorgan's huge trading loss, the sputtering job market, Facebook's failed initial public offering — it's a wonder stocks aren't down more this year.
Actually, stocks aren't down. That was a trick sentence. At the halfway mark for 2012, stocks are up more than 8 percent.
"People think we're down because memories are short," says Rex Macey, chief investment officer at Wilmington Trust Investment Advisors. "It feels like the market's been worse than it actually has."
The year began with investors focusing on corporate America's record profits and scooping up stocks. The Standard & Poor's 500 index surged 12 percent from January through March.
It looked like that gain would be cut in half in the second quarter. Investors worried about Europe's inability to find a lasting solution to its debt crisis and about slower job growth in the United States.
Then came Friday: European leaders announced a broad strategy to funnel money into failing banks and keep borrowing costs down for governments, and stocks soared around the world.
It all left the S&P 500 up a healthy 8.3 percent for the year.
What happens next will probably depend on corporate earnings again. For April through June, they are expected to fall 0.7 percent from a year ago, according to S&P Capital IQ, a research firm. That would be the first drop in nearly three years.
So far, though, stocks in the U.S. are trouncing those in many countries. European markets are nearly all down this year, and several are down more than 10 percent. And many big emerging markets are struggling. China is down 1 percent, Russia 7 percent and Brazil 14 percent.
The backdrop is a darkening economic picture. China's economy is slowing, consumer confidence in the U.S. has sunk for four straight months, and a report next Friday is expected to show a fourth straight month of weak job growth.
As if that weren't bad enough, U.S. companies, from retailers to consumer goods makers to technology firms, are talking down investor expectations for how much they'll earn over the next several months, and that is sinking their stocks.
Then there's the sorry case of Bed Bath & Beyond, which had been an investor favorite. It lowered earnings estimates June 21 and disclosed it had to give out more coupons to get people to shop. The stock plummeted 17 percent, erasing in hours most of what it gained over several months.
Tally them up, and for every company raising its expected earnings, nearly four are lowering them, according to Thomson Reuters, a financial information company. Projections haven't been that negative in more than a decade.
"We began the year thinking we'd achieved escape velocity," says Barry Knapp, chief U.S. equity strategist at Barclays Capital. "But the second quarter data has deteriorated."
Well, not all of it. The price of gasoline has dropped to a five-month low, which means Americans have more money to spend elsewhere, boosting the economy. And the housing market may finally be recovering.
Prices of homes in most major cities rose in April, the latest month for which data is available, and the trend may continue. People have been signing contracts to buy existing homes at the fastest pace in two years, encouraged by low mortgage rates. The average rate on a 30-year fixed mortgage has fallen to 3.66 percent, the lowest on record.
James Paulsen, chief investment strategist at Wells Capital Management, says falling gas prices and mortgage rates have kick-started economic growth in the second halves of the previous two years, and he thinks they will this time, too.
He thinks the S&P 500 could end 2012 at 1,500, up 19 percent for the year. |
492 S.E.2d 648 (1997)
COUNTY OF FAIRFAX, et al.
v.
CENTURY CONCRETE SERVICES, INC.
Record No. 961854.
Supreme Court of Virginia.
October 31, 1997.
Dennis R. Bates, Senior Assistant Attorney (David P. Bobzien, County Attorney; Robert L. Howell, Deputy county Attorney, on briefs), for appellant.
*649 Brian J. Vella (Randall C. Allen; Christina M. Pirrello; Smith, Pachter, McWhorter & D'Ambrosio, on brief), Vienna, for appellee.
Present: CARRICO, C.J., COMPTON, LACY, HASSELL, KEENAN and KINSER, JJ., and WHITING, Senior Justice.
HASSELL, Justice.
In this appeal, we consider whether Code § 15.1-549 prohibits a county from paying interest on a judgment.
Fairfax County executed a contract with Century Concrete Services, Inc. Pursuant to the terms of the contract, Century agreed to perform certain construction work on a landfill basin. A dispute arose between Century and the County. Century filed a motion for judgment against the County and was awarded a judgment in the amount of $60,340.00 plus prejudgment and judgment interest. The County appeals that portion of the judgment which awarded interest.
The County argues that the trial court erred by entering an order which requires the County to pay interest. The County asserts that Code § 15.1-549 prohibits the County from paying interest on a judgment. Century responds that Code § 15.1-549 does not bar the award of interest. We agree with the County.
Code § 15.1-547 authorizes a county's board of supervisors to issue and approve warrants to pay all valid claims that may be asserted against a county. Code § 15.1-549, which imposes certain limitations upon the issuance of warrants, states in relevant part:
"No board of supervisors shall order any warrant issued for any purpose other than the payment of a claim received, audited and approved as required by § 15.1-547.
....
No interest shall be paid on any county warrant.
Any clerk, deputy clerk or member of any board of supervisors who shall violate or become a party to the violation of any of the provisions of this section shall be guilty of a misdemeanor, and in addition thereto shall be guilty of malfeasance in office."
In Lynchburg v. Amherst County, 115 Va. 600, 80 S.E. 117 (1913), we considered whether a city was entitled to a jury instruction which would have permitted a jury to make an award of prejudgment interest against a county. We stated:
"As a rule, the common law did not imply a promise to pay interest, and interest could not be recovered, save where it was expressly contracted for.... While the courts in this State, aided by the legislature, have established a different doctrine as between natural persons and private corporations, viz., that it is but natural justice that he who has the use of another's money should pay interest on it ... yet, so far as we know, it has never been held by this court that a claim asserted against the State or a county bears interest where there is no provision in the statute or authorized agreement creating the liability for the payment of interest. Not only is there no statute or precedent for the payment of interest on claims like those asserted in this case, but clause 2, section 834 of Pollard's Code [the precursor to Code § 15.1-549], which provides for the examination, settlement and allowance of all accounts chargeable against the county and for the issuance of warrants therefor when settled and allowed, expressly declares that no interest shall be paid by any county on any county warrant. If the board of supervisors had allowed the claims of the city, or any of them, and issued a warrant therefor, and the county afterwards refused to pay the claim and litigated its liability, as it had the right to do ... and judgment had been rendered against it for the amount of the warrant so issued, by the plain terms of the statute, it would not have been chargeable with interest. This being so, it is difficult to see upon what ground the county would be liable for interest on the same claims when disallowed by the board of supervisors."
Id. at 608-09, 80 S.E. at 120.
The rationale that we invoked in Lynchburg v. Amherst County is equally pertinent here. The County pays its construction claims by ordering the issuance of warrants, payable on demand, which may be *650 converted to negotiable checks. See Code § 15.1-547. That portion of the trial court's judgment awarding interest against the County is erroneous because Code § 15.1-549, which is similar to the statute that we considered in Lynchburg v. Amherst County, specifically states that "[n]o interest shall be paid on any county warrant." And, consistent with our reasoning in Lynchburg v. Amherst County, in the absence of a specific statutory authorization, we will not permit a judgment creditor to obtain an award of interest against a county because to do so would enable that judgment creditor to circumvent the express prohibition against an award of interest contained in Code § 15.1-549.
Moreover, Code § 15.1-549, which prohibits payment of interest in these circumstances, provides that any clerk, deputy clerk, or member of any board of supervisors who violates the statute is guilty of a misdemeanor and guilty of malfeasance in office. Certainly, the language in this statute is a strong command from the General Assembly that the County cannot pay either prejudgment or post-judgment interest on any claim against it.
It is true, as Century asserts, that Code § 8.01-382 permits a litigant to recover interest against a party in certain instances. That Code section states in relevant part:
"In any action at law or suit in equity, the verdict of the jury, or if no jury the judgment or decree of the court, may provide for interest on any principal sum awarded, or any part thereof, and fix the period at which the interest shall commence. The judgment or decree entered shall provide for such interest until such principal sum be paid. If a judgment or decree be rendered which does not provide for interest, the judgment or decree awarded shall bear interest from its date of entry, at the rate as provided in § 6.1-330.54, and judgment or decree entered accordingly; provided, if the judgment entered in accordance with the verdict of a jury does not provide for interest, interest shall commence from the date that the verdict was rendered."
Contrary to Century's assertion, however, Code § 8.01-382 simply has no application here. We must apply Code § 15.1-549 in this appeal because it is a statute of specific application which takes precedence over Code § 8.01-382, a statute of general application. "`[W]hen one statute speaks to a subject in a general way and another deals with a part of the same subject in a more specific manner, ... where they conflict, the latter prevails.'" Dodson v. Potomac Mack Sales & Service, 241 Va. 89, 94-95, 400 S.E.2d 178, 181 (1991) (quoting Virginia Nat'l Bank v. Harris, 220 Va. 336, 340, 257 S.E.2d 867, 870 (1979)); City of Winchester v. American Woodmark, 250 Va. 451, 460, 464 S.E.2d 148, 153 (1995).[*]
Finally, Century, relying upon City of Richmond v. Blaylock, 247 Va. 250, 440 S.E.2d 598 (1994), says that this Court held that "an award of prejudgment interest against the City of Richmond, although denied, was properly within the discretion of the court under Va.Code § 8.01-382." Blaylock is not pertinent to our resolution of this appeal. The litigants in Blaylock did not, and indeed, could not, assert that Code § 15.1-549 precludes an award of interest against the City of Richmond because Code § 15.1-549 is applicable to counties only. Furthermore, in Blaylock, the trial court refused to award prejudgment interest, and we did not decide whether a city could be required to pay such interest. Blaylock, 247 Va. at 253, 440 S.E.2d at 599.
We will reverse that portion of the trial court's judgment which awards interest against the County, modify the judgment accordingly, and enter final judgment in favor of Century.
Reversed in part, modified and final judgment.
NOTES
[*] In view of our holding, we need not address the litigants' remaining arguments.
|
-2*b = -b + 57. Let w = 102 + b. What is w*s(q) - 2*t(q)?
-5*q**2
Let h(t) = -14*t**3 + 20*t**2 - 5*t + 17. Let c(n) = -323*n**3 - 352*n**3 + 680*n**3 + 2*n - 6 - 7*n**2. Give 17*c(w) + 6*h(w).
w**3 + w**2 + 4*w
Let g(z) = 36*z**2. Let l = -81 + 88. Let f be 54 + (0 - 9/6*-2). Suppose -4*u + l = -f. Let p(d) = -7*d**2. What is u*p(a) + 3*g(a)?
-4*a**2
Let v(l) be the third derivative of l**5/6 - 23*l**4/12 + 579*l**2. Let f(i) = 2*i**2 - 9*i. Calculate -14*f(n) + 3*v(n).
2*n**2 - 12*n
Let q(u) = -156*u**3 - 4*u**2 + 2*u - 11. Let x(v) = -310*v**3 - 9*v**2 + 4*v - 24. What is -13*q(b) + 6*x(b)?
168*b**3 - 2*b**2 - 2*b - 1
Let n(w) = -7*w**3 - 5*w**2 - 10*w - 4315. Let i(f) = 9*f**3 + 6*f**2 + 12*f + 4316. What is -5*i(u) - 6*n(u)?
-3*u**3 + 4310
Let z(o) = -30*o**3 - o**2 + 1. Let p(u) = 125*u**3 + 21*u**2 - u - 5. What is -p(i) - 6*z(i)?
55*i**3 - 15*i**2 + i - 1
Let a(k) = 2*k + 9. Let p(j) = -7*j - 30. Let g(m) = -4*a(m) - p(m). Let l(z) = -5. Calculate 4*g(t) - 5*l(t).
-4*t + 1
Let y(x) = x**3 - 17*x**2 - 2. Suppose 346 = 6*t + 334. Let z(w) = -w**3 + w**2 + 1. Calculate t*z(v) + y(v).
-v**3 - 15*v**2
Let z(a) = 31*a**3 - 3*a**2 - 8*a + 11. Let k(i) = -3*i**3 + i**2 + 2*i. Determine -3*k(g) - z(g).
-22*g**3 + 2*g - 11
Let u(p) = 2*p + 432. Let c(f) = -3*f - 835. Determine -4*c(g) - 7*u(g).
-2*g + 316
Let f(z) = 48685*z**2 - 130*z + 130. Let k(p) = 3043*p**2 - 8*p + 8. Calculate 4*f(c) - 65*k(c).
-3055*c**2
Let q(v) = -4*v**2 + v + 5. Let t(w) = -19*w**2 + 5*w - 572. What is -5*q(o) + t(o)?
o**2 - 597
Let j(z) be the third derivative of 0*z - 112*z**2 - 1/6*z**3 + 0 + 7/24*z**4. Let v = 2 - 1. Let l(f) = -f. What is v*j(c) + 4*l(c)?
3*c - 1
Let x be (-2*10/20)/((-5)/(-30)). Let d(t) = -2*t. Let y(m) = 45*m. Give x*y(w) - 130*d(w).
-10*w
Let w(c) = -417*c**3 + 20*c**2 + 2*c + 2. Let t(p) = -260625*p**3 + 12510*p**2 + 1251*p + 1251. Determine -2*t(l) + 1251*w(l).
-417*l**3
Let g(s) = 3*s + 4652. Let v(q) = 13*q + 18602. Calculate -9*g(p) + 2*v(p).
-p - 4664
Let o(q) = -9*q**2 + 4*q + 815. Let t(d) = d**2 - d + 1. Calculate o(u) + 6*t(u).
-3*u**2 - 2*u + 821
Let k(f) = f. Let g(a) = a**2 + 1. Suppose -w + 75 - 70 = 0, 20 = 5*c + 3*w. Determine c*g(r) - 2*k(r).
r**2 - 2*r + 1
Let t(a) = 21*a**2 - 5*a. Let s(c) = 3*c**2 + 9*c - 4. Let j(v) = 4*v**2 + 11*v - 5. Let w(n) = 4*j(n) - 5*s(n). Give t(f) - 5*w(f).
16*f**2
Let q(j) be the first derivative of 73*j**3 - 4*j**2 + 1662. Let c(v) = 73*v**2 - 3*v. Determine -8*c(z) + 3*q(z).
73*z**2
Let z(a) = -9*a**2 + 515*a. Let m(p) = -p**2 + p. Give 10*m(c) - z(c).
-c**2 - 505*c
Let c = 219 + -214. Let x(s) = 2*s + 1 - c*s + 0*s + 5*s. Let o(i) = 2*i + 1. Suppose -3*y - y = 16. Calculate y*o(q) + 5*x(q).
2*q + 1
Let t(i) = 0*i - 6 + i + 5. Let u(p) = 5*p + 2. Let a(g) = 3*t(g) - u(g). Let h(b) = 1 + 9 - 5*b + 1 + 7 - 13 - 16. Calculate -7*a(r) + 3*h(r).
-r + 2
Let u(i) = 2*i - 11. Let f(z) = -z + 5. Let x(g) = -14*f(g) - 6*u(g). Let r(k) = 5*k - 9. Suppose 261*n - 2419 = -592. What is n*x(h) - 3*r(h)?
-h - 1
Let w(h) be the third derivative of 5*h**4/4 + 7*h**3/2 + 18*h**2 - 14*h - 3. Let m(k) = 3*k + 2. Let b = -6 - -10. Calculate b*w(y) - 42*m(y).
-6*y
Suppose 118*u - 8 = 122*u. Let o(p) = 4*p**2 - p - 9*p**3 - 4*p + 12*p**3 + 3*p - 5*p**2. Let s(h) = 7*h**3 - 3*h**2 - 5*h. Determine u*s(t) + 5*o(t).
t**3 + t**2
Let h(n) = -114*n**2 + 19*n - 24. Let x(g) = -g**2 + g - 2. Calculate h(v) - 11*x(v).
-103*v**2 + 8*v - 2
Let s(m) = -62*m**2 - 2*m - 1889. Let l(q) = -30*q**2 - q - 1. Give 2*l(t) - s(t).
2*t**2 + 1887
Suppose -16*m + 43 = -21. Let s(q) = m*q - 117181*q**2 + 6 - q**3 + 117181*q**2. Let f(x) = -2*x**3 + 11*x + 17. Determine -6*f(p) + 17*s(p).
-5*p**3 + 2*p
Let j(k) = 29625*k + 266. Let x(r) = 9875*r + 94. What is -6*j(w) + 17*x(w)?
-9875*w + 2
Let g(q) = q**3 - 4*q**2. Let j = 212 - 212. Suppose 3*b + b - 16 = j. Let h(f) = -5*f**2. Determine b*h(a) - 5*g(a).
-5*a**3
Let c(s) = -4215*s + 126. Let x(o) = 1405*o - 36. Determine 4*c(n) + 14*x(n).
2810*n
Let y(l) = 5554*l**2 - 5555*l**2 - 3*l - 1 + 2*l. Let r(j) = 5*j**2 - j - 3. What is r(b) - y(b)?
6*b**2 - 2
Let i(t) = 133*t - 56. Let n(m) = -200*m - 5 - 205*m - 207*m + 624*m. Suppose 6 + 34 = -8*k. Calculate k*i(g) + 56*n(g).
7*g
Let b(q) = -2494*q - 84. Let x(z) = -500*z - 15. Calculate 2*b(o) - 11*x(o).
512*o - 3
Let s(u) = 4953*u**3 + 48*u**2 - 25*u + 16. Let r(d) = -1651*d**3 - 15*d**2 + 8*d - 5. Determine 16*r(a) + 5*s(a).
-1651*a**3 + 3*a
Let l(i) = -8*i**2 + 22*i + 5. Let g(k) be the second derivative of 7*k**4/12 - 7*k**3/2 - 2*k**2 + 128*k - 5. Determine -5*g(r) - 4*l(r).
-3*r**2 + 17*r
Let f(j) = -5*j**2 - 8*j - 248. Let m(s) = 13*s**2 + 23*s + 744. Calculate -11*f(o) - 4*m(o).
3*o**2 - 4*o - 248
Let g(q) = -9*q + 3. Let l(p) = -44*p - 16. What is 10*g(u) - 2*l(u)?
-2*u + 62
Let b(h) = 36*h + 91. Let i(q) = 29*q + 90. Determine -3*b(z) + 4*i(z).
8*z + 87
Let i(y) = 2163*y**3 - 189*y**2 + 189*y - 189. Let n(d) be the first derivative of 23*d**4/4 - 2*d**3/3 + d**2 - 2*d - 5458. What is -4*i(h) + 378*n(h)?
42*h**3
Let c(l) = -14*l**3 + 3*l**2 - 3*l + 2. Let a(q) = 2 - 28 - 50 + 10*q - 8*q**2 + 70 - 2*q + 41*q**3. Calculate 3*a(z) + 8*c(z).
11*z**3 - 2
Let n(u) = 18*u**2 - 9*u + 9. Suppose -2*s + 16 = -2*y + 8, -4*s - 4*y + 8 = 0. Let t(h) = -3*h + 2 + s + 11*h**2 - h - 2*h**2 - h. What is -5*n(z) + 9*t(z)?
-9*z**2
Let j be (10/9)/(11/495). Let l(i) = j*i + 2 + 47*i - 7 - 99*i. Let g(k) = -4*k - 10. What is -3*g(d) + 5*l(d)?
2*d + 5
Let m(n) = 7*n + 405. Let h(k) = -19*k - 1211. What is 4*h(b) + 11*m(b)?
b - 389
Let i(z) = -5*z**2 - 26*z - 600. Let p(l) = 6*l**2 + 34*l + 601. Determine 4*i(a) + 3*p(a).
-2*a**2 - 2*a - 597
Let o(y) = 17790*y**3 + 36*y**2 - 18*y + 9. Let x(s) = -4447*s**3 - 8*s**2 + 4*s - 2. What is -4*o(r) - 18*x(r)?
8886*r**3
Let d(n) = -3*n**2 + 9. Let k(b) = b**2 - 5. Let h(j) = -4*j - 80. Let o be h(-20). Suppose 2*y + y = o, -4*y + 8 = -2*t. What is t*d(w) - 7*k(w)?
5*w**2 - 1
Let k(t) = t**3 + 12*t**2 - t - 5. Let r be k(-12). Let s be 1/(2 + r/(-3)). Suppose -9*x + 10 = -26. Let w(d) = 4*d. Let p(f) = 4*f. Give s*w(a) + x*p(a).
4*a
Let s(k) = -4*k + 2. Let x(y) = -7774*y + 4186. Calculate 8372*s(v) - 4*x(v).
-2392*v
Let h be -51*3*(-9)/27. Let c be ((-1)/3)/(1/h). Let i be (10/15)/((-1)/(-9)). Let l(t) = -8*t**2 - 7*t. Let y(w) = -23*w**2 - 20*w. Determine c*l(k) + i*y(k).
-2*k**2 - k
Let x(p) = 9*p**3 - 19*p**2 + 4*p - 24. Let o(y) = -2*y**3 - y**2 - y. Give 4*o(v) + x(v).
v**3 - 23*v**2 - 24
Let h(y) = 23*y - 1553. Let k(o) = -21*o + 1. Give h(s) + k(s).
2*s - 1552
Let t(a) = -13873*a + 8. Let w(f) = 13882*f - 12. Determine -3*t(z) - 2*w(z).
13855*z
Let t(a) = 74*a**2 - 3*a + 13. Let f(k) = 36*k**2 - k + 6. Give -13*f(x) + 6*t(x).
-24*x**2 - 5*x
Let k(o) be the first derivative of -14*o**3/3 - o**2 + o - 8841. Let m(v) = -13*v**2 - 2*v. What is -2*k(a) + 3*m(a)?
-11*a**2 - 2*a - 2
Let x(t) = 14*t**2 + 6*t - 2. Let w(q) = -q**2 - q + 1. Let d(a) = -9*a**2 - 11*a + 10. Let s(k) = d(k) - 10*w(k). Give 5*s(j) + x(j).
19*j**2 + j - 2
Let i(q) = -q**2 - 2. Let y be i(0). Let a = 353 + -348. Let u(v) = v**3 + 2*v + 1. Let h(c) = c. Calculate a*h(s) + y*u(s).
-2*s**3 + s - 2
Let x(t) = -1589*t - 60. Let l(a) = -9534*a - 350. Give 6*l(w) - 35*x(w).
-1589*w
Let j(w) = -11*w**2 - 43*w - 8. Let h(x) = 9*x**2 + 38*x + 8. Calculate -7*h(m) - 6*j(m).
3*m**2 - 8*m - 8
Let b(x) = -6*x**3 - 198*x**2 + 18*x + 2. Let p(r) = -20*r**3 - 594*r**2 + 63*r + 7. Determine -7*b(z) + 2*p(z).
2*z**3 + 198*z**2
Let b be 22/(-4) + (-2)/(-4). Suppose -18*x - 757 = 686 - 1515. Let y(k) = k**2 + 8*k + 5. Let c(p) = p**2 + 7*p + 4. Determine b*c(w) + x*y(w).
-w**2 - 3*w
Let z(d) = 17*d**3 - 20*d**2 - 6*d + 11. Let u(x) = 6*x**3 - 7*x**2 - 2*x + 4. Suppose -129*m = 135*m - 295*m + 93. Determine m*z(g) - 8*u(g).
3*g**3 - 4*g**2 - 2*g + 1
Let u(n) = -370*n - 2715. Let s(q) = -83*q - 678. Determine -9*s(y) + 2*u(y).
7*y + 672
Let u = 5268 - 5272. Let w(n) = -1. Let h(l) = 5*l + 5. What is u*w(p) - h(p)?
-5*p - 1
Let g(k) = 733*k**3 - k**2 + 2*k - 8. Let f(n) = -2932*n**3 + 4*n**2 - 8*n + 36. Determine -2*f(r) - 9*g(r).
-733*r**3 + r**2 - 2*r
Let c(z) = 14*z**3 - 9*z**2 - 2*z + 8. Let y(g) = g**3 - g**2 + 2. Calculate -c(u) + 7*y(u).
-7*u**3 + 2*u** |
Wal-Mart Steels Itself for Black Friday Labor Showdown
If you're going to a Walmart on Black Friday to score a cheap TV, the drama unfolding in the parking lot could be bigger than what you'll eventually watch on the screen.
The nation's largest retailer and a consortium of workers' rights groups have traded jabs after Wal-Mart responded to threats of Black Friday walkouts and protests at 1,000 stores across the country by Organization United for Respect at Walmart (OUR Walmart).
Wal-Mart filed an unfair labor practice suit against the United Food and Commercial Workers union with the National Labor Relations Board last week asking the NLRB to stop the protests, which the retailer claims are an attempt to disrupt its business. OUR Walmart claims the union doesn't control it, however, even though the two organizations have ties.
But Black Friday shoppers can probably expect labor actions to be a minor annoyance, at most. While 1,000 protest events sounds like a lot, Wal-Mart has 4,500 stores in the U.S. In an email to NBC News, company spokesman David Tovar characterized participants as "a handful of associates, at a handful of stores scattered across the country."
Rashid Robinson, executive director of advocacy group ColorOfChange, which is working with OUR Walmart, said people shopping at those 1,000 stores would notice a difference. "I think we're going to see a strong turnout. ... I expect the lines to be longer, I expect things to be much slower," Robinson said.
UFCW spokeswoman Moira Bulloch called the organized actions "very much unprecedented" and said shoppers at some stores could see workers walking out or protesting.
The response from the investor community was more of a shrug. "I think it'll be a non-event," said Budd Bugatch, analyst with Raymond James & Associates. "I don't see this as something we in the investment community will ever make a big deal of."
Rob Wilson, analyst at Tiburon Research Group, said he thinks the work actions are being driven more by an effort to unionize than to improve working conditions, which is similar to what Wal-Mart alleges in its NLRB suit.
Bulloch disputes this, as does Mary Pat Tifft, a leader with OUR Walmart. "The UFCW has no ownership, equity or other controlling interest in OUR Walmart," she said via email.
Although the impending courtroom clash won't take place until well after Black Friday, one labor expert said the retailer's response shows that it's taking the threat of a Black Friday showdown seriously.
"The fact that Wal-Mart is responding to this shows that they share the perception that this is not good for them," said Paul Osterman, professor of human resources and management at the Massachusetts Institute of Technology and author of "Good Jobs America: Making Work Better for Everyone."
Osterman agreed that there's unlikely to be any damage to Wal-Mart's earnings, even if walkouts and protests go as activists plan. "It's not just a question of how today's shopper feels," he said. "People will still shop there."
"The real impact is what it adds up to is Wal-Mart's public perception and how that reverberates in a variety of ways," he said. Labor regulators could scrutinize allegations of misdeeds more carefully, and local politicians could make it difficult for the retailer to open new stores in their jurisdictions, especially in urban areas where Wal-Mart historically has not had as much penetration.
"That said, if this becomes a material issue [and] enough workers actually walk out, I think the walk out could have huge ramifications for the company and the industry in general," Wilson said.
Although the pushback of Black Friday into Thanksgiving night has been embraced by mass-market retailers of all types, he said a worker revolt significant enough to disrupt business could give them pause. "It may force the retail sector to re-think their Black Friday/Thanksgiving openings." |
Following breaking news at a Massachusetts new DNA tests have confirmed the link between the last Boston strangler victim and the man who once confessed to the killings. Prosecutors say a familial match connects Albert Desalvo. To the murder of nineteen year old Mary Sullivan in January of 1964. Desalvo confessed to being the Boston strangler but he later recanted. He was killed in prison in 1973. To sell those remains will now be exhumed and tested to get an exact match.
This transcript has been automatically generated and may not be 100% accurate.
{"id":19641951,"title":"Boston Strangler Case Solved After 50 Years","duration":"0:26","description":"Authorities say DNA found on the last victim's body is a 99.9 percent match to Albert DeSalvo.","section":"US","mediaType":"Default"} |
A multifaceted analysis of viperid snake venoms by two-dimensional gel electrophoresis: an approach to understanding venom proteomics.
The complexity of Viperid venoms has long been appreciated by investigators in the fields of toxinology and medicine. However, it is only recently that the depth of that complexity has become somewhat quantitatively and qualitatively appreciated. With the resurgence of two-dimensional gel electrophoresis (2-DE) and the advances in mass spectrometry virtually all venom components can be visualized and identified given sufficient effort and resources. Here we present the use of 2-DE for examining venom complexity as well as demonstrating interesting approaches to selectively delineate subpopulations of venom proteins based on particular characteristics of the proteins such as antibody cross-reactivity or enzymatic activities. 2-DE comparisons between venoms from different species of the same genus (Bothrops) of snake clearly demonstrated both the similarity as well as the apparent diversity among these venoms. Using liquid chromatography/tandem mass spectrometry we were able to identify regions of the two-dimensional gels from each venom in which certain classes of proteins were found. 2-DE was also used to compare venoms from Crotalus atrox and Bothrops jararaca. For these venoms a variety of staining/detection protocols was utilized to compare and contrast the venoms. Specifically, we used various stains to visualize subpopulations of the venom proteomes of these snakes, including Coomassie, Silver, Sypro Ruby and Pro-Q-Emerald. Using specific antibodies in Western blot analyses of 2-DE of the venoms we have examined subpopulations of proteins in these venoms including the serine proteinase proteome, the metalloproteinase proteome, and the phospholipases A2 proteome. A functional assessment of the gelatinolytic activity of these venoms was also performed by zymography. These approaches have given rise to a more thorough understanding of venom complexity and the toxins comprising these venoms and provide insights to investigators who wish to focus on these venom subpopulations of proteins in future studies. |
Prison smokes ban ruled unlawful
Corrections Minister says it has been a great success and the Government will change the law if it has to.
Taylor, who is in Auckland Prison, took his case to the High Court claiming the prison manager had no power to impose a total smoking ban. Photo / Paul Escourt
A judge has ruled a prison smoking ban is unlawful - a victory for career criminal Arthur Taylor, who challenged it in court.
But Corrections says inmates will still not be allowed to smoke and the Government says it will change the law if it has to.
Taylor, who is in Auckland Prison, took his case to the High Court at Auckland claiming the prison manager had no power under the Corrections Act to impose a total smoking ban, and, even if he did have the authority, had not used his discretion and implemented the smoke-free ban under direction from the chief executive.
Late last week Justice Murray Gilbert ruled that the ban, which has been in place for 17 months, was "unlawful, invalid and of no effect".
Corrections has yet to decide if it will appeal, but conceded that implementing the policy was a "serious challenge".
However, despite the ruling, prisoners still cannot smoke because the Government amended Corrections regulations to make tobacco and related products contraband and the court ruling was not about those amended regulations.
Corrections Minister Anne Tolley said: "The smoking ban in prisons has been a great success and there is no way we are backing away from it. Prisons are safer and healthier places for staff and offenders, and if we need to change the law to maintain this then that is what we will do."
Justice Gilbert said a blanket smoking ban did not serve the purpose of ensuring custodial sentences were safe, secure, humane and effective, and was not "reasonably necessary" to maintain safety of prison staff and inmates.
"In my view, the ban falls outside the scope of the rule-making power under section 33 of the Corrections Act." He added it was inconsistent with other laws.
The judge said it was well established in common law that prisoners retained all civil rights, unless removed by law, so the presumptive starting point was that they had the same rights as other citizens to smoke in their own home.
"The prison cell is the institutional equivalent of a prisoner's home."
The general manager of prison services, Dr Brendan Anstiss, said smoking had been very common before the ban and had contributed to poor health for staff and prisoners, whether they were smokers or not.
"There were a substantial number of incidents involving prisoners using lighters or matches to start fires, trigger smoke detectors, smoke illicit drugs, and make weapons."
Dr Anstiss called it "a courageous decision" and said Corrections "remained passionate in our belief that we could change lives". |
Other project properties
Description
This module scans an incoming stream of rs232 serial characters. It constantly looks for a new character, which it detects by seeing the "start" bit. When a condition resembling a start bit is detected, the module then begins a measurement window, to try and determine the BAUD rate of the incoming character. Since many different characters have different bit transitions because of their different data content, this module actually only "targets" a single character -- in this case the "carriage return" character (0x0d). How can it tell if the character is the carriage return?
Well, once it finishes the measurement interval (first 2 bits of the received character) then it uses the measurement to produce a BAUD rate clock. The module uses this BAUD rate clock internally to verify the remaining 8 bits in the serial character (total of 10 bits per received character, including start/stop bits. Parity is supported, but has never been tested.)
If the remainder of the character verifies correctly to be a carriage return character, the measurement is accepted as valid, and the module then produces the BAUD rate clock externally, and flags that it has "locked" onto the BAUD rate of the incoming characters.
There are two versions of this module: One for a single lock at the beginning of the session, which is then maintained for the entire duration of the session (this one is called "auto_baud.v"). And another version constantly tracks the incoming characters, which allows for changes in the clock rate and/or BAUD rate of incoming characters to happen at any time, and the BAUD rate will adjust as soon as the carriage return character is detected (this one is called "auto_baud_with_tracking.v") Because of the extra logic needed to produce a BAUD rate while checking a possible new BAUD rate at the same time, the tracking version is slightly larger than the "single lock" version, and it will work with faster clock speeds.
The auto_baud generator is intended for use in "human interface" rs232 serial applications. It has also been tested with "text file transfer" in hyperterm and SecureCRT terminal programs, to see if it would function during higher speed character transfer, and it worked just fine.
Features
- Tested in Xilinx XC2V200 hardware, no simulation available.
- Test results, and documentation given in code header comments.
- A PC using "hyperterm" and "SecureCRT" was used for testing.
- "auto_baud.v" consumes 59 slices and works up to 87 MHz (no constraints.)
- "auto_baud_with_tracking.v" consumes 93 slices, operates up to 102 MHz (no constraints.)
- Code is written in Verilog and VHDL. Both versions have been tested.
- Default parameter settings work from 300 BAUD up to 115200 BAUD with any FPGA board clock between 30 MHz and 100 MHz.
- Clock speeds lower than 30 MHz support lower BAUD rates, like 9600. See code for details.
- The new VHDL version is a package file in the SVN repository trunk.
- Fully parameterized module.
- Will operate just fine with "non standard" BAUD rates -- such as MIDI (musical instrument digital interface.) No calculations required.
- Works with "rs232_syscon" for an easier bring up of debugging sessions. |
[Possibilities for optimizing therapy with theophylline preparations. Clinical effectiveness and side effects of microcrystalline theophylline].
The efficacy of microcrystalline theophylline is examined in patients with stabilized bronchial asthma. Beside the concentration of theophylline in the serum are estimated: the changes of subjective state of health, the consumption of beta2-stimulants, VC and FEV1. Although in 8 of 10 patients the theophylline concentration in the serum was below the therapeutical range for a considerable period of time, an improvement of the subjectively estimated state of health, a diminished consumption of beta2-stimulants and an increasing VC and FEV1 are evident after 6-7 days, also statistically confirmed. Proposals are suggested for using all possibilities for an improved therapy with theophylline. |
200 Ill. App.3d 1000 (1990)
558 N.E.2d 596
KENNETH S. HARTBARGER, Plaintiff-Appellee,
v.
SCA SERVICES, INC., Defendant-Appellant.
No. 5-88-0675.
Illinois Appellate Court Fifth District.
Opinion filed July 25, 1990.
*1001 *1002 *1003 *1004 Robert L. Jackstadt, of Peper, Martin, Jensen, Maichel & Hetlage, of Wood River, for appellant.
Floyd D. Peterson, Jr., of Law Offices of William W. Schooley, of Granite City, for appellee.
Judgment affirmed.
JUSTICE GOLDENHERSH delivered the opinion of the court:
Defendant, SCA Services, Inc., appeals from a judgment of the circuit court of Madison County entered after a jury verdict in favor of plaintiff, Kenneth S. Hartbarger, in the amount of $225,000 for the breach of an oral contract. In this cause, defendant raises the following issues: (1) whether the parol evidence rule and collateral contract doctrine bar plaintiff's oral contract claim; (2) whether sufficient independent consideration, definiteness, or certainty existed to support the separate oral contract; (3) whether the trial court improperly instructed the jury by giving plaintiff's instructions numbers 10 and 11; (4) whether the Statute of Frauds (Ill. Rev. Stat. 1979, ch. 59, par. 1 et seq.) barred plaintiff's oral contract claim; and (5) whether the verdict is supported by the evidence. This court affirms.
Plaintiff originally owned a landfill near Granite City. In 1971, plaintiff and his partner sold the landfill to defendant, a Delaware corporation involved in the waste hauling and disposal business. Plaintiff later took a position with defendant and eventually became a vice-president and central division manager for defendant, controlling defendant's operations in 30 States at a salary of $87,500 per year. His employment contract with defendant provided for an annual bonus of one-half his salary and severance pay of one-half his salary if plaintiff were ever terminated. Plaintiff was involved in an automobile accident in August 1979, in which he sustained physical injuries as well as memory loss. This accident was in no way related to his employment with defendant. Plaintiff eventually went back to work for defendant on October 10, 1979, but was terminated in January 1980.
Plaintiff and representatives of defendant had a meeting in Boston on February 19, 1980, concerning plaintiff's termination. Defendant's chairman of the board had given attorney Robert Popeo full authority to negotiate a deal on behalf of defendant. Plaintiff and defendant attempted to work out an agreement which would compensate plaintiff, as well as protect defendant from any competition with plaintiff. The parties were able to reach an agreement in principle, *1005 but many items and terms were left open. No final agreement was reached at this time, and no papers were signed. A written agreement was not signed until September 24, 1980. In the interim, several meetings occurred and several promises were made. During the time between the parties' first meeting on February 19, 1980, and the signing of a termination agreement on September 24, 1980, plaintiff became involved in a number of ventures in the landfill business that were in direct competition with defendant. These acquisitions occurred after March 27, 1980, when plaintiff's attorney, John Farrell, sent a letter to defendant's attorney, Popeo, indicating that because no written agreement had been sent to plaintiff by defendant, and since no payments to plaintiff had been made, the settlement talks were withdrawn. On April 25, 1980, Farrell sent another letter to Popeo renewing the settlement talks. Another meeting was held on September 10, 1980, to work out a final agreement. Plaintiff, his two attorneys, Farrell and Thomas Long, and defendant's attorney, Popeo, attended this meeting. Popeo learned that plaintiff had acquired seven additional companies since the parties' original meeting in February 1980. Plaintiff explained to Popeo that he had acquired a substantial amount of debt by starting these companies. In addition to the terms that had been discussed at the original meeting, i.e., severance pay, bonus, health insurance, plaintiff asked for an additional $150,000 to $200,000 for his newly acquired businesses. According to attorney Long, discussions took place as to the allocation of this $150,000 to $200,000 among three of plaintiff's businesses on which defendant had options to purchase. These three businesses were known as the Trusik accounts, the Wagner landfill, and a hazardous material site referred to as "Hazmat." All parties agreed that no final agreement was made at this meeting. Popeo testified that he made no representations to plaintiff or plaintiff's attorneys about any additional compensation for the Trusik, Wagner, or Hazmat transactions.
The final meeting took place in St. Louis at plaintiff's attorneys' office. In attendance were plaintiff, his wife, Gaynell, plaintiff's attorneys, Long and Farrell, and defendant's representative, Popeo. At this meeting, defendant tendered a check through Popeo to plaintiff and his wife for $228,000. This check represented payment for 130 acres of land in Wilsonville, Illinois, and was made payable to the Richtone Corporation, a corporation held in trust and controlled by plaintiff. The termination agreement indicated that the $228,000 was allocated for real estate only. According to plaintiff and his attorneys, plaintiff then told Popeo that he would not sign any agreements unless he was paid an additional $200,000. According to plaintiff, Popeo *1006 then made a phone call after which he counteroffered a figure of $175,000. Plaintiff testified that he insisted he must receive $200,000, and Popeo finally agreed on behalf of defendant. Plaintiff and his attorneys, Long and Farrell, testified that Popeo suggested that the $200,000 be distributed in three separate transactions. This manner was suggested because Popeo had authority to approve transactions under $100,000 without approval from defendant's board of directors. The termination agreement included an option agreement for defendant to buy the three previously mentioned properties of plaintiff the Trusik accounts, the Wagner landfill, and the Hazmat site. The option agreement signed by the parties states, in pertinent part:
"2. Global hereby grants to SCA the option to acquire from Global the Trusik Business, other than the trucks and equipment listed on Schedule A attached hereto, for a price of Seventy Thousand Dollars ($70,000) to be paid in the same manner as Global is paying for its acquisition of the Trusik Business. Global represents and warrants that it is the owner of the Trusik Business, which consists primarily of certain contracts and accounts, free and clear of all claims, liens and encumbrances and has full right to convey the same to SCA.
3. Global hereby grants to SCA the option to acquire from Global the Wagner Business for the price to be paid therefor by Global, which price shall be payable in the same manner as payments are to be made to Wagner by Global under the Wagner Business Agreement. Global represents and warrants that upon closing under the Wagner Business Agreement, it will be the owner of the Wagner Business, which consists of certain equipment, contracts and accounts, free and clear of all claims, liens and encumbrances, except as set forth in the Wagner Business Agreement, and will have full right to convey the same to SCA.
4. Global hereby grants to SCA the option to acquire from Global the Wagner Landfill for the price to be paid therefor by Global, which price shall be payable in the same manner as payments are to be made to Wagner by Global under the Wagner Landfill Agreement. Global represents and warrants that upon closing under the Wagner Landfill Agreement it will be the owner of the Wagner Landfill free and clear of all claims, liens and encumbrances, except as set forth in the Wagner Landfill Agreement, and will have full right to convey the same to SCA.
5. Global hereby grants to SCA the option to acquire from *1007 Global the Hazmat site and license for the price and on the terms under which Global may acquire the Hazmat site and license under the Hazmat option. Global represents and warrants that, upon the grant and exercise of the Hazmat option, it will be the owner of the Hazmat site and license, free and clear of all claims, liens and encumbrances and will have the full right to convey the same to SCA."
The additional $200,000 was to be distributed in the following manner: (1) $25,000 would be added to the written purchase price of $70,000 defendant had agreed to pay for the Trusik accounts; (2) $75,000 would be added to the purchase price of the Wagner landfill; and (3) $100,000 would be added to the purchase price of the Hazmat site. Plaintiff testified that he signed the termination and option agreements only because of Popeo's promise to pay him an additional $200,000, which he felt would adequately compensate him for debts he had incurred by acquiring landfill businesses in direct competition with plaintiff during the interim between the first meeting and the parties' final meeting. These businesses are collectively referred to as the Global Waste Services accounts. Popeo denies making promises for any additional compensation.
The termination agreement also provided for a no-competition clause. By signing the agreement, plaintiff agreed not to compete with defendant for a period of two years. Paragraph 1 of the termination agreement also provided:
"Hartbarger acknowledges receipt of payment in full of all salary, termination pay, and other compensation and benefits due to him as an employee of SCA, and agrees that he is not entitled to any further salary, termination pay, retirement or pension benefits or other compensation or benefits of any nature with respect to his employment by SCA or the termination thereof * * *."
Paragraph 12 also provided:
"This Agreement constitutes the entire agreement and understanding between the parties in relation to the subject matter hereof and there are no promises, representations, conditions, provisions or terms related thereto other than those set forth in this Agreement."
As per the option agreement, defendant purchased the Trusik accounts from Global Waste Services of St. Louis, a corporation held by plaintiff, but for a higher price than appeared in the option agreement. Plaintiff received two checks from defendant in the amounts of $86,271.51 and $8,728.49, respectively, for a total of $95,000. Popeo *1008 testified that defendant believed the Trusik accounts were worth $140,000, and, thus, defendant had made a good business decision to purchase the Trusik accounts for $95,000. The options on the Wagner landfill and the Hazmat site were never exercised.
On January 24, 1983, plaintiff and Global Waste Services of St. Louis, Inc., filed a nine-count complaint against defendant. Counts I, IV and VII pleaded a cause of action under the Illinois Antitrust Act (Ill. Rev. Stat. 1979, ch. 38, par. 60-7). Counts II, V and VIII alleged breach of an oral contract by defendant. Counts III, VI and IX pleaded a cause of action for unjust enrichment. Before trial, on March 2, 1984, the trial court dismissed counts VII, VIII and IX. At the close of plaintiff's evidence, the trial court directed a verdict in favor of defendant on the antitrust and unjust enrichment causes of action contained in counts I, III, IV and VI. At the close of all the evidence, the trial court directed a verdict in favor of defendant on count V. The remaining issue was plaintiff's oral contract claim against defendant found in count II. The jury found in favor of plaintiff for $225,000.
The first issue we are asked to consider is whether the parol evidence rule and the collateral contract doctrine bar plaintiff's oral contract claim. Defendant argues the termination agreement referred to the Trusik, Wagner, and Hazmat transactions and plaintiff should not be allowed to circumvent the parol evidence and collateral contract doctrines by alleging a separate oral contract. Defendant further argues that the written termination agreement between the parties explicitly provided that the agreement contained the entire understanding between them and superseded all previous agreements; therefore, no extrinsic evidence should have been considered or introduced construing the termination agreement. For these reasons, defendant contends that the trial court erred in denying its motion for summary judgment, directed verdict, and judgment notwithstanding the verdict. Plaintiff replies that the parol evidence rule does not bar evidence of the separate oral contract in the instant case since, first, the parol evidence rule does not apply to nonintegrated agreements. Plaintiff contends that the contracts in this case are nonintegrated; the option agreement, for example, provided that defendant could purchase the Trusik accounts for $70,000, but defendant actually paid $95,000. The contracts, therefore, are not integrated since they do not contain the final agreement between the parties. Second, plaintiff contends that the parol evidence rule is not a bar to evidence of the oral contract because plaintiff did not seek to vary any terms of the termination agreement and the terms of the oral contract are not inconsistent *1009 with the termination agreement. We agree.
1, 2 Under the parol evidence rule, if an instrument appears complete, certain, and unambiguous, then parol evidence of a prior or contemporaneous agreement is inadmissible to vary the terms of the instrument. (Chicago White Metal Casting, Inc. v. Treiber (1987), 162 Ill. App.3d 562, 569, 517 N.E.2d 7, 12.) However, whether a written contract was intended to be the complete and final agreement must be determined from the language of the contract and the circumstances of the case. (Bleck v. Stepanich (1978), 64 Ill. App.3d 436, 439, 381 N.E.2d 363, 366.) Whether an oral contract exists, its terms and conditions, and the intent of the parties are questions of fact to be determined by the trier of fact, in this case, the jury. (Howard A. Koop & Associates v. KPK Corp. (1983), 119 Ill. App.3d 391, 400, 457 N.E.2d 66, 73.) This determination should not be reversed unless it is contrary to the manifest weight of the evidence. 119 Ill. App.3d at 400, 457 N.E.2d at 73.
3 Defendant contends that we may only consider the four corners of the written agreement; however, we find that we must look to the totality of the circumstances. The negotiations between the parties went on for an extended period of time, undeniably caused by delays of defendant. While defendant originally sought to keep plaintiff from competing against defendant in the landfill and waste management business, delays caused by defendant prompted plaintiff to acquire at least seven other waste management businesses between the parties' first meeting on February 19, 1980, and their final meeting on September 24, 1980. For simplicity's sake, these businesses were merged into the Global Waste Services accounts. It is undisputed that the parties signed an option agreement for the Trusik accounts, the Wagner landfill, and the Hazmat site. The written option agreement provided for a purchase price of $70,000 for the Trusik accounts, but failed to provide for price terms on the Wagner and Hazmat options. Defendant actually paid a total of $95,000 for the Trusik accounts. Defendant contends that it agreed to pay $25,000 more than the option provided only because more equipment was added to the transaction and because, overall, $95,000 was a good business deal. Plaintiff, on the other hand, testified that the additional $25,000 was paid because attorney Popeo, on behalf of defendant, had agreed to pay plaintiff an additional $200,000 to fairly compensate plaintiff for the Global Waste Services accounts and for his promise not to compete against defendant. The $200,000 was to be paid in three separate transactions, the first being an additional $25,000 for the Trusik accounts. Plaintiff contends the reason the parties agreed on three separate *1010 transactions was because if the transaction was for $100,000 or less, Popeo could complete the transaction without approval by the defendant's board of directors. Plaintiff's attorneys, Long and Farrell, gave virtually the same testimony as plaintiff concerning the additional $200,000. In our opinion, the jury could reasonably find that the payment of $95,000 for the Trusik accounts, originally priced at $70,000, signified that there was a separate, oral contract between the parties, and, therefore, the termination agreement was not the final, integrated agreement between the parties. We cannot say that this finding is against the manifest weight of the evidence.
Defendant further contends that because the written termination agreement between the parties explicitly stated that the agreement contained the entire understanding between the parties and superseded all previous agreements, no evidence should have been considered or introduced construing the termination agreement. We must, however, consider this integration clause in context. Paragraph 1 of the termination agreement provides, in pertinent part:
"Hartbarger's employment by SCA is terminated as of the close of business on May 31, 1980. Hartbarger acknowledges receipt of payment in full of all salary, termination pay, and other compensation and benefits due to him as an employee of SCA, and agrees that he is not entitled to any further salary, termination pay, retirement or pension benefits or other compensation or benefits of any nature with respect to his employment by SCA or the termination thereof * * *."
Paragraph 12 then provides:
"This Agreement constitutes the entire agreement and understanding between the parties in relation to the subject matter hereof and there are no promises, representations, conditions, provisions or terms related thereto other than those set forth in this Agreement. This Agreement supersedes all previous understandings, agreements and representations between SCA and Hartbarger regarding the employment of Hartbarger by SCA and the termination of such employment, written or oral."
Taken in proper context, we agree with plaintiff that these clauses refer solely to compensation and benefits due plaintiff as an employee of defendant. The previously cited paragraphs do not refer to plaintiff's business acquisitions made between the time of the first meeting between the parties and their final meeting. The $200,000 did not attempt to vary the terms of the termination agreement between the parties. Rather, the $200,000 would adequately compensate plaintiff for his recently acquired businesses which he would be unable to be *1011 involved in under the terms of the noncompetition clause.
Defendant argues that the parol evidence rule bars evidence of an oral contract made contemporaneously with a written contract and cites the case of Roth v. Meeker (1979), 72 Ill. App.3d 66, 389 N.E.2d 1248. In that case, suit was brought to recover damages to the plaintiffs' pure-bred cattle-breeding operation allegedly resulting from the defendant's refusal to vacate possession of premises leased to the plaintiffs from the purchaser of the defendant's land. The defendant attempted to testify that he entered into an oral contract with the purchaser of his land to retain possession of certain lots around the farm buildings. The court held that the parol evidence rule barred this testimony, since it would have been normal for the parties to the written contract to have incorporated the oral contract subject matter in any prior or contemporaneous agreement.
We, however, find the Roth case distinguishable from the instant case. In Roth, the written contract provided for possession of the 364 acres of land sold to vest in the purchaser as of the date of the contract, April 9, 1976, with an exception for the dwelling house located on the farm. Possession of the home was to be retained by the defendant until October 1, 1976. The Roth court found that the evidence presented proved that the defendant was quitting the farming business. The main demonstration of this was defendant's participation in a public auction held on April 10, 1976, to close out his farming operation. The Roth court concluded that the defendant's situation at the time he entered into the contract with the purchaser was such that he did not need any agreement for possession of portions of the farm other than the house. The Roth court did not hold that parol evidence could never be used to prove the existence of a separate, contemporaneous oral contract between the parties.
4 In the instant case, the evidence demonstrated that the parties had been involved in negotiations for over seven months. Initially, Popeo had been given authority by defendant to work out a termination agreement with plaintiff on behalf of defendant. In a letter dated June 10, 1980, to plaintiff's attorney, Farrell, Popeo admitted that the delays in finalizing a termination agreement were caused by him. The initial talks included discussions about a noncompetition clause. Once the talks fell apart and no agreement was signed, plaintiff formed a number of businesses which were in direct competition with defendant. Unlike Roth, we believe the evidence presented here shows the need for a separate oral contract to compensate plaintiff adequately for his businesses acquired in the interim and for his agreement not to compete further with defendant. We also believe that Popeo's delays *1012 in executing a termination agreement with defendant adequately explained the reasons for the separate oral contract. Popeo agreed to pay plaintiff an additional $200,000 in three separate transactions in order to avoid going to the board of directors for approval. Had the termination agreement been completed within a matter of weeks as originally planned, plaintiff would not have formed and acquired these new business ventures which were in direct competition with defendant, and there would have been no need to pay plaintiff an additional $200,000.
By our decision, we by no means wish to encourage these types of side agreements between parties. Under the facts in the instant case, however, the jury's determination that there was a separate oral contract to compensate plaintiff for his business ventures in direct competition with defendant was supported by the testimony of plaintiff, plaintiff's attorneys, and defendant's own actions in paying $95,000 for the Trusik accounts and will not be reversed by this court.
The second issue we are asked to address is whether sufficient independent consideration, definiteness, or certainty existed to support the separate oral contract. First, defendant argues that plaintiff failed to establish the existence of independent consideration from the written contract to support the oral contract. Defendant contends that the oral agreement lacked consideration because the parties had already agreed to options on the Trusik accounts, the Wagner landfill, and the Hazmat site in a written contract. Second, defendant argues that the oral contract lacked sufficient definiteness or certainty as evidenced by plaintiff's testimony as well as plaintiff's attorneys' testimony.
5, 6 Consideration for a promise has been defined in Restatement (Second) of the Law of Contracts, section 71, as:
"(1) To constitute consideration, a performance or a return promise must be bargained for.
(2) A performance or return promise is bargained for if it is sought by the promisor in exchange for his promise and is given by the promisee in exchange for that promise.
(3) The performance may consist of
(a) an act other than a promise, or
(b) a forbearance, or
(c) the creation, modification, or destruction of a legal relation." (Restatement (Second) of Contracts § 71 (1981).)
It is well settled that consideration is an essential element, and it is necessary to the validity or enforceability of a contract. (Wickstrom v. Vern E. Alden Co. (1968), 99 Ill. App.2d 254, 260, 240 N.E.2d 401, 404.) Courts do not ordinarily inquire into the adequacy of consideration, *1013 and any consideration, however slight, is legally sufficient to support a promise, except where the disparity is so gross as to raise a presumption of fraud. 99 Ill. App.2d at 261, 240 N.E.2d at 405.
7 The written contract in the case at bar set forth various terms with which plaintiff would have to comply in order to receive benefits under the termination agreement. For example, plaintiff would not be able to compete with defendant for a period of two years under the terms of the written contract. However, plaintiff had seven businesses in direct competition with defendant before signing the termination agreement. In order to be able to sign the written contract, plaintiff had to dispose of these businesses. He explained that he had mortgages on these businesses and needed at least $200,000 for these businesses to make it worth his while to sign the termination agreement. For simplicity's sake, plaintiff merged these businesses into the Global Waste Services accounts. We find the transfer of the Global Waste Services accounts, which were businesses acquired by plaintiff during the period of limbo between his termination from defendant's employment and his signing of the termination agreement, was sufficient consideration to support the oral contract. Defendant's promise to pay plaintiff an additional $200,000 is, therefore, legally enforceable.
8 Defendant also contends that the oral contract lacked sufficient definiteness and certainty. As we previously explained, whether an oral contract exists, its terms and conditions, and the intent of the parties are questions of fact to be determined by the trier of fact. (Howard A. Koop & Associates v. KPK Corp. (1983), 119 Ill. App.3d at 400, 457 N.E.2d at 73.) This determination should not be reversed unless it is contrary to the manifest weight of the evidence.
9 Defendant points out that, in the instant case, attorney Long testified that Popeo agreed to add on somewhere in the range of between $75,000 and $100,000 for the purchase of the Hazmat option. Defendant also points out that plaintiff made the statement, "In any event, Popeo was going to pay me my $200,000." Defendant contends that such testimony proves that any oral agreement lacked sufficient definiteness and clarity. On the other hand, plaintiff testified that under the terms of the oral contract, defendant had agreed to pay him an additional $200,000 to be paid in three installments with $25,000 being added to the Trusik option, $75,000 being added to the Wagner option, and $100,000 being added to the Hazmat option. The jury also heard testimony and saw evidence that defendant did, in fact, pay an additional $25,000 for the Trusik option by paying a total of $95,000 when $70,000 was the price written in the termination agreement. *1014 Under these facts, we cannot say that it was against the manifest weight of the evidence for the jury to find that there was a separate oral contract between the parties under which plaintiff was to be paid an additional $200,000.
10 Along this same line, defendant argues that plaintiff's instructions 10 and 11 were in error because they did not allow the jury to determine the price terms of the contract and did not allow the jury to consider what plaintiff was to do in exchange for $200,000.
Plaintiff's instruction number 10 read as follows:
"Plaintiff's Complaint alleges that Defendant breached an oral agreement with the Plaintiff.
Plaintiff must prove the following propositions:
A. That the Plaintiff and Defendant entered into an oral agreement for $200,000.00;
B. That the Defendant breached the oral agreement;
C. That Plaintiff has sustained damages due to Defendant's breach of the oral agreement.
The Defendant denies there was an oral agreement, denies the Plaintiff sustained damages therefrom, and denies that Plaintiff sustained damages to the extent claimed."
Plaintiff's instruction number 11 read as follows:
"The Plaintiff has the burden of proving each of the following propositions:
First, that Plaintiff and Defendant entered into an oral agreement for $200,000.00;
Second, that Defendant breached the oral agreement;
Third, that the Plaintiff sustained damages due to the Defendant's breach of the oral agreement.
If you find from your consideration of all the evidence that each of the propositions required for the Plaintiff has been proved then your verdict should be for the Plaintiff. If, on the other hand, you find from your consideration of all the evidence, that any one of the propositions the Plaintiff is required to prove has not been proved, then your verdict should be for the Defendant."
We have carefully reviewed the transcript of the instructions conference. At that time, defendant objected to the above-cited instructions based upon the fact that neither instruction allowed the jury to consider whether there was adequate consideration for the separate oral contract. Since the question whether adequate consideration exists is a question of law for the trial court (Lesnik v. Estate of Lesnik (1980), 82 Ill. App.3d 1102, 403 N.E.2d 683), defendant's argument failed, *1015 and the instructions were given. Defendant did not object at trial to the insertion of the $200,000 price term. On the contrary, defendant's own tendered instruction, which defendant contends alleviated the problems found in instructions 10 and 11, includes the $200,000 price term. Defendant's tendered instruction specifically reads:
"The Plaintiff has the burden of proving each of the following propositions.
First, there was an oral agreement entered into between the Plaintiff and Defendant in which Defendant agreed to pay Plaintiff $200,000.00, and Plaintiff agreed to do something he was not already obligated to do or Plaintiff refrained from doing something he was entitled to do;
Second, that the Defendant breached the oral agreement;
Third, that the Plaintiff sustained damages due to the Defendant's breach of the oral agreement."
We need not reach the merits of defendant's argument because it has been waived by the failure of defendant to object specifically to the price term at the instructions conference (Lawson v. Belt Ry. Co. (1975), 34 Ill. App.3d 7, 24, 339 N.E.2d 381, 396), and further waived because defendant's own tendered instruction included the $200,000 price term.
The fourth issue we are asked to consider is whether the Statute of Frauds bars plaintiff's oral contract claim. Defendant contends that assuming, arguendo, an oral agreement to pay plaintiff $200,000 did exist, it would be unenforceable under the Statute of Frauds for three reasons: (1) defendant cannot answer for the debt of another; (2) the contract was to be performed over a period of years; and (3) the contract was for the sale of land.
11 Defendant is correct in that the Statute of Frauds provides that an action cannot lie on one's promise to answer for the debt of another unless such promise is in writing. (Ill. Rev. Stat. 1979, ch. 59, par. 1.) It has been held that a promise to pay the debt of another which is not written and signed cannot be enforced either in law or in equity. (Brown & Shinitzky Chartered v. Dentinger (1983), 118 Ill. App.3d 517, 519, 455 N.E.2d 128, 129.) However, the promise to answer for the debt of another "has been defined as an undertaking by a person not before liable, for the purpose of securing or performing the same duty for which the original debtor continues to be liable." 72 Am.Jur.2d Statute of Frauds § 179, at 709 (1974).
12 In the instant case, the evidence presented was that defendant promised to pay plaintiff $200,000. The $200,000 figure was apparently agreed upon because plaintiff amassed substantial debt by acquiring *1016 landfill property and businesses during the interim between the parties' first meeting concerning the termination agreement and the actual signing of the agreement. Plaintiff introduced evidence of this debt to show why the $200,000 amount was agreed upon. Plaintiff testified that he told attorney Popeo, "What you need to do is give me a couple of hundred thousand dollars, and that will cover the debt with a little something for the non-compete." Therefore, plaintiff was not asking defendant to pay his creditors, but rather, was asking for enough money so that he could pay off his creditors and have some money left for himself in return for his promise not to compete with defendant. No evidence was presented that defendant would become liable on the bank debt owed by plaintiff.
13 Defendant next argues that the oral contract violated the Statute of Frauds because the $200,000 was to be paid over a period of years. Specifically, defendant contends that since the payments were scheduled over a four- to five-year period, the contract is unenforceable because it was not reduced to writing.
The Illinois Statute of Frauds provides, in pertinent part:
"[N]o action shall be brought * * * upon any agreement that is not to be performed within the space of one year from the making thereof * * *." (Ill. Rev. Stat. 1979, ch. 59, par. 1.)
In Illinois, this has been determined to mean that a contract is unenforceable only if it is impossible to perform the contract within one year. (Brudnicki v. General Electric Co. (N.D. Ill. 1982), 535 F. Supp. 84, 86; Sinclair v. Sullivan Chevrolet Co. (1964), 45 Ill. App.2d 10, 14, 195 N.E.2d 250, 252.) If, however, it appears from a reasonable interpretation of the terms of the agreement that it is capable of performance within one year, the Statute of Frauds is inapplicable. Stein v. Malden Mills, Inc. (1972), 9 Ill. App.3d 266, 271, 292 N.E.2d 52, 57.
14 In the instant case, the $200,000 payment by defendant was to be made in three transactions. While attorney Long testified that these payments were scheduled over a period of four to five years, we find that these transactions could have been completed within one year. The evidence adduced at trial indicates that it was not impossible to perform the oral contract within one year; therefore, the oral contract did not violate the Statute of Frauds.
15, 16 Defendant next contends that because payment was to be made by exercising the options for the sale of property, the oral contract fell within the Statute of Frauds and was in violation of said statute. Contrary to defendant's assertion, the option contracts on the Trusik, Wagner, and Hazmat properties were reduced to writing. The *1017 parties had, however, agreed to add $200,000 more to the purchase price of these transactions in order to adequately compensate plaintiff for the Global Waste Services accounts. We do not, therefore, consider this a contract for the sale of land. Likewise, we find that the contract does not violate the Statute of Frauds provision of the Uniform Commercial Code (Ill. Rev. Stat. 1979, ch. 26, par. 2-201). An oral contract for the sale of goods, in this case the Global Waste Services accounts, which has been partially performed, is enforceable at the insistence of either party. (Allied Wire Products, Inc. v. Marketing Techniques, Inc. (1981), 99 Ill. App.3d 29, 37, 424 N.E.2d 1288, 1294.) Defendant's payment of $95,000 rather than the written term of $70,000 constitutes partial performance on the oral contract and, thus, takes the oral contract out of the Statute of Frauds and removes the statute as a bar to enforcement of the contract.
The final issue we are asked to consider is whether the verdict is supported by the evidence. Defendant argues that the jury's verdict was excessive and was not supported by the evidence. For these reasons, defendant contends it is entitled to a new trial or, in the alternative, a remittitur. Specifically, defendant argues that the jury's verdict of $225,000 placed plaintiff in a better position than he would have been had the oral contract been performed. Defendant argues that since plaintiff had already been paid $25,000 on the Trusik accounts, plaintiff was entitled to recover only $175,000. Defendant contends the only logical explanation for the award of $225,000 was that the jury speculated as to the amount of interest accumulating on plaintiff's loans, as no evidence as to the amount of interest plaintiff paid was presented. Plaintiff replies that the jury has some latitude in returning the amount of damages and the record adequately supports the verdict. We agree.
17 The question of damages is largely within the discretion of the jury, and courts of review will not interfere with a jury's assessment of damages unless:
"(1) the award is palpably inadequate or a proved element of damages has been ignored; (2) the amount of the verdict is shown to be erroneous or the result of passion or prejudice; or (3) it clearly appears from uncontradicted evidence that the amount of the verdict bears no reasonable relationship to the loss suffered by the plaintiff." (Ryan v. E.A.I. Construction Corp. (1987), 158 Ill. App.3d 449, 463, 511 N.E.2d 1244, 1253.)
A person breaching a contract can be held liable for any damages that may fairly and reasonably be considered as arising from the breach in light of the facts which were known or should have been known. *1018 Naiditch v. Shaf Home Builders, Inc. (1987), 160 Ill. App.3d 245, 267, 512 N.E.2d 1027, 1240.
18 A review of the record in the instant case leads us to conclude that the jury award was properly based on the evidence. Plaintiff presented sufficient evidence concerning the amount he owed on the Global Waste Services debt and interest accruing thereon at at least two separate banks. Plaintiff also presented evidence as to the amounts he paid out of his own pocket on the Global Waste Services debt. While the jury is not allowed to speculate, its members are allowed to use their experiences in life in determining the amount of money which will adequately compensate plaintiff for a breach of contract. (Illinois Pattern Jury Instructions, Civil, No. 1.04 (2d ed. 1971).) The award of $225,000 does not put plaintiff in a better position than he would have been had the oral contract been performed nearly eight years ago as originally scheduled. This verdict in no way shocks the judicial conscience. Instead, we find the award to be within the jury's discretion, and we will not interfere with the jury's determination.
For the foregoing reasons, the judgment of the circuit court of Madison County is affirmed.
Affirmed.
LEWIS, P.J., and HOWERTON, J., concur.
|
WIMBLEDON, England -- Tennis star Venus Williams broke down in tears during a post-match press conference at Wimbledon on Monday when a reporter asked her to comment on how she was dealing with her involvement in a car crash that claimed the life of an elderly man in Florida.
"There are really no words to describe, like, how devastating, and, yeah, I'm completely speechless," Williams said.
The five-time Wimbledon champion appeared to be at a loss for words as she wiped tears away from her eyes.
Get Breaking News Delivered to Your Inbox
A man sitting next to Williams at the press conference said, "Before we take any further questions for Venus, please be aware she is unable to say anything more about this."
Williams then broke down in tears and suggested that it was time for her to leave the press conference. She stood up and left the room.
An attorney representing the family of 78-year-old Jerome Barson filed a lawsuit, seeking unspecified damages, against Williams Friday, a day after Palm Beach Gardens police released a report saying she caused the June 9 crash that left Barson with a fractured spine and numerous internal injuries. He died June 22.
Barson's wife, Linda, suffered several fractures to her right arm and hand in the crash. The family's attorney says she is "physically and emotionally devastated."
The lawsuit accuses the 37-year-old of running a red light, failing to yield the right-of-way, inattentive driving and negligent operation of a motor vehicle.
Barson, a retired teacher who had moved to South Florida from Philadelphia in 1975, had been in good health and was preparing to go on a Disney cruise with his wife of 33 years, three children and 13 grandchildren.
Williams' attorney, Malcolm Cunningham, did not immediately respond to an email from The Associated Press. The Palm Beach Post quoted him as saying only that he was aware of the lawsuit.
Williams has not been cited or charged. Police say she was not drunk, on drugs or texting, but that she drove her 2010 Toyota Sequoia SUV in front of the Barsons' 2016 Hyundai Accent after the couple's light turned green. The Accent smashed into the side of the Sequoia.
Williams, who owns a home near the crash site, told investigators her light was green when she entered the six-lane intersection but she got stopped midpoint by traffic and didn't see the Barsons' car before she crossed their lane.
The tennis star has career on-court earnings of more than $34 million and her own clothing line, EleVen. According to Forbes Magazine, she also has endorsement deals with Ralph Lauren, Kraft foods, Tide detergent and Wilson sporting goods. |
The Rise and Fall of the LDS Church
by Ed H. Yong
The Secrets of Success
Success is a fuzzy word. It is measured by numbers and statistics. In 1920, the Mormons numbered roughly half a million on the face of this planet. By 2000, the number has risen to more than 10 million. That is a 2000% rise in 80 years. This is success.
Rodney Stark famously predicted in 1998 that the Mormons who make up the Latter-Day Saints (LDS) church will increase to 265 million by the year 2080. That is, it will be the only major world religion to have emerged since the rise of Islam in the 7th century. This is success.
If Albert Einstein is right when he spoke of success as 1% genius and 99% labor, then is it wrong to speak of religious success as 1% truth and 99% marketing? After all, the business of religion is first and foremost communication. So if some groups are doing this right and succeeding, then others must be doing this wrong.
The LDS case study is unique not so much because it is phenomenal, but because it is well publicized. Other groups that egressed from mainline Christianity and took off in roughly the same period as the Mormons are now either bigger (Seventh Day Adventists: membership 20 million) or faster (Jehovah's Witness: 6% p.a.). It is uncertain whether or not such religious "successes" are attributable to the "Force" logic tells us it usually boils down to sound management.
The LDS church is run like a corporation. Take as an analogy, Coca-Cola. Both enterprises originated in America by Americans and became multinationals based in America. Coca-Cola has its secret recipe which gives us the drink, the LDS has its gold plates which gives us the Mormon scriptures. Both are led by a CEO slash Prophet and assisted by managers slash counselors. Both are heavy media users. The former pitches its sales from giant billboards and Super bowl ads. The latter relies on direct selling missionaries and Olympic sponsorships.
Both are market leaders. Coca-Cola is a blue chip on the Dow and the LDS is a huge denomination in the Pacific Northwest. While Coca-Cola may sometimes suffer the unholy reputation of being "asinine" i.e. great company lousy stock, the LDS church excels. It ranks as the 7th biggest denomination in America, but it outgrows the Catholics at 1st place. Coca-Cola prints its financial data annually to woo investors. The LDS advertises the social demographics of Utah like a prospectus to the potential churchgoer, the lowest abortion, intoxicated driving and divorce rates in the nation. This is the puff: "If you have faith (and money), invest in us. We are risk averse, morally conservative and global-minded." So obvious is the LDS corporate example that TIME in a 1997 cover story dubbed it "Mormon Inc." drawing attention to a little known empire of media, finance and real estate. Clergy and laity wear their same dark business suits to church, which is run on such boardroom formalities as meetings, interviews and quorums. Each Sunday service begins with a corporate communion, and then subdivided into various auxiliary departments of welfare and education. Decisions are made by heads of departments, which are then delegated to members for execution of service-oriented assignments. Sales patterns are audited regularly. Missionaries report their tracting results to District Leaders who report to Zone Leaders who report to the Mission President. The diffusion of corporate philosophies into religious affairs makes many churches nervous. It is a root of evil they claim, but it can also occasion much good. How else can you manage 11 million members in 25,793 congregations that speak 175 languages in over 150 countries? The same curve that measures the revenue of a corporation, measures also the membership of a church. Critics point out that the Bible warns that the church should not be overtaken by moneychangers. On that same token however, the Bible does not prohibit the church from cooperating with moneychangers. About 140,000 LDS members volunteer part-time in church duties, effectively a total waiver of USD 531 million in wages per annum. And yet with the paid full-time clergy of mainline Protestant groups, their memberships actually decrease. In 1996, the Presbyterian Church (USA) lost 1.9% of its 2.7 million while the LDS added 3.3% to theirs. During the 1980s, the Lutherans (ECLA) had to retrench staff to meet a budget deficit that ballooned to USD14.8 million, at a time when they were already losing members. Since religion is by far the single largest service industry in the world, it needs to be managed by leaders who are well-versed in spiritual and secular disciplines. The overwhelming majority of those at the upper echelons of the LDS hierarchy are highly educated professionals. Of the 2 counselors and 12 apostles that surround the Prophet, there are at least 4 MBAs, 2 JDs and 13 Doctorates: including 1 mechanical engineer, 1 surgeon, 1 nuclear physicist, 1 former mayor and 1 former Supreme Court justice. Such an oasis of talent is a huge asset to churches today. Anything from the lack of market research to the insensitivity of market trends can crowd out the most faithful of churches. That said, marketing the church is essential for the "organizational survival" of the church in a market-driven environment (George Barna 1991). Many do not realize that the world's second largest congregation in terms of attendance, the Willow Creek Community Church in South Barrington, Illinois, started out with a targeted "customer survey"!
Authoritative Leadership Religion in the modern century is all about image. People want to invest in leaders not followers, the Bill Gates not Paul Allens. The idea of a Prophet on earth that is God's sole representative sounds very persuasive. Just as any marketing exec from Nike will tell you that "people never buy shoes, they buy everything else but the shoes," one must therefore understand that people do not just shop for the truth, they shop for moral authority, social stability and future certainty. When you give your sheep a shepherd, you get more than your own sheep, you also get your neighbor's sheep by virtue of herd instinct. This underlies the phenomenon as to why a sizeable portion of LDS converts come from other denominations. But for authority to succeed, it must be authoritative. And for authority to be authoritative, it must be exclusive. It is thus not surprising that the fastest growing religions in the world are those that preach exclusivity. By comparison, those that try to accept or incorporate other beliefs experience modest growths. The Bahai Faith and Vatican II are two examples. In a world where religious choices now come in graffiti and junk mails, the buzzword is product differentiation. Form is in, function is out. The rational consumer thinks that religion in general will make him a better person. So the gimmick is not to sell religion as truth per se, but as a package: "Not only do we have the Bible, we also have a Prophet who oversees the one True Church." For the most part, the biggest advantage of having an authoritative figure at the fore is not so much leadership, but visibility. When authority is visible, faith is less demanding. It is the nature of humans, as Albert Camus would say, that we generally avoid making difficult moral choices, and so we leave it to our leaders to decide for us. The Prophet fills this role enthusiastically. He is the "charismatic authority" who extends his influence through a continuum of perceived power, and in the case of Mormons, the priesthood hierarchy (Douglas Davies 1995). In an article in Christianity Today entitled "Why your neighbor joined the Mormon Church?" the evangelical author conceded: "In a day when many are hesitant to claim that God has said anything definitive, the Mormons stand out in contrast, and many people are ready to listen to what the Mormons think the voice of God says. It is tragic that their message is false, but it is nonetheless a lesson to us that people are many times ready to hear a voice of authority." (italics added) It must be noted that the "myth" of authority is self-perpetuating. Often authority is believed without being spoken! Long before the missionaries have the chance to spiel their testimonies, the public already has an impression of authority. Call it the Nuremberg Effect if you like. The impression is sourced from two things: uniformity and solidarity. When 60,000 Gen X'ers (and counting) sacrifice 2 years of adolescence and submit to a spartan regime of work, dress and conduct, the public turns. The media is mainly responsible for this public perception. Every feature story on the LDS inclines to project the missionaries as a "spiritual army" or "moral police."
Centralization Power in the LDS church is concentrated in a handful of individuals at the headquarters in Salt Lake City. For a relatively small dynamic enterprise, this is a plus. Decisions are executed a lot faster in a top-down "autocratic" model than say, the consensual "democratic" models adopted by mainstream denominations. Speed in the context of religion is efficiency. Speed indicates objectivity and creates public confidence. Take for instance: It took Episcopalians and Anglicans worldwide 10 years to reach a final consensus on the ordination of women. In that same Lambeth Conference in 1998, the vote was also cast on homosexuality. It was by no means unanimous: 526 against 70 for, 45 abstentions. The Lutheran General Assembly is more divided: 820 against 159 for (August 1999). After several compromises, the United Methodist Church decided: 628 against 327 for (May 2000). The Presbyterian Synod pending a 1998 appeal by a gay elder in has yet to settle the issue. Meanwhile the savvy LDS has already assured the public that it will never sustain a female priest let alone a gay member, as though the Prophet just had a direct audience with God. A centralized church allows it to speak out in an official and unopposed manner on social issues. When the Scouts of America were dragged to the courts for its discrimination against gays, it was the LDS that first voiced concern and threatened to pull donations out. The Roman Catholics and some others followed suit. Similarly, abortion is never an issue in the LDS ward. You will not catch pro-lifers and pro-choicers on the same pew arguing the merits of Roe v Wade. The church has simply spoken. Even when traditional churches stay silent on risky areas like cohabitation, the LDS invades it with its Law of Chastity. Believe it or not, it has also canonized a famous 10-point plan to defeat masturbation among teenage boys. If not for the centralized organism of power, it is practically impossible for a church of this magnitude to insulate itself from theological liberalism and reverse back to moral orthodoxy. Consider the analogy of a Southeast Asian economy: A handful of elites in a government think tank shapes the path to industrialization. The object is invariably growth but in achieving this object, division becomes a liability. Hence the solution is to defer all ancillary interests — that is, "when you leave less room for debate, you leave more room for ambition." Likewise, "democracy" is a tardy concept that will wear down the objects of the LDS church. The church requires a homogenous product that can be duplicated rapidly, so it must be wary of liberal discussions that can fragment its policies. Everything from operation manuals right to the type of musical instruments allowed is conceived on the Salt Lake drawing board. Did you think it is an accident that the Big Mac you snarfed in Seattle is the same Big Mac in Tokyo?
Risk Management Faith ultimately leads to growth, but as the LDS model shows, fiscal prudence is an indispensable mean towards that end. Born out of the pioneer days, the church began as a struggling community uprooted from the Midwest. The hostile environment forced them to rely on no one but themselves and to hone virtues of sustenance and self-sufficiency. The Mormon patriarchs commissioned "business missionaries" to key industries to learn various skills so that they could someday supply their brethren's needs. Even after the Mormons became the majority in Utah, the church continues to cave in to a "crisis mentality," partly driven by their persecution past and a future apocalypse. This mentality birthed, for good measure, admirable habits of risk management and horizontal integration. Little is known of the LDS sprawling portfolio since it stopped publishing detailed financial data in 1959. But we know this much — that it is incredibly self-reliant, debt free and well diversified. Shearson Lehman Hutton brokers almost all of the church's investments, most of which are channeled into traditional sectors. Real estate is big on the hit list: The LDS makes 2% of the US population but owns 1 million acres of agricultural land, larger than the size of Rhode Island. Their corporate web skulks other Big 4 spin-offs too: like construction, insurance and media (John Heinerman & Anson Shupe 1985). In a speech during the 166th Semiannual General Conference, the Prophet discussed financial accountability: "We have all funds carefully audited. We have a corp. of auditors who are qualified CPAs, who are independent from all other agencies of the Church and who report only to the First Presidency of the Church. We try to be very careful... We treat them carefully and safeguard them and try in every way..." (emphasis added) Long term goals require patience. And by far the smartest long-term investment is education. The largest privately owned college in America is (surprise!) Brigham Young University (BYU), an old-boy flagship of the LDS. While brain drain may be a problem for mainstream ecclesiastics, BYU with its 32,000 students virtually promises an unbreakable supply of human resource into the LDS organism. Having friends in high places wield enormous goodwill, at least on paper. Not to mention that these same alumni will also be serving in church administration on top of their secular duties. No theological training is necessary. Ever asked a Mormon why he is encouraged to stock a year's worth of food in the pantry, clothes and fuel? In an unlikely doomsday scenario, the church can function like an autonomous economy. It will have enough cattle ranches and peanut butter to feed itself, and surpluses to trade. It will have farms to relocate into, with adequate financing options to start anew. It will have the pools of talent to restore its infrastructure, and the necessary communication networks to keep distributions alive and its economy breathing. Marvel yet, it will have the resources to spare for the consumption of needy onlookers and passers-by, at interest of course. It will transcend wars, borders and stock market crashes.
In Ricardian analysis, it is assumed that a perfect laissez-faire market has an infinite number of cutthroat competitors. Welcome to the 21st century world of religions. When 4 billion people vie for essentially the same Allah, Jesus or Jehovah, brand recognition seriously helps. If the President of the United States can hire spin doctors and ad agencies to churn public relations, why not the President of the Global Church? The task: Give the church a friendly face and a valid social cause. The answer: Shed the "underground" image and advertise the church as a mainstream feel good denomination. By the turn of the 80s, Mormons are no longer aliens that abduct young girls. Although Hollywood is still by no means kind, Mormons are now painted as cadet-toned straightjacket missionaries who put Encyclopedia and Amway peddlers to shame. More often than not, they will turn the other cheek and swallow abuse, the kind of salesmanship Zig Ziglar would teach. On the stump, the church trumps family values in degenerate America. It now sits as a member of World Congress of Families in Geneva, and defines its role in contemporary society just as Focus on the Family and Planned Parenthood do. In fact, every LDS commercial is a portrait of a happy family with lovey dovey kids. This image would never kick start so successfully but for the tireless PR of the current leader, Gordon B. Hinckley. At 93 years of age, he is nimble enough to attend press conferences, dedicate temples and badmouth polygamy on Larry King Live. His job is to make the ordinary guy on the street associate Mormonism with orthodox Christianity, as if they roll off the same tongue. Kudos, he pulled it off! The ordinary guy probably has 10 minutes of Bible exposure in his lifetime, and so "if it looks like chicken and tastes like chicken — it must be chicken!" In an interview with Mike Wallace on 60 Minutes, he was asked why the LDS is still sometimes referred to as a "cult." A clever response followed: "I don't know what that (word) means really. But if it has negative connotations, I don't accept it... But look, here is this great church now! There are only 6 churches in America with more members. We are in more than 150 nations. You will find our people in business institutions, high in educational circles, in politics, in government, in whatever. We are rather ordinary people doing extraordinary work." (aired Easter Sunday, 1996) The biggest sales push is yet to come in the 2002 Winter Games. After all, the church lobbied for it. Journalists are welcome to free personal tours to the largest mission training facility and genealogical research center in the world. The former has a laboratory to teach 54 languages and the latter records the names of 2 billion individuals. Missionaries who eagerly speak Norsk, Svenska, Amharic or Croatian will hug the tarmac on Temple Square to pass out tracts. Members who make up 70% of Utah are expected to open their houses to give curious tourists some good old-fashioned Mormon hospitality. Throughout the event, a media relations team will be on standby to provide assistance — so that you will leave happy, and spread the word! Christians, are you listening?
The Systemic Decline
The trend of growth is exaggerated. Rodney Stark's projection of 265 million is moot. He is not wrong, but he is not stark right either. Technical analysis warns that looking at data from different angles will give us different interpretations. It is possible that Stark had projected from a "shoulder" at a time when the church grew in exponential rates. Hindsight however shows that growth had probably peaked during the mid-1980s.
The statistics are interesting. Forget absolute numbers, focus instead on the rates of conversion growth (G C = total of converts / total membership) and growth per missionary capita (G M = total of converts / total missionaries). Two readings stand out:
For the year ending 31 Dec 1999, the total membership grew at 2.85%.
This is a 35% drop in annual growth since 1989.
For the year ending 31 Dec 1999, each missionary produced an average of 5.22 converts.
This is a 35% drop in productivity since 1989.
Year 1989 1990 1991 1992 1993 G C 4.37% 4.26% 3.67% 3.17% 3.52% G M 8.03 7.58 6.86 5.96 6.26 Total 7.30 mil 7.76 mil 8.12 mil 8.41 mil 8.67 mil
Year 1994 1995 1996 1997 1998 1999 G C 3.33% 3.26% 3.35% 3.16% 2.89% 2.85% G M 6.36 6.26 6.07 5.62 5.19 5.22 Total 9.02 mil 9.34 mil 9.70 mil 10.07 mil 10.35 mil 10.75 mil
In 1975, the church stood at 3.57 million members. By late 2000, it passed the 11 million mark. The pattern of growth was not constant. What we see is that it tracked a "bell curve" that steeped for most of the 80s and flattened out in the 90s. For the past 10 years, the number of converts per annum hovered at 300,000 (margin error 2%). Fortunately, the pace of internal births continues to outstrip world population growth at 1.33% p.a. (UN Revision 1998). At these rates, the church will probably stagnate around 40 to 50 million for most of the 21st century.
By all counts, this is still a simplistic projection. More importantly, it fails to factor in structural trends that currently besiege the LDS church.
Missions Overreach Each year, more and more resources are poured into the production of temples, wards and missions. This massive outlay represents fixed costs that are justifiable by a corresponding increase in membership. Since 1998, the church has planned the construction of about 47 temples, the most recent one in Nauvoo, Illinois costing USD23 million. This is an incredibly sharp rise considering that in 1997, there were only 51 temples in operation. Two years later, there are 68 temples in operation with 47 soon on the way. Owing to the stiff policy of expansion, we find that fixed costs are rising a lot faster than productivity. Despite a record number of missionaries, their performance fails to match an equivalent increase in value added capital. For instance in 1989, the church operated 228 missions that produced 318,940 converts. In 1999, there are 333 missions in operation that produced only 306,171 converts. This is an alarming loss of efficiency, akin to "throwing good money at bad assets." As the reader might observe from here and subsequent points, there seems to be an ongoing dilemma between an expansionary policy and one that is consolidatory. It is almost as if there are two political camps in the LDS upper house, each lobbying for what they perceive is the best interest of the church. Even in a "divinely appointed" institution, power struggles are not uncommon (Michael Quinn 1997). It remains interesting to see whether the legacy of expansion borne by Gordon Hinckley will be as actively carried on by his looming successor. Until then, there is sort of a Catch 22 situation. The church will continue to raise its international profile for the sake of reputation and standing, but at the same time it has to come to terms with its systemic decline — an "aging symptom" that has already struck all of the biggest mainline denominations in America. The onus will fall squarely on Mormons to buck this trend, given that Protestant, Catholic and Jewish preferences have all slided across the board since World War II (Princeton Research Center 1993).
Export-LDS Growth For the first time in history, there are now more Mormons living outside the USA. There are more than 130 translations of the Mormon bible, reflecting a global export drive to tap into newer and less saturated markets. The startups and variable costs for such an export strategy are enormous. So the real issue on every economist's lips is this: "can the LDS recoup its investments?" Or to paraphrase: "Is this export strategy going to be profitable enough?" Profitability is not a wishy-washy spiritual effect. It comes in the giving of tithes, a 10% church tax on members' disposable incomes. The problem is that of the USD 5.2 billion in annual tithe collection, 94% comes directly from the pockets of local Americans (Joel Kotkin 1997). Not only are foreign members much poorer, many of their countries impose restrictions on the remittance of church giving. To add salt to the wound, Americans are leading the rate of departure from LDS among the demographic groups (see below). In other words, the parent tree cannot afford to bear fruit overseas when the same tree continues to be chipped away at home. The church must therefore ask, in the face of extremely uneven profit-loss distribution, whether it should still push for an all-out export-led growth. There are still untapped opportunities in affluent North America: the LDS has yet to break the Baptist stronghold in the South, the Evangelical stronghold in the Midwest or the Roman Catholic stronghold in Mexico. In the long term, LDS branches overseas will have to be more financially independent because they can no longer rely solely on parent financing. This is a step towards decentralization, something that is seen as inviting splinters from the church. But this may well be an inevitable consequence of church globalization. (Joan Ostling & Richard Ostling 1999)
Mormons do not stay Mormons forever. They are not immune. Due to the increasing "social and cultural homogeneity" among churches, denominational loyalty is shrinking as ever (Robert Wuthnow 1988). About 33% of Americans have switched denominations, while 70% become inactive some time during their lives. Fully 80% of adults have attended churches other than their own. Weekly church attendance in America is unchanged for the past era at barely 44% (University of Michigan 1997 Survey). When it comes to tithing, only 4 in 10 Mormons actually meet the stipulated threshold of 10% (Omaha World Herald 23 April 2000). In religious America, we find that the LDS church is losing significant market share. According to Saints Alive (July 2000), there are some 1 million local Mormons who have renounced their church — a huge clip off the 5 million on record. This might sound somewhat sensational, but bear in mind that opposition towards the LDS church has greatly intensified in the past few decades. Three groups are primarily responsible: The Counter Cult Movement — A largely evangelical community which have sprung up to reach Mormons and disseminate literature that encourage genuine theological comparisons, and ultimately a return to biblical Christianity. The Ex-Mormons — Or otherwise known by church members as "apostates." They are usually born into the church but have left; having grown disillusioned with its stringent practices and "mind control" of organized religion. The Civil Libertarians — Those members and their supporters who feel marginalized by the church, and demand inter alia greater academic freedom in BYU, equal treatment to homosexuals and constitutional separation between church and state. It is uncertain whether these efforts have resulted in a net outflow of Mormons. One thing for certain however is that religious America is over-saturated. The combined strength of secularization, negative publicity from ex-Mormons and the rise of evangelicalism leave the Salt Lake players little choice but to expand more fully overseas.
Statistics lie. They are not a barometer of the true net growth of the church. Many denominational churches have registration mechanisms that make it almost impractical for any exiting member to remove their name on the register. This "burnout" procedure is deliberate, supposedly to allow time for members to rethink their decisions to leave. In the end, most people just ignore and move on with their lives because they are "fed up with arguing with the church". The statistics tell us nothing about denominational commitment. We know that for the most part, LDS growth has been overseas driven. In countries where Mormonism is far less culturally entrenched, it is hard to maintain the retention rate of members that is competitive to the Motherland. Those social historical structures that make Mormonism attractive, like the Pioneer Days and biography of Joseph Smith, are geographically removed. Furthermore, given that the majority of overseas members are first generation converts, the family traditions and sense of community which keep them there are also absent. Finally, the statistics do not indicate what the level of church participation is. Rumors abound that many Third World families are baptized into churches due to incentives like food and shelter. But this aside, it is hard to imagine a struggling father of five children in Brazil or India dedicating 20 unpaid hours each week to church activities or bishopric duties. This is perhaps a wake-up sign that full time pastoral staff is desperately needed to keep members on the books!
The Trend of Stagnation
At least in the context of sociology, trends matter more than the truth. Why? Because most people are sold on to the social cohesion of the LDS community before they are even interested in its theology. To put it flatly, the public tends to be converted first by culture, then gradually by theology. This gives us an insight of a fundamental LDS strength.
On the flip side, we find that the hyped up statistics show very positive results and concurrently reveal some disturbing trends. The statistical information itself leads us to believe in something markedly different from the intelligence of the information. To arrive at a satisfactory interpretation, we should examine these LDS trends in light of social, religious and geopolitical undercurrents in contemporary society.
Institutionalization The biggest strength of any entity is usually also its biggest weakness. The LDS church is big and institutionalized but it is also visible and over-exposed. Visibility slows movement. The fastest growing churches are those that deliberately make themselves "invisible" and mushroom underground in forbidding countries like China and India. Those evangelists who smuggle Bibles do not wear white pressed shirts and badges, and do not necessarily belong to any single institution or marquee, but they collectively sprout more converts in a month than Mormons do in a year! Let us be realistic: 60% of the world live in countries that are hostile to Christianity. If the LDS is serious enough to fulfill their scriptural mandate, to create a "global Mormon tribe," then it must do a lot more than just wait cross-fingered for Beijing or Teheran to approve missionary visas. At an age where a Korean pastor can infiltrate Pakistan and stage a 100,000 people rally (Manmin World Mission, 20-Oct-2000), the LDS technique seems like a historical anachronism. There is nothing wrong in knocking doors or using proper channels of immigration. It is after all, a matter of efficiency and opportunity cost. Take for example: LDS missionaries are required to teach six 45-minute "hit-and-run" discussions to potential converts. Contrast this with the friendship based approach of plain-dressed "undercover" missionaries teaching English in a classroom, or striking conversation in a teahouse. Modern religious institutions use "events" to promote their cause but postmodern churches know the power of "relations." Institutionalization and denominationalism go hand in hand. Logically, you can't have one without the other. The prospects however are not encouraging. For 6 mainline denominations (ECLA, UMC, DOC, UCC, Presbyterian & Episcopal) the trend as Russell Chandler remarked has been to lose an equivalent of "a 530-member church every day of the year!" On the other hand, churches that have embraced a deregulated and fluid "Acts 2" paradigm have soared. An "Acts 2" paradigm affirms transparent and informed leadership that is able to provide a corporate Spirit-filled experience and above all a Christian trans-identity that is genderless, classless and cultureless. Think Vineyard Fellowship, think Assembly of God, think Megachurches, think Metachurches. They comprise of small and independent Pentecostal or Evangelical groups that rarely identify with any particular denominational "establishment." Together they represent the fastest growing segment of global Christianity. One survey points out that in 1990, 89% of the 500 fastest growing churches in America are Evangelical. A recent article published in the Lexington Theological Seminary Bulletin (Vol. 30) warns that secular and pluralist cultures have essentially "disestablished" denominational Christianity, short of a "death." Research on baby boomers found that those who seek religious satisfaction are extraordinarily "skeptical of denominations" and suspicious of institutions and leaders. (Wade Clark Roof 1993) Tough times indeed for denominational churches — they have to come to grips with a public of "spiritual consumers" who have shifting loyalties, question authority and demand high-quality instant gratification service. This brings us to perhaps the most painful question: "Can the denominational LDS church survive in a post-denominational era?" Or rather, can the church alter its presentation and restructure its dynamics without threatening to tear itself apart? The stakes are high — most of the 100 or so LDS splinter groups have severed from the church due to mutations in doctrine (polygamy: United Order Effort), policy (ordination of blacks: Apostolic United Brethren) and leadership (successor to Joseph Smith: Reorganized LDS).
Cultural Ethnocentrism Mormonism is a homogeneous culture. To be exact, it is a religious subculture that was born in America, flourished in America and concludes in America. This is how the Mormon grand narrative sounds like: "The Church is restored in America 18 centuries after the resurrection of Jesus Christ. It is presided by a lineage of white male American prophets. Jesus appeared to the Americans because the rest of the world apostatized. Therefore, it is the only legitimate church and will be rebuilt as the New Jerusalem when Jesus returns. The revealed location is Independence in the state of Missouri, hometown of President Harry S. Truman." Whereas Christianity has historically been molded to personify a particular people group — that is, a theology of "liberation" for Latin Americans (Gustavo Gutierrez), African Americans (Martin Luther King), Asians (Bastiaan Wielenga) etc; it is hard to see how anyone can duplicate an extremely ethnocentric model onto a foreign culture diametrically opposed to it. Africans can worship the Jesus that transcends national identity, but can they also worship a culture that exalts the American ideal — which in itself really is an extension of American imperialism. In effect, the America that conquered and plundered now offers grace to save and heal. The question fascinates: "How can a homogeneous culture absorb and accommodate a mosaic of multicultural faces?" There are two responses. Yes, it does and no it does not. Either way, Mormon culture is transplanted on other paradigms to a point of subversion. The church expects proper attire preferably the western suit and tie for male members — an American expression of its national costume! The church subjects its members to job-like interviews, it sets the optimal age for marriage and the optimal family size, and it even regulates sensitive things like diet and underwear. In short, the church is the most important external relation outside the family unit. To understand Mormon culture is to understand its limitations. People are increasingly ethnocentric and are conscious of mimicking the unpopular West. (Samuel Huntington 1993) There is a resurgent anti-American sentiment in Pan Arab, Continental Africa and Southeast Asia, regions where an LDS initiative will not be readily welcome. Surprisingly, Mormonism also does not find favorable acceptance in Judaism. Orthodox Jews find it hard to stomach that the LDS religion that purports to be Jewish in origin can be so insensitive to Jewish civilization. For instance, Mormons claim that their scriptures were written by Jewish forefathers in "reformed Egyptian." As an Old Testament people who emancipated themselves from slavery to the Egyptians, the idea of bearing testimony of Yahweh in the language of oppressors is quite offensive. Further, Mormon scriptures relate the migration of a tribe of Jews to ancient America who had supposedly kept to their faiths and traditions — but there is no whatsoever mention of basic Jewish practices like circumcision, dietary laws and Sabbath observance. Not only does Mormonism lack the legitimacy of exegesis and anthropology, it also lacks a concrete aspect of Jerusalem Theology. That is, it does not have anything to say about the eschatological significance of Jerusalem: the holy city and temple of the Jews; except that New Jerusalem will be in Missouri! Inasmuch as other churches have worked diligently towards multiculturalism, we have yet to see any effort towards ethnic representation in the LDS hierarchy. It has been 24 years since the ban on black priesthood was finally removed, but where are their faces: In the 1st Presidency? In the Apostles? In the Quorum of Seventies? In like manner, roughly 2.5 million Hispanics in South America call themselves members but the church has still to cede 20% of its Executive to them. Apologists are quick to cite that the LDS Indian Placement Program for the American natives is peerless to other church schemes. Sadly, they fail to recognize that it takes a lot more to reconcile power imbalances than free education and job placements.
It was John Naisbitt who pronounced the death of the Nation state, and in its stead is the rise of the Network. Unbeknown to the LDS church, this may well be a doomsday prognosis. The most extensive and divisive propaganda against the church is disbursed through the internet — ironically, the medium of choice for guerilla protesters at Seattle, Davos and Melbourne. So worried is the church that internet missionaries (or in cyberlingo: "net-mishes") The anti-Mormon campaign has made a huge detrimental impact for three reasons: They are invisible — The church can censor the newspapers, radio and television that missionaries consume, but they cannot block its members from accessing the internet. In fact, the literature is so overwhelming, it is purpose defeating to even attempt to trace or refute them.
They are invincible — For every Mormon apologetic website like FARMS or SHIELDS, there are mobs of alternatives that link to one another. Killing one off will automatically spark an uproar among proponents of free speech and allow the victims to free-ride on "martyrdom." This was exactly the aftermath of the church winning a court injunction against the internet-based Utah Lighthouse Ministry (UTLM) for posting a link to an ominous church website, but eventually losing the public relations war.
They are effective — It is interesting to note that while people have a healthy distrust of institutions, they find the internet credible. Already there are far more hits on anti-Mormon websites than there are on pro-Mormon ones. Testimonies of those who left the church abound and are hugely popular. For example, the bulletin board on "Exmormon.org" receives an average of 1 million hits a month, or around 30,000 a day. It maintains email newsgroups that swell in subscription, even from Mormon "lurkers" who are curious to exit the church. The weakness of the effort to thwart these critics is exacerbated by the church's indifferent or outwardly "agreeable" approach — for good measure though. Lest it becomes involved in a frenzy of negative dog-eat-dog publicity, the church will never associate itself with its apologetic forums or websites. For example, it is a deeply unsatisfying anti-climax to read Robert Starling's stirring critique of the "Godmakers" films only to find in the end that he is not representing the official views of the church! And the list goes on and on. Because the church is so media-friendly, you will not find a concerted defense of church doctrine. This shoves an additional incentive for critics to play hardball. Sandra Tanner, who heads UTLM observes: "The church is so concerned about PR, that I can't imagine them wanting to be involved in a lawsuit that would get everyone in the internet mad at them." Chances are, the church will back off because it does not want to lose the popular vote. This is in essence a replay of the student protests in University of Utah last year for the removal of names from church record; and Jewish protests against the church for baptizing Holocaust victims into membership — including the heroine Anne Frank! Opposition is also on the rise from other denominations. For long the 15-million Southern Baptist Convention (SBC) have been witnessing defects of members from its ranks, thanks in no small part to the Mormons. This "sheep stealing" has got to stop, and so it was decided that the Atlanta-based church would stage its 1998 Annual Conference at the Mormon garrisons in Salt Lake City. All 12,000 delegates of "Crossover SLC" were asked to commit three days of tracting door-to-door, manning café tents and distributing 45,000 videotapes of a documentary that falsifies Mormonism. It is high time, they suggested, for Mormons to take a dose of their own medicine! Opposition, to a substantial extent, is fanned by over-exposure. The trunky publicity of the LDS church makes itself a likely "tall poppy" target of interdenominational angst. Though the Seventh Day Adventists (SDA) and Jehovah's Witness (JW) are homegrown offshoots similar to the LDS, they experience considerably less backfire. They do not glamorize their success as the LDS does, and still they outshine the latter. For example, did you hear about the 6 million JW pioneers and publishers who put in 1 billion hours of missionary work to recruit 323,000 baptisms in 1999? Or are you aware that SDAs grow at 11% p.a. (what is that out of 20 million members!) and are actively involved in life-saving medical breakthroughs in their Dorcas Society?
The LDS church has come to a bitter realization that in its ambitious pursuit of growth, many vital interests have been sacrificed. It reeks of two drawbacks typical of "catch-up" competitors: the lack of research and technology and the lack of after-sales service. The first really translates to the church's passive attitude towards the discourse and development of theology. To date, there is no such thing as Systematic Mormon Theology (SMT). The second is the neglect of trained pastoral ministry to meet the discipleship needs of its members. Mormon clergy and laity are often thrown into the deep end of counseling or giving advice on sensitive issues without any experience. For all its 170-year history, Mormons have relied wholly on their Prophet to interpret and sanction scriptures as he deems fit. Eldon Tanner declared: "When the Prophet speak, the debate is over!" (Ensign, Aug 1979) In "14 Fundamentals In Following The Prophet," a decree by a former Prophet himself, the 1st fundamental informs us that "the prophet is the man who speaks for God in everything" and the 14th warns us to "follow him and be blessed, reject and suffer" (Ezra Taft Benson, 26-Feb-1980). These Prophets are merely lay people who have risen above the occasion, it is extremely rare for them to have any discernible form of theological qualification. While you can expect Jerry Falwell and Benny Hinn to be prolific at Greek, New Testament exposition and the principles of hermeneutics, the same cannot be said of Mormon leaders. What the Prophet says is scripture, and what he says supersedes past scripture. Twice a year in April and October, he generates "official" scripture in conferences. Other times, he trots to BYU to give devotional addresses or "quasi-official" scripture, but scripture nonetheless. It is not unusual to find prophecies that are inconsistent with one another. For example, the Mormon canon still prescribes polygamy, blood atonement (or human sacrifice) and anathematization of the black race (the "curse of Cain") although these teachings are jettisoned and no longer practiced. Modern day prophecy have distanced away from controversial doctrines, and have been reduced to a sanitized and shallow rhetoric of ethics and self-improvement. As a result of its "under-developed" theology, we find that Mormon scholars are heavily dependent on outside Christian literature to fill in the gaps. Though we may find guides like the Encyclopedia of Mormonism or Bruce McConkie's Mormon Doctrine, they fall short of the standard and comprehensiveness of extant mainstream scholarship. Let us examine one pivotal area of Mormonism: the Holy Spirit. Missionaries hinge on the testimony of the Spirit but their supporting literature does not satisfactorily explain or identify it. For instance: "What is, how and when do you feel the Spirit?" The answer, even from the all-knowing Prophets themselves, is inconclusive — it is peace, no it is a burning-in-the-bosom, no it is a small still voice. The plenary and Pentecostal activity of the Spirit is at best speculative because there is no tangible Mormon scholarship on pneumatology (eg what is the role of the Spirit in sanctification?), doxology (eg what is the role of the Spirit in worship?) or dispensational eschatology (eg what is the role of the Spirit in the end times?). Using non-Mormon analysis, the Mormon Spirit can be easily confused for 1 of 3 things: It is an existential energy that contextualizes human freedom and interaction with God, in a "demythologized" world — something that Rudolph Bultmann would think of. It is a "pharmakon" that cannot be decided and has no particular detectable characteristic because it is a matter of interpretation — something that Jacques Derrida would deconstruct. It is an immanent spiritual agent that "empowers the presence" of God and manifests charismatic gifts and healing — something that Gordon Fee would preach on. Is the church facing a "crisis of theology?" Not entirely. However, the absolute power of prophecy and the lack of theological discourse mean that it cannot provide adequate responses to the trends and interests that affect its congregation. It loses relevance and credibility. The voices of lobbies and minorities are silenced and ignored. For instance, how do you respond to the growing trend of egalitarian feminism. Already, some have clamored for the recognition of a "Prophetess" who presides over the Relief Society (Maxine Hanks 1992). Or what do you do when the church is accused of not having a proper "ecotheology," or a Mormon ethic for the environment? (Richard Foltz 2000) Indeed Mormon senators and representatives who convene in the US Congress have regularly ranked bottom in environment voting scores. (League of Conservation Voters 1999) If the church decides to engage in open-ended discussions and reexamination of its doctrines, it will risk alienating a lot of members. Theological revisionism is a stumbling block to growth. How can its members trust a church that keeps changing its mind? How can a church maintain respect when it already has such a colorful history of revising its doctrines? More perplexing to members is that the leaders do not clarify the status and effect of the church's labyrinth of teachings, and emphasize instead on bare basics. In one incident when TIME reporter David Van Biema asked Prophet Hinkley what he thought about the classic God-was-once-a-man doctrine, which his predecessor Lorenzo Snow had taught, he sloughed: "I don't know that we teach it. I don't know that we emphasize it... I understand the philosophical background behind it, but I don't know a lot about it and I don't think others know a lot about it." (4-Aug-1997, italics added) The inescapable consequence from the increasing Mormon-Evangelical academic dialogue, such as that between Stephen Robinson and Craig Blomberg in 1997, will be for the church to shy away from past tenets that the mainstream public find grossly unacceptable. This irregular pattern of behavior will motivate more and more members to research into the histories of the church. Take careful note that the LDS commitment to such dialogue stands on a slippery slope. Modern scholarship will subject the Book of Mormon to rigorous inquiries from archaeology, form criticism, Marxist dialectics and epistemology. In fact, evaluations in the past have gone so far as to reduce this book to a work of fiction! It is therefore high time for the LDS church to reconsider and renovate its spiritual faculty. If the church can eke the spiritual gratification that members look for, it will compensate for the shortfalls of science, history and cryptic teachings. The religious public of today seeks substance over form, experience over beliefs. The church has to rethink the custom of conscripting 14-year olds to "home teach" delinquent adults and families, and the endless repetition of testimony-bearing stumps on weekly sacrament meetings. By rushing converts to the responsibilities of priesthood without the sufficient investment of training or discipleship by qualified professionals, the church risks embedding a culture of mediocrity — one that has no quality control. At the end of the day, the church must cultivate a belief system that is informed not induced. Not everyone is a missionary who has to spend two years to do nothing but believe. Members should be given participation and independent access to the information that cultivates this belief — a process that "empowers" the consumer to think and reach an informed conviction.
The Future of Survival
Religion in the 21st century is a search for identity. Despite the incoming tide of global ecumenism, the reality is Protestants have become more Protestant, Orthodoxes have became more Orthodox and so forth. Ecumenism at the present stage is really a call to establish common denominators amid the diversity of groups. The Lausanne Covenant (1974), Chicago Statement (1978) and COCU Consensus (1999) are some veritable initiatives that have united churches by downplaying their differences. The fear that constructive dialogue and ecumenism will further undermine the loyalty of members remains unfounded, interdenominational cooperation thus far has not compromised the thriving identities of individual groups.
Where does the LDS church fit into all this? On one hand, it is ostracized by the conservative coalition and sits like a pariah on the fringe of the mainstream. Whilst Protestant-Catholic understanding may have accelerated in recent times, the evangelical opinion on Mormons leave much to be desired. When asked why he called Mormons a "cult," Bob Jones III of the right-wing Bob Jones University said on impulse: "Mormonism is pantheistic!" (Larry King Live, 3-Mar-2000) On the other hand, there is a resistance on the LDS part to reform itself. To elbow its way into the mainstream is to betray the "restorationism" of Joseph Smith that set the LDS apart from the rest of the generic non-LDS "abominable church."
The strongest identity and legitimacy of Mormonism have always been "social proof." It may not have the strength of tradition like the Orthodox community. It may not wield the weight of martyrdom like the Protestant forefathers. It may not broker world peace and humanitarianism like the Catholic papacy. But it does have a set of values that exhibits darn good demographics. It may not be super-spiritual, but it is a remarkable story of "social engineering" — with real results! This is its comparative advantage, its niche. The onus is on the LDS church to highlight these results as a triumph of Mormon values rather than as a triumph of Judeo-Christian values.
The LDS church has arrived at the crossroads. It is caught between the political agenda to move mainstream and affect the "larger culture" (Jan Shipps 1997), and the innate desire to guard its values and traditions more jealously in a transient environment.
Shawn Skalebund of Northern Arizona University sketches the picture: "Just at the Israelites were left in the wilderness for forty years to try and find themselves... I see the Mormons going off to the Great Basin to be left alone to worship how they may but in the years since have lost their way — meaning they really don't know who they are anymore. They have lost the meaning of trying to forget oneself for the good of the whole, the community, the holy, the creation."
There is finally the million dollar question: "Will the church ever reach mainstream?" In the Zeno Paradox, it was illustrated that for an entity A to reach B, it must first reach a point in-between, i.e. C; and for C to reach B, it must first reach D and so forth. Frustrating as it is, it underlies the principle that a full transition or transformation can never take place, because it undeniably entails the baggage of history, integrity and identity. Rather, we should view Mormonism as part of a larger movement that shapes the religious landscape in the new millennium, and not simply as an institution that seeks to expand its territorial wings.
Implicit from above is a twofold response. The spectator outside will do no wise to stem the flow of this prodigious movement. The constituent inside can do no wise to stop it from happening either. Let nature take its course and if needs be, patience and understanding of the times.
© 2000 Ed H. Yong
All Rights Reserved
(Posted with author's permission.) |
The hotel lobby also houses different Christmas Trees on display created by known personalities in the city. They even have a real pine tree as Christmas tree, located near the doorway of Kave restaurant and Christmas Village Display.
To help, we are encouraged to purchase Christmas ornaments and the proceeds of which will benefit Balay Canosa Foundation children. as a return, they will put up an ornament or a card to the LKK Luxe Hotel Tree bearing your name on it.
hope to see your name on the tree mga higala, while you are there, please also try the christmas kakanin on display at the Lobby Lounge. the puto bumbong and freshly brewed coffee is perfect afternoon delight. |
476 N.W.2d 523 (1991)
SCHOOL SISTERS OF NOTRE DAME AT MANKATO, MINNESOTA, INC., Appellant,
v.
STATE FARM MUTUAL AUTOMOBILE INSURANCE COMPANY, Respondent.
No. C5-91-829.
Court of Appeals of Minnesota.
October 29, 1991.
Thomas B. Wieser, John C. Gunderson, Meier, Kennedy & Quinn, Chartered, St. Paul, for appellant.
Michael J. Ford, John A. Nelson, Quinlivan, Sherwood, Spellacy & Tarvestad, P.A., St. Cloud, for respondent.
Considered and decided by RANDALL, P.J., and SCHUMACHER and KALITOWSKI, JJ.
*524 OPINION
SCHUMACHER, Judge.
Appellant School Sisters sought survivors economic loss benefits from respondent State Farm following the death of Sister Delores Wagner, who was struck and killed by an automobile. Both parties moved for summary judgment. The trial court granted State Farm's motion for summary judgment, holding that a non-human could not be considered a "dependent" for purposes of survivors economic loss benefits. School Sisters appeals. We affirm.
FACTS
The parties stipulated to the relevant facts. Appellant School Sisters of Notre Dame at Mankato, Minnesota, Inc. (School Sisters) is a Minnesota non-profit corporation. In 1989, School Sisters was comprised of approximately 585 religious women of the Catholic faith. The members of School Sisters take a vow of, among other things, poverty. Pursuant to their vow of poverty, each member vows "to be dependent upon the community in the use and disposition of material goods." The members express their vow of poverty by "holding all things in common, living simply, sharing materially and spiritually, receiving gratefully and reverencing created things."
One of the members of School Sisters, Sister Delores Wagner, was employed as principal at St. Francis School in Benson, Minnesota. For Sister Wagner's services, School Sisters received $950 per month plus benefits of $278.41 per month. On September 28, 1989, while a pedestrian, Sister Wagner was fatally injured when she was struck by a motor vehicle insured by respondent State Farm. State Farm paid medical, hospital and funeral expenses on behalf of School Sisters in the approximate sum of $1,500.
School Sisters sought survivors economic loss benefits from State Farm. State Farm denied that any survivors economic loss benefits were payable, and School Sisters commenced the present action. Both parties moved for summary judgment.
The trial court granted State Farm's motion for summary judgment. The trial court determined that although School Sisters depended on the income of its members, a non-human, such as a non-profit corporation, could not be considered a "dependent" for purposes of survivors economic loss benefits. School Sisters appeals.
ISSUE
Did the trial court err in determining School Sisters is not entitled to survivors economic loss benefits?
ANALYSIS
1. STANDARD OF REVIEW
Summary judgment is appropriate when there is no genuine issue as to any material fact and a party is entitled to a judgment as a matter of law. Minn.R.Civ.P. 56.03. On appeal from a summary judgment, this court must determine whether there are any genuine issues of material fact and whether the trial court correctly applied the law. Offerdahl v. Univ. of Minn. Hosps. & Clinics, 426 N.W.2d 425, 427 (Minn.1988). The trial court's grant of summary judgment in the present case was based on its application of the No-Fault Act to undisputed facts. Statutory construction is a question of law which this court reviews de novo. A.J. Chromy Constr. Co. v. Commercial Mechanical Servs., Inc., 260 N.W.2d 579, 582 (Minn. 1977).
2. SURVIVORS ECONOMIC LOSS BENEFITS
As an initial matter, State Farm contends School Sisters lacks standing to bring this action because it has not appealed the trial court's determination that it is not a person or an insured under the State Farm policy. We disagree. The question before the court is whether a non-human entity, School Sisters, can be a dependent. School Sisters does not claim to be an insured; School Sisters claims to be a dependent of an insured.
*525 Survivors economic loss benefits are among the mandatory basic economic benefits which must be included in every automobile insurance policy issued in Minnesota. See Minn.Stat. §§ 65B.42(1), 65B.44, subd. 6 (1990). These benefits are intended to
cover loss accruing after decedent's death of contributions of money or tangible things of economic value, not including services, that surviving dependents would have received from the decedent for their support during their dependency had the decedent not suffered the injury causing death.
Minn.Stat. § 65B.44, subd. 6. Under the statute, certain people are presumed to be dependents of a deceased person:
(a) a wife is dependent on a husband with whom she lives at the time of his death; (b) a husband is dependent on a wife with whom he lives at the time of her death; (c) any child while under the age of 18 years, or while over that age but physically or mentally incapacitated from earning, is dependent on the parent with whom the child is living or from whom the child is receiving support regularly at the time of the death of such parent. Questions of the existence and the extent of dependency shall be questions of fact, considering the support regularly received from the deceased.
Id. (emphasis added).
The statute lists three categories of persons who are presumed to be dependents. The enumerated presumed dependents do not include corporations. In addition to persons presumed to be dependents, the statute indicates an intent to create a category of persons whose dependent status is a question of fact. Peevy v. Mutual Servs. Casualty Ins. Co., 346 N.W.2d 120, 122 (Minn.1984). Where general language in a statute follows an enumeration of specific subjects, the general language is presumed to include only subjects of a class similar to those enumerated. This canon of statutory construction is known as ejusdem generis. See Core v. City of Traverse City, 89 Mich.App. 492, 500, 280 N.W.2d 569, 573 (1979). Applying this doctrine to the present case, we believe the trial court was correct in concluding that a non-human cannot be a dependent for purposes of section 65B.44, subd. 6.[1]
In addition, under the statute, payment of survivors economic loss benefits must cease when the recipient ceases to be dependent. Minn.Stat. § 65B.44, subd. 6. A nonprofit religious corporation, however, may have perpetual duration. Minn.Stat. § 300.13, subd. 3 (1990). This perpetual duration is inconsistent with the termination of benefits contemplated by section 65B.44, subd. 6.
DECISION
The doctrine of ejusdem generis and the fact of perpetual corporate existence preclude recovery by a corporation of survivors economic loss benefits.
Affirmed.
RANDALL, Judge, dissenting.
I respectfully dissent.
NOTES
[1] We do not decide whether any individual members of School Sisters might have a claim for such benefits. We are only concerned in this case with the corporate entity.
|
“You want us to wash our hands?” asked Fadi Mesaher, the Idlib director for the Maram Foundation for Relief and Development. “Some people can’t wash their kids for a week. They are living outdoors.”
Syrian doctors believe the virus has already swept into the camps, with deaths and illness that bear the hallmarks of the outbreak. But the international response has been slow to nonexistent, according to more than a dozen experts and Syrian medical professionals.
The World Health Organization has not yet delivered coronavirus testing kits to the opposition-held northwest, despite making its first delivery of such kits to the Syrian government more than a month ago.
Doctors said the delay has probably allowed the virus to spread undetected for weeks in a uniquely dangerous environment.
“We currently have cases that are similar, and we’ve had people die,” said Dr. Mohamed Ghaleb Tennari, who manages the Syrian American Medical Society’s hospitals in the region. “But unfortunately because we don’t have the test, we can’t confirm that these cases are truly corona or not.” |
VANCOUVER -- When you think of retail giant Walmart, you may think of great bargains, or the death of small businesses, or convenience. What you probably don't think about is the software behind the supply chain that enables Walmart to offer its "everyday low prices." That would be OpenStack.
In a keynote and panel discussion at OpenStack Summit, Amandeep Singh Juneja, Walmart Lab's Senior Director for Cloud Operations and Engineering, explained that "Walmart's decision to invest in cloud infrastructure might not be something you'd expect from a brick and mortar retailer with over $480-billion in annual revenue," but it was a necessity.
Why? Because to keep a supply chain running that can profitably deliver goods at very low prices, Walmart needs software that can track 245-million customers a week in 11,000 stores in 27 countries. On top of that Walmart is moving to eCommerce 3.0 with 11 e-commerce websites that had to handle 1.5 billion page views over 2014's Black Friday weekend.
To do this, Juneja said "Walmart has always relied on cutting-edge technology, from satellites in the 80s to OpenStack today, to fuel our growth: At the same time Walmart Global eCommerce is growing at a rate of more than 30 percent per year."
On top of that, Walmart's "customers want to use our eCommerce platform from many different access points, not only from their home computers but also from mobile phones, tablets, and kiosks within Walmart retail stores and they're always expecting a seamless experience."
To meet this demand "Walmart needed a technology stack that would scale to meet the explosive demand, flexible enough to build applications that adapt to ever-changing user preferences, and with enough big data smarts to predict what customers want and provide them with recommendations."
After long consideration, Walmart bet in August 2014 that OpenStack was that technology. It moved its entire ecommerce stack to OpenStack running on Canonical's Ubuntu Linux.
Walmart chose OpenStack as its cloud platform, not only because it's best of the breed, but also because open-source software comes with several big advantages. The biggest of these is that with OpenStack, Walmart avoided long-term lock-ins with any single proprietary vendor.
In the nine months since Walmart started using OpenStack the company has built an OpenStack Compute layer with more than 150K cores and counting. Next, Walmart will add more block storage and venture into software-defined networks using OpenStack projects such as Neutron and Cinder. The company is also currently building a multi-petabyte object storage using Swift. By the 2015 holiday season Walmart will have also moved its OpenStack cloud to 2014's Juno release.
So, the next time someone tells you that OpenStack isn't mature enough to be used in a business product environment, just remind them that the world's largest retailer has bet the house that OpenStack is ready for prime-time.
Related Stories: |
Back to Santiago
April 17, 2019
I decided to write this series of posts out of the order in which I experienced the places, so this entry takes us back to Santiago after a week in Easter Island.
My boutique hotel, the Casa Bellavista, could not have been more different from the dreary B&B I stayed in the weekend before. It was strategically located in the midst of the Bellavista barrio, a hip and artsy neighborhood with plenty of restaurants, wine bars, cafés and shops. Patio Bellavista, a covered city block, is chock full of shops and restaurants and is great for nightlife.
The distinguishing feature of the barrio is the abundance of murals painted on storefronts and walls. I guess you could call it graffiti, but it’s so much more, obviously the work of very talented artists.
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
Wandering the streets of Bellavista is a treat for the eyes!
My friend Laura, who was on the Easter Island trip and also the expedition to Bali in January, had secured a driver for a day, so Arturo took us to the Underraga Winery in the Maipo Valley, just a short hop south of Santiago. The winery was established in 1885, and we were able to taste sauvignon blanc, carmenere, and a 100% cabernet sauvignon, finishing with a dessert blend of sauvignon blanc and semillon. All yummy! It’s going into fall here, and the grapes have all been harvested, so we got a peek at the process of selecting and destemming.
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
We wandered through the rustic village of nearby Pomaire, home to many potters — all of whom seemed to make the same thing: ollas in every size imaginable, bean pots, round, square and rectangular baking pans, outdoor flower pots, pitchers and cups. While the town is normally crowded with tourists on weekends, the crafters take Mondays off, so many shops were closed and the town had a sleepy air, with dogs taking their siestas in the street.
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
A restaurant tried to lure us in with a 10 kilo empanada! I got indigestion just looking at it!
We wound our way down the coast through the exceptionally lovely community of Santo Domingo Beach, landing at Isla Negra, made famous by Pablo Neruda, who built his favorite house here overlooking the wild, windswept beach. Huge rock formations add interest to the landscape, and one even has a bust of the poet carved on top. The rip tides and huge waves make the area too dangerous to swim, but one can imagine how this untamed place inspired him. This is where he died and is buried. Once again, it being Monday, the house was closed to visitors; on the other hand, there were no hordes of tourists to contend with.
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
My final days in Santiago took me by metro to Pueblo los Dominicos, a rustic village at the western edge of the city, with a warren of streets lined with shops selling high-quality handicrafts: hand-knitted shawls and sweaters, jewelry, pottery, paintings — you name it.
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
That bird you see above is a chicken I named Phyllis Diller, which was pecking around in a cage with a number of other birds (which is why she’s sort of blurry). I saw an amazing variety of colorful chickens during this trip.
One morning I took the funicular up Cerro San Cristóbal, the highest point in Santiago, with its expansive views of the sprawling city, and St. Christopher looking down from the peak. Especially up here you see the smog that bathes the skyline every day (except after heavy rains) and obscures any glimpse of the Andes. Santiago lies in a basin, with the Andes to the east and a coastal mountain range to the west, trapping all the nasty brown air.
These two shots show an unprocessed image right out of the camera (left), and one with dehaze applied during processing (right) . Goes to show you how much more the camera can see than I can with my naked eye — and how thick the smog is.
OLYMPUS DIGITAL CAMERA
OLYMPUS DIGITAL CAMERA
I left Santiago and Chile with more to see and more restaurants to try; more day trips, to Valparaiso and back to Isla Negra when Neruda’s house is open; more wineries to visit; and excursions further afield to Torres del Paine National Park in Patagonia and the Atacama Desert. For a long thin country — nearly 2700 miles long but, on average, only 110 miles wide — it has remarkable geographic diversity and stunning beauty. I loved it, and want to go back!
Amazing murals! Love Phyllis Diller the chicken! My free day was on a Monday and everything I wanted to do was closed- even the zoo and the funicular! I’m so happy you got to a winery and the coast in Chile! I should have scheduled a few more days to see more. I, like you, would like to go back to explore Atacama and Patagonia. Welcome home! |
Less Coal, But More What?
It’s not hot yet across the entire U.S., but it soon will be. Power plant rules haven’t changed yet, but they will.
With the unofficial start of summer just around the corner, utilities and independent system operators are looking for ways to relieve peak loads and congestion on the electricity grid for the coming season and down the road.
Although every region of the country claims it has adequate generation for even the hottest days of summer, each ISO is also looking forward as U.S. Environmental Protection Agency rules will take affect in coming years.
Grid operators are planning now for how to replace coal with natural gas, along with a side of demand response and a dash of renewables. Many of the changes won’t come for years, but the planning is happening now and changes to pricing and rules, will happen ahead of the EPA rules.
“From a PJM perspective, the lights aren’t going to go out,” Paul Sotkiewicz, chief economist at PJM Interconnection, said during a Restructuring Today webinar on Wednesday.
There are two EPA rules that are putting pressure on older coal generation, the cross-state air pollution rule, which is currently on stay until further ruling, and the MATS rule, which regulates mercury and other heavy metals and is scheduled to go into effect in April 2015.
PJM Invests in Transmission
In PJM’s territory, the problem is not a lack of capacity. Sotkiewicz said that there’s quite a bit of natural gas that isn’t being used to its full capacity. PJM expects that nearly 14,000 megawatts of coal-fired generation will retire by 2016. Most of the plants are over 40 years old or 400 megawatts or less, which makes up about 30 percent of PJM’s current coal fleet.
In anticipation of the changes, the capacity auctions for the 2015 to 2016 year in PJM territory procured a record amount of new generation for one year, nearly 5,000 megawatts. Almost all of the new generation is gas-fired. For the first time ever, new combined-cycle gas plants are the same price as a northern Appalachian coal plant, according to Joseph Bowring, independent market monitor for PJM and president of Monitoring Analytics.
Overall, PJM has 164,561 megawatts of capacity resources. Along with new gas resources, the capacity auction procured nearly 15,000 megawatts of demand response and energy efficiency. Energy efficiency, solar and wind saw double-digit growth since the year before, although the renewables are still just a drop in the bucket in terms of generation. Solar, for example, increased to 56 megawatts, a 22 percent increase from the year before.
To combat retiring coal generation, PJM recently announced $2 billion in transmission upgrades. There will be more than 130 projects that range from substation upgrades to rebuilding transmission lines. More than half the projects will be in Ohio, where there is a lot of coal retiring. However, the upgrades could also be a boon to renewables like wind, which has various transmission constraints.
MISO Seeks More Wind, Demand Response
The Midwest Independent System Operator is facing essentially the same problem as PJM, although it is even more pronounced, since more than 70 percent of its fleet is coal-fired. MISO also has transmission constraints that are being revisited, but there have been no announcements about upgrades similar to what PJM is doing.
The constraints will mean a change to demand response rules, said Jameson Smith, manager of regulatory studies at MISO. “Demand response qualification requirements and deployment procedures will be reviewed and given a potential increase in use.”
For MISO, there’s more wind that’s currently slated to be built than gas, but that could also change in coming years, said Smith. Any new gas could need new pipeline infrastructure, which can take at least five years to develop. At this time, “there’s limited ability to increase existing gas-fired unit capacity,” said Smith. But wind needs transmission too, which means that no matter what comes on-line to replace coal in the next five years, there will have to be substantial investment.
ERCOT Pushes Up Prices
In Texas, ERCOT is already planning to spur new generation by raising the system-wide offer cap. Last summer, prices hit $2,500 per megawatt-hour as ERCOT’s grid was strained by high temperatures. If a ruling now being considered is approved, that could jump to at least $4,000 as early as this August, and perhaps rise considerably more in coming years. “There’s a consensus that the system-wide offer cap will have to go significantly higher,” Ken Anderson, commissioner of the public utility commission of Texas, said during a Restructuring Today webinar. “We need to at least double it -- and maybe triple it.”
A bump to the SWOC will also come with a change to a variety of other rules, including a potential increase of 200 megawatts to come from energy efficiency programs and a decision that could allow waste gas and energy storage to play in ERCOT’s markets. The cost of a negawatt is still considerably cheaper than building new generation.
Anderson said that he believed that the commission was removing most of the barriers to energy storage coming into the wholesale market, and now it was just a matter of economics. The next few years will also be rosier for negawatts. “Eventually, I’d like to get demand response out of energy efficiency completely and into the competitive space,” he said during the webinar. “We need to give some certainty to where the market will be in 2014, 2015 and beyond.” |
In view of the current status of file management, the traditional management methods can no longer meet the actual needs. Informatization of archive management urgently requires a more advanced and complete solution for automated management systems. In this context, an archive management system based on radio frequency identification (RFID) technology emerged.
By RFID technology, the classified files are continuously monitored, their status and whereabouts are known at any time, and they can be managed and controlled accordingly, effectively avoiding loopholes in traditional management tools.
The working principle is: an RFID electronic tag is affixed to each file box or secret product that needs to be controlled, and the information stored in the tag and the name, category, and secret level of the file or secret product are passed through the software of the information management system. Information such as belonging archives is bound and the archives are put into the filing cabinet.
1. Double Encryption: The opening of the cabinet door adopts the fingerprint authentication and the digital password dual authentication method to control the access. Only when the fingerprint and the password are verified correctly, can the cabinet door be opened.
2. Smart Inventory: Click the “Inventory” button on the touch screen interface. After waiting for dozens of seconds, all file names in the cabinet will be displayed on the screen and the total number of files will be counted.
3. Smart alarm: When you want to open the file cabinet, if the fingerprint is incorrect or the fingerprint password does not match, the file cabinet itself will sound an alarm and prompt and retain the record on the control platform.
When the door opening time exceeds the specified time, the cabinet itself will sound an alarm. The control platform will also have an alarm and store it in the form of a log.
After the file or confidential product was borrowed, it was not returned on time and there will be an alarm and records will be kept.
4. Status display: After starting the intelligent file management and control system software, all the file cabinets in the management will be displayed on the interface. In the log below, the working status of each file cabinet will be displayed. All the configuration information in the management file cabinet can be passed. The "Parameter Configuration" function is modified.
6. Business setting: The application setting function consists of three parts, namely, setting the closing prompt alarm time, setting the morning and evening inventory time, emergency unlocking and active inventory. "Close prompt delay" means the upper limit of time for closing the door; "morning inventory time" and "afternoon inventory time" refer to the time for setting automatic checking in the morning and afternoon.
7. Log Management: Through the "Log Management" button on the main interface of the intelligent file management and control system software, you can easily query the system operation log, such as screening according to time, operation type and other information, and screening against file data or confidential products.
Xminnov's one stop service of RFID security solution include RFID research and development, RFID production, personalized services, RFID hardware and software development etc. |
Mirror yesterday and revealed some bad news for Newcastle United, but some good news for QPR, as he admitted that the Magpies don’t have an option to buy Loic Remy at the end of his season-long loan.
Loic Remy’s Newcastle career hasn’t exactly started well, as the Frenchman is yet to wear the famous black and white shirt in a Premier League encounter.
The 26-year-old has been ruled out of Newcastle’s opening fixtures against Manchester City and West Ham with a niggling calf injury, and he still has to face a trial on suspicion of gang rape next month.
So he may never even play for Newcastle and now Director of Football Joe Kinnear has revealed that, contrary to prior reports, there is no option to buy as part of the deal.
Kinnear firstly said: “I sanctioned the one-year loan deal for Loic Remy, and if it goes pear-shaped I will take responsibility for it,” so it seems like Joe has been acting alone.
He continued: “But if he scores goals and does well for us, Alan will be happy with our end of the deal; the player will be happy because he will come into contention for a World Cup place with France,” which is all fine.
However, Kinnear concluded: “If both those things happen, Remy will go back to QPR as a World Cup player with a higher value than when he joined them, so everyone will come out of it well.”
Thus Kinnear is inferring that Remy will go back to QPR whatever happens during his time at Newcastle, which just seems ludicrous.
It would be amateurish not to have an agreed fee in place for the end of the deal, but then that’s a word that describes Newcastle’s activities pretty much perfectly right now. |
Tom Brady talks up Falcons quarterback Matt Ryan’s MVP candidacy
After New England Patriots quarterback Tom Brady fell short of an All-Pro selection, it appears the 39-year-old passer will not be winning NFL MVP this season.
After missing the first four games of the season due to suspension, Brady blitzed the league. The 17-year quarterback completed 67.4 percent of his passes for 3,554 yards and set the NFL record for touchdown to interception ratio tossing 28 scores to just 2 picks.
Even still, Falcons quarterback Matt Ryan earned 29 votes for the All-Pro quarterback position compared to just 14 for Brady.
And in his weekly interview on WEEI’s “Kirk and Callahan” program, Brady mentioned Ryan’s name unprompted when asked if it would mean something to him if he didn’t win MVP.
“I’ve been fortunate to win it (2007, 2010), so it’s a very cool thing because you think about how far you’ve come as a player. Everyone starts and kind of has their own football experience,” Brady said.
“To realize, ‘Man, I won that award — they only choose one guy and they chose me’ is very cool. But I think Matt has had an incredible year. I think he is as deserving as anybody. He’s got that team playing well.” |
Angry Tour de France riders want to put doping talks to rest
Porto Vecchio: Tour de France riders protested angrily on the eve of this year's race on Friday against the burden of suspicion they have been forced to carry because of a previous generation's doping.
"It is degrading to be dragged through the mud and be run down by some who look to make money on our backs," the riders said in a statement on Friday after Le Monde newspaper printed a headline quoting Lance Armstrong saying it was impossible to win the Tour de France without doping.
"Enough is enough!" a riders' statement said after Armstrong's statement that the Tour can't be won without doping.
American Armstrong, who was stripped of his seven Tour titles for doping and later admitted taking performance-enhancing drugs, had been speaking about the 1999-2005 era during which he crushed the opposition.
Earlier in the week, sports daily L'Equipe said a urine sample from Frenchman Laurent Jalabert in 1998 showed traces of the banned blood-booster EPO when it was re-tested in 2004.
"Enough is enough!!!!!!" the riders' statement further read. "Today the limits of the bearable have been reached!!!! We have for many years shown our will to work for a flawless fight against doping.
"If there was a culture of doping in the 1990s, in the past 15 years our sport has been fighting alone against the plague of doping. We are professional bike riders and we are proud of that. But do not treat us like sub-citizens as you have been doing for too long," the riders' statement continued.
In 2011, blood tests accounted for 35 percent of tests in cycling while 17.6 percent in athletics and less than 6 percent in tennis. Cycling pioneered biological passports in 2008, a programme that according to the World Anti-Doping Agency (WADA) "indirectly reveals the effects of doping".
'RACING IS CLEANER'
Garmin-Sharp manager Jonathan Vaughters told Reuters he thought cycling was cleaning up its act. "The science points to a trend that racing is cleaner, that it is possible to win the Tour de France clean," he said.
"When you look at the climbing speed and look at the numbers. The science firmly points to the fact that doping is on the decline. Racing is slower even though the equipment and the training are better. To me, there is only one explanation for that - doping has decreased a lot," Vaughters added.
Tour de France director Christian Prudhomme backed the riders' complaints, saying that almost every year a doping-related story breaks days before the Tour. I can appreciate that some agendas have nothing to do with cycling but 14 times in the last 15 years, it cannot be a coincidence," he told Reuters.
"For some, the Tour is a unique opportunity to communicate their message."
Referring to the report about Jalabert, Prudhomme added: "Why give on June 24, 2013, the name of a rider whom it is said doped after a control that occurred on July 22, 1998?"
Garmin-Sharp rider David Millar, a former doper turned anti-doping campaigner, thought it was essential cycling learned from previous mistakes. "What needs to change is that we need complete truth and transparency into what happened in the 15-year era of the 1990s and early 2000s," said the former Armstrong team-mate, who served a two-year ban after admitting taking EPO. "So we can understand what mistakes were made and we can make sure those mistakes do not happen again. "Because I think racing has cleaned up a lot; I think the Tour de France can be won clean."
For all the effort it has been making to clean up, cycling cannot let its guard down, according to Vaughters. "What I hope is that we gather information from the past to find a way to correct those mistakes the next time around." |