Datasets:

OpenScholar

/

OpenScholar-DataStore-V2

like 0

Follow

OpenScholar 10

IGBT-Based Cost-Effective Energy-Recovery Circuit for Plasma Display Panel A new insulated-gate-bipolar-transistor (IGBT)-based cost-effective energy-recovery circuit (ERC) for a plasma display panel (PDP) is proposed. Since it is composed of two small resonant inductors and four power diodes instead of the conventional large auxiliary circuit, it features a simpler structure, less mass, fewer power devices, higher efficiency, and lower cost. Since all its power switches are turned off under the zero-current switching operation, IGBTs can be employed as power switches. Moreover, the very stable and uniform light emitted from a PDP proves the high quality of screen. Therefore, it is well suitable for the consumer-affordable hang-on-the-wall TVs which have the desirable features such as thinness, lightness, high efficiency, low price, etc. To confirm the validity of the proposed ERC, a comparative analysis and experimental results based on a whole ac PDP driver equipped with the proposed circuit for the 42-in PDP are presented

30522770

BounAra: Deployment of Markov Models In recent years, much research has been devoted to the improvement of telephony; on the other hand, few have refined the intuitive unification of courseware and replication. In fact, few statisticians would disagree with the analysis of massive multiplayer online role-playing games, which embodies the confirmed principles of randomized cyberinformatics. Our goal here is to set the record straight. BounAra, our new methodology for secure models, is the solution to all of these issues.

149653020

Photopolymerizable Hydrogels Made from Polymer‐Conjugated Albumin for Affinity‐Based Drug Delivery As a drug delivery vehicle, biodegradable albumin hydrogels can combine the high binding capacity of albumin with the structural stability of a polymeric hydrogel network to enable controlled release of small molecules based on both binding affinity and physical interactions. In the present study, we report on the development of a hybrid hydrogel composed of albumin conjugated to poly(ethylene glycol) (PEG) for drug delivery applications where controlled release is accomplished using the natural affinity of the drugs to the serum albumin. Bovine serum albumin was conjugated to PEG‐diacrylate having a molecular weight of 1.5, 4, or 10 kDa to form a PEGylated albumin macromolecule (mono‐PEGylated or multi‐PEGylated). Biodegradable hydrogels were formed from the PEGylated albumin using photopolymerization. Two model drugs, Warfarin and Naproxen, were used for equilibrium dialysis and release experiments from the hydrogels, both having relatively low molecular weights and a known high affinity for albumin. Equilibrium dialysis experiments showed that multi‐PEGylation of albumin significantly decreased the drug affinity to the protein compared to non‐PEGylated controls, irrespective of the PEG molecular weight. However, the results from drug release experiments showed that mono‐PEGylation of albumin did not change its natural affinity to the drug. Comparing the release profiles with a Fickian diffusion model provided strong evidence that hydrogels containing mono‐PEGylated albumin exhibited sub‐diffusive drug release properties based on the affinity of the drug to the tethered protein.

95984520

From Bohemia to Balintawak This chapter provides a seemingly unusual, but potentially illuminating, vantage point from which to approach the cosmopolitan dimensions of the Philippine Revolution of the late nineteenth century — the Bohemian town of Litoměřice. It recounts the visit of Dr. José Rizal, the great Filipino novelist and celebrated progenitor of Philippine nationalism, to Leitmeritz and his relationship with Ferdinand Blumentritt, a local gymnasium teacher and avid student and scholar of Philippine history and society. The chapter provides a coherent narrative account, one whose emplotment follows the nationalist logic so prevalent in the study of Southeast Asian history. On the one hand, the revolution is said to have been led from above by urban — and highly urbane — educated young men familiar from Benedict Anderson's Imagined Communities, Filipino nationalists who emerged from Spanish colonial schools in the Philippines. On the other hand, the Philippine Revolution is also said to have been driven from below by a broader pool of the Filipino masses, by peasants and fishermen across the provinces of the archipelago, and by artisanal laborers in Manila and other port cities. The chapter argues that the struggles leading up to the Philippine Revolution can be understood in terms of what scholars have termed the “Culture Wars” of the late nineteenth century, a transcontinental if not global conflict pitting “anticlerical” scientists, Freemasons, liberals, and republicans against the Catholic Church in its ultramontane incarnation.

244332570

Medial prefrontal cortical control of reward‐ and aversion‐based behavioral output: Bottom‐up modulation How does the brain guide our actions? This is a complex issue, where the medial prefrontal cortex (mPFC) plays a crucial role. The mPFC is essential for cognitive flexibility and decision making. These functions are related to reward‐ and aversion‐based learning, which ultimately drive behavior. Though, cortical projections and modulatory systems that may regulate those processes in the mPFC are less understood. How does the mPFC regulate approach‐avoidance behavior in the case of conflicting aversive and appetitive stimuli? This is likely dependent on the bottom‐up neuromodulation of the mPFC projection neurons. In this review, we integrate behavioral‐, pharmacological‐, and viral‐based circuit manipulation data showing the involvement of mPFC dopaminergic, noradrenergic, cholinergic, and serotoninergic inputs in reward and aversion processing. Given that an incorrect balance of reward and aversion value could be a key problem in mental diseases such as substance use disorders, we discuss outstanding questions for future research on the role of mPFC modulation in reward and aversion.

232115070

FGF signaling establishes the anterior border of the Ciona neural tube The Ciona tadpole is constructed from simple, well-defined cell lineages governed by provisional gene networks that have been defined via extensive gene disruption assays. Here, we examine the patterning of the anterior neural plate, which produces placodal derivatives such as the adhesive palps and stomodeum, as well as the sensory vesicle (simple brain) of the Ciona tadpole. Evidence is presented that the doublesex-related gene DMRT is expressed throughout the anterior neural plate of neurulating embryos. It leads to the activation of FoxC and ZicL in the palp placode and anterior neural tube, respectively. This differential expression depends on FGF signaling, which inhibits FoxC expression in the anterior neural tube. Inhibition of FGF signaling leads to expanded expression of FoxC, the loss of ZicL, and truncation of the anterior neural tube.

10609320

Changing epidemiology of liver disease in Asia: Dual infection of HBV and HCV Transmission of hepatitis B virus (HBV) and hepatitis C virus (HCV) is similar regarding the mode of transmission and related risk factors. Therefore, it is not rare to encounter dual HBV/HCV infection in populations at risk of parenteral exposure to hepatitis viruses. Besides, in HBV endemic countries before the era of global HBV vaccination, dual HBV/HCV infection was clinically significant likely because of HCV superinfection over pre‐existing HBsAg carriage. Universal childhood HBV vaccination was implemented worldwide since 1992. Public education programs for prevention of new hepatitis viral infections have been actively promoted recently by World Health Organization. Apart from preventive measures, potent anti‐HBV agents effective in the control of viral replication have been introduced gradually in the past three decades. Direct acting antiviral agents capable of curing HCV infection in more than 97% of patients with chronic hepatitis C have also been widely implemented in the past decade. These interventions will change the epidemiology of new HBV or HCV mono‐infection and dual HBV/HCV infection. Understanding the evolution in the epidemiology of dual HBV/HCV infection is important for evaluation of current public health policy towards infectious disease control in different countries. The changing prevalence of dual HBV/HCV infection in certain Asia‐Pacific countries will be re‐visited based on endemicity of HBV or HCV, as well as in populations at risk of parenteral viral infection.

237147770

Molecular Imprinted Polymer Based Thermo-Sensitive Electrochemical Sensor for Theophylline Recognition A novel molecular imprinted polymer (MIP) based thermo-sensitive electrochemical sensor was fabricated by an electropolymerization method using N-isopropylacryamide and theophylline as the monomer and the template molecule, respectively. The [Fe(CN)6]3−/[Fe(CN)6]4− was used as an electrochemical probe to investigate the electrochemical behavior of the prepared sensor. The influence factors including electropolymerization cycles, the utilization of cross-linkers, and the extraction solution were investigated in detail. The sensor exhibited excellent thermo-sensitive behavior to environmental temperature stimuli and displayed a good recognition capacity for template molecules from its analogues. This approach may allow the application of this type of intelligent electrochemical sensor for stimulus-responsive recognition of template molecules.

96935620

Planning Postdisaster Operations in a Highway Network Vital lifelines in the event of a disaster, transportation networks support evacuation activities, emergency logistics, and the restoration of daily activities. The rapid recovery of surviving transportation network operations immediately after a disaster is critical for the well-being of communities. The focus here is on planning highway operations in the recovery period after a disaster. A bilevel network design model with choice inter-dependencies was developed for choosing the strategies necessary to maximize the performance of a surviving highway network. A genetic algorithm was coupled with a traffic assignment procedure to solve the associated problem. Results on a real-size network in Greece under two disaster scenarios indicate both adequate computational performance and significant improvement in network performance indicators.

109660070

Comparison of numerical and experimental results of the flow in the U9 Kaplan turbine model The present work compares simulations made using the OpenFOAM CFD code with experimental measurements of the flow in the U9 Kaplan turbine model. Comparisons of the velocity profiles in the spiral casing and in the draft tube are presented. The U9 Kaplan turbine prototype located in Porjus and its model, located in Älvkarleby, Sweden, have curved inlet pipes that lead the flow to the spiral casing. Nowadays, this curved pipe and its effect on the flow in the turbine is not taken into account when numerical simulations are performed at design stage. To study the impact of the inlet pipe curvature on the flow in the turbine, and to get a better overview of the flow of the whole system, measurements were made on the 1:3.1 model of the U9 turbine. Previously published measurements were taken at the inlet of the spiral casing and just before the guide vanes, using the laser Doppler anemometry (LDA) technique. In the draft tube, a number of velocity profiles were measured using the LDA techniques. The present work extends the experimental investigation with a horizontal section at the inlet of the draft tube. The experimental results are used to specify the inlet boundary condition for the numerical simulations in the draft tube, and to validate the computational results in both the spiral casing and the draft tube. The numerical simulations were realized using the standard k-e model and a block-structured hexahedral wall function mesh.

250674170

A new approach to solve EMI related problems when designing reliable high power converters using precomputed electromagnetic models The coupling between low power control circuits and high power switching components which generate high parti/partt greatly decreases the power converters reliability and increases substantially the product time-to-market when introducing a new design. The quantification of these couplings is traditionally estimated using the finite elements method which requires a high technical expertise for complex three-dimensional circuit geometries. To solve this problem, the authors propose a new approach based on the use of a precomputed electromagnetic models library which includes all the metallic conducting structures present in modern power converters. The transistor case as well as the printed circuit board copper traces are included in this library. This library allows to identify quickly and visually the high coupling areas with higher flux density in the converter tridimensional layout. Also, it helps to develop remedial strategy to avoid it. In this paper, the electromagnetic behavior of a bidirectional matrix converter cell using the proposed approach is analyzed. The magnetic field of the matrix cell is analyzed and numerically computed. Experimental results are shown to demonstrate the viability of the proposed new approach. I.

25561220

[Fiber and nutrients intake in children with chronic constipation]. OBJECTIVES The aim of this case-control study was to evaluate the intake of fiber alimentary and macronutrients in constipated children. METHODS Fifty-four children (aged 2-12 yr) with diagnosis of chronic functional constipation were investigated at the Pediatric Hospital, "Universidade Federal do Rio Grande do Norte", Natal, RN, Brazil. They were age and sex matched with 50 patients without constipation. A standard questionnaire was applied to both groups and a 3 day dietary record was analyzed by computer software. RESULTS The mean age at onset of symptoms was 29,0 +/- 26,1 months. There was not sex predominance and no difference about nutritional condition between the groups. Constipated children ate less fiber, proteins, lipids, carbohydrates and less caloric and protein adequated percentuals. The proportion of children who ate less dietary fiber than recommended (age + 5 g /day) was greater in the constipated group (83,3%) than in controls (66,6%); odds ratio 2,6. CONCLUSION Constipated children ate less fiber and macronutrients than children without constipation. Intake of dietary fiber below the minimum recommendation is a risk factor for chronic functional constipation in children.

25812720

Solution structure of SpoIIAA, a phosphorylatable component of the system that regulates transcription factor sigmaF of Bacillus subtilis. The establishment of differential gene expression in sporulating Bacillus subtilis involves four protein components, one of which, SpoIIAA, undergoes phosphorylation and dephosphorylation. We have used NMR spectroscopy to determine the solution structure of the nonphosphorylated form of SpoIIAA. The structure shows a fold consisting of a four-stranded beta-sheet and four alpha-helices. Knowledge of the structure helps to account for the phenotype of several strains of B. subtilis that carry known spoIIAA mutations and should facilitate investigations of the conformational consequences of phosphorylation.

12489870

A CROSS-SECTIONAL STUDY OF PHYSICAL ACTIVITIES AND SMOKING HABIT ON BONE MASS AMONG MALE INDUSTRIAL WORKERS IN PADANG, WEST SUMATRA Labors, especially in industry, spend most of their time in the workplace. Several factors including physical activity and lifestyle of workers such as smoking habit in the workplace that will affect labors health. Besides that, bone mass is one of the factors that influence the health quality of workers, especially for hand-operated labor. This research aims to define the relationship between physical activity and smoking habit on bone mass in male industrial labors. The study is a preliminary study to recognize variables that influence bone mass and the base for defining the weight limit for lifting activities. This investigation was purposed determining physical activity and smoking habit of labors in the workplace, as well as calculating the bone mass of workers. The respondents required were 93 male labors in Padang, West Sumatra. Bone mass measuring tools were used to calculate labor's bone mass, while questionnaires were used to define the smoking habit of labors and physical activity. Physical activity, as well as smoking habit, were significantly affected the bone mass (p<0.05) of the workers. This study result explains that physical activity and smoking habit are factors that are associated with bone mass status for young male workers in Padang, West Sumatra.

213903370

Caregivers' perspectives on the social and physical environmental factors associated with the play of their children with palliative care needs: A Q methodology study. Children living with palliative care needs are less engaged in play, despite its importance in their lives. The environment may have a crucial role in supporting these children's play. Understanding the importance and impact of environmental factors on children's play is essential to being able to support their participation in play. Data were collected from caregivers (mostly parents) of children living with life-threatening/limiting conditions, who were between 5 and 11 years old. Thirty-nine participants were recruited from two children hospitals and two hospices in Kuwait and in the United Kingdom. The participants' perspectives were explored using Q methodology. By-person factor analysis was used to explore the ranking of each statement. Content analysis was used to analyse the participants' verbal comments. The most important environmental factors were the need for others to share play and get assistance to facilitate play. However, this is not always possible as these conditions, the life-threatening/limiting conditions, may be socially isolating. Children also experience limitations in accessing play resources that match their abilities and meet their play needs. Being aware and responsive to children's play needs is essential for building appropriately supportive play environments for children living with life-threatening/life-limiting conditions.

247407420

Performance issues of distance relays for shunt FACTS compensated transmission lines In this paper, the performance of distance relays when applied to transmission system equipped with shunt FACTS device, Static Synchronous Compensator (STATCOM) is described. The aim of the proposed study is to evaluate the performance of distance relays when STATCOM is incorporated at the mid point of transmission lines for voltage control. A detailed model of STATCOM and its control strategy is presented. The presence of these devices significantly affects apparent impedance seen by the distance relays due to their rapid response to different power system configurations. The distance relay is evaluated for different loading conditions and for different fault locations. The faults are created during various pre-fault loading conditions. The studies are performed on 400KV and 132KV systems and the results are presented. Simulation studies are carried out using transient simulation software, PSCAD/EMTDC.

39749020

Where to now for health-related journal peer review? Peer review of health-related manuscripts has enormous power in determining what is published in health-related journals, and what makes its way into health policy and clinical practice. However, peer review is at times ethically problematic and not always effective in achieving its goals. Over the past 25 years, a large number of debates about, and studies of, the peer review process has been published. Despite this, there is limited agreement about the strengths and weaknesses of peer review, and limited evidence about whether peer review achieves its goals and whether interventions to improve it have been successful. The authors argue that this state of affairs is not acceptable and that there is a need to systematise efforts to understand and improve the review process.

6283420

Secular trends of obesity in Iran between 1999 and 2007: National Surveys of Risk Factors of Non-communicable Diseases. BACKGROUND Obesity is a rapidly progressing pandemic and a central feature of the metabolic syndrome. There is no solid evidence on the recent trends of obesity in Iran. In this study we present the secular trends of overweight and obesity among Iranian adults (25-64 years old) within an 8-year period (1999-2007). METHODS The analyses were performed on the datasets of three cross-sectional national surveys: The National Health Survey-1999 (n = 21,576), National Surveys of Risk Factors for Non-Communicable Diseases (SuRFNCD)-2005 (n = 70,945), and SuRFNCD-2007 (n = 4,186). RESULTS The overall prevalence of obesity increased from 13.6% in 1999 to 19.6% in 2005 and 22.3% in 2007 [odds ratio (OR) = 1.08 per year; P < 0.001]. For overweight subjects, the rates were, respectively, 32.2%, 35.8% and 36.3% (OR = 1.02 per year; P < 0.001). During these years, the mean body mass index (BMI) (kg/m(2)) increased from 25.03 in 1999, to 26.14 in 2005, and 26.47 and 2007 (P < 0.001). The increase in prevalence of obesity was seen in both males (OR = 1.09 per year; P < 0.001) and females (OR = 1.07 per year; P < 0.001) and both urban (OR = 1.07 per year; P < 0.001) and rural (OR = 1.10 per year; P < 0.001) residents. CONCLUSIONS In conclusion, the present study highlighted the rapid growth of obesity during recent years in Iran. Our findings indicate the crucial necessity of primary

39272020

prevention programs to counteract this undesired condition.

39272020

Gating the bacterial mechanosensitive channel MscL in vivo YggB and MscL are the major mechanosensitive channels in Escherichia coli, and each can rescue the double knockout mutant from osmotic downshock. However, the role of MscL in wild-type bacteria is in question, not only because cells without MscL survive severe osmotic downshocks, but because 1.8 times more suction is required to gate MscL than YggB under patch clamp. Here, we extend previous evidence [Ajouz, B., Berrier, C., Garrigues, A., Besnard, M. & Ghazi, A. (1998) J. Biol. Chem. 273, 26670–26674] to show that downshock gates MscL in vivo even in the presence of YggB. We have made this determination by engineering a channel we can structurally modify in vivo (Leu-19→Cys MscL). MscLs with charges in their constrictions are known to open easily and transiently to substates and stop cell growth. In this study, we use downshock to stretch this region open to allow attachment of a charged thiosulfonate reagent MTSET+, thereby creating a toxic channel. Therefore, channel opening can be monitored by loss of colony forming units. By this measure, we find that an ≈800 mmol/kg downshock from 1,200 mmol/kg medium opens Leu-19→Cys MscL in the presence of YggB, but a downshock of only ≈400 mmol/kg is required in the absence of YggB. In parallel, Leu-19→Cys MscL, stretched open by large sustained suction in the presence of MTSET+ in voltage-clamped patches, subsequently flickers open with little suction. These observations show that MscL opening is triggered by a specific downshock, even in the presence of YggB, that YggB

27500570

buffers MscL gating in vivo, and that residue 19 becomes exposed upon channel opening.

27500570

A mixed integer linear programming solution for single hoist multi-degree cyclic scheduling with reentrance This article considers single hoist multi-degree cyclic scheduling problems with reentrance. Time window constraints are also considered. Firstly, a mixed integer programming model is formulated for multi-degree cyclic hoist scheduling without reentrance, referred to as basic lines in this article. Two valid inequalities corresponding to this problem are also presented. Based on the model for basic lines, an extended mixed integer programming model is proposed for more complicated scheduling problems with reentrance. Phillips and Unger's benchmark instance and randomly generated instances are applied to test the model without reentrance, solved using the commercial software CPLEX. The efficiency of the model is analysed based on computational time. Moreover, an example is given to demonstrate the effectiveness of the model with reentrance.

120163870

Roles of chemokines in thymopoiesis: redundancy and regulation. Thymus is the primary lymphoid organ involved in the development of thymocytes. Maturation related events of thymocytes within thymus, especially the widely discussed directional migration of thymocytes, is regulated by chemokines via chemokine receptors mediated signaling pathway. Multiple types of chemokines and chemokine receptors, as components of the network-interaction within thymic microenvironment, are involved in the thymopoiesis. It appears that these chemokines are functionally redundant and such phenomenon may be explained not only by the promiscuous, non-one-to-one matching between ligands-receptors within CXC or CC chemokine subfamily, but also by the various spatio-temporal expression patterns within different cell types and developmental stages. The redundancy and regulation of thymus expressed chemokines and chemokine receptors during thymocyte development are herein discussed.

12063570

Ground-Water Flow Analysis in the Slope Above Shum Wan Road On August 13, 1995, a slope above Shum Wan Road failed due to high rainfall and caused a 30-m section of Nam Long Shan Road to collapse. The slope consists of weathered tuffs with a clay layer on the surface ofthe failure. A hydrogeological study was carried out by saturated finite difference grid model, MODFLOW, for the slope at the Shum Wan Road area. From the ground-water model, it was found that the ground-water level reached three meters below the ground surface during failure. The model is sensitive to recharge and specific yield. The presence of the clay layer helped to maintain a high ground-water level. Stability analyses were performed using SLOPE/W. The result of stability analyses showed that the factor of safety, F, decreased due to the rising initial water table. On the 31st of July, the factor of safety was 1.41, and dropped down to 1.01 on the 3rd of August. The factor of safety again rose back to 1.31 on the 8th of August and it finally dropped down to 0.99 on the morning of the 13th of August. The present study showed that the antecedent rainfall had some influence on stability of the slope. The amount of water in the form of seepage, which drained out from the seepage surface from the lower part of the slope, is quantified and found to be 790 m• Preventive measures can be taken by inserting horizontal pipes in the slope to drain out the ground

7766320

water in the form of seepage or by covering the slope with shortcrete or chunam.

7766320

Survival of patients after ST-elevation myocardial infarction: external validation of a predictive biomarker model. To the Editor: Early risk stratification has the potential to play an important role in ST-elevation myocardial infarction (STEMI)1 patients who are to be treated with primary percutaneous coronary intervention (PCI). Several risk scores have been developed for STEMI patients; however, most risk scores require many variables, making them more difficult to use in clinical practice. The long-term prognostic value of biomarker measurements for glucose, N-terminal pro–brain type natriuretic peptide (NT-proBNP), and estimated glomerular filtration rate (eGFR) taken early after admission has recently been demonstrated for STEMI patients (1). Damman and coworkers have shown that a multimarker model including these biomarkers improved the prediction of mortality over that provided by established risk factors derived from the Thrombolysis In Myocardial Infarction (TIMI) score, which include age, body mass index, diabetes, hypertension, systolic blood pressure, heart rate, anterior myocardial infarction, and time to treatment (1, 2). Moreover, a simplified risk score developed with the 3 biomarkers identified low-, intermediate- and high-risk subgroups with respect to mortality. The best way to evaluate such a model is to perform an external validation study of the predictors in a new and independent …

35975070

Book Review: Advances in Parenteral Nutrition with certain carcinomas; tables devoted to the conclusively established associations; data on ABO-distribution in the healthy, by age and sex; and a comprehensive review of the literature on fertility perhaps on the lines of Edwards' critique of 1957. In this edition, the fast-expanding HLA-system shares a subordinate position with the non-ABO blood groups, the haemoglobins, red-cell enzymes, plasma proteins and so forth. In future, however, its growth and importance will doubtless demand a separate volume. T M ALLAN Assistant Director Aberdeen & NE Scotland Blood Transfusion Centre

78464920

A Career and Learning Transitional Model for Those Experiencing Labour Market Disadvantage Research investigating the learning and career transitions of those disadvantaged in the labour market has resulted in the development of a four-component model to enable dis-advantaged groups to navigate learning and career transitions. The four components of the model include: the self-concept; learning and recognition; career and life planning; and new literacies. The focus of this paper will be on the career and life planning component. The research utilised a sequential mixed model design, which consisted of two phases. Phase one of the research involved a Learning Survey of approximately 250 labour market program participants in which quantitative data analysis techniques were used. Phase two involved the development of the model and testing in the field. A formative evaluation of the model in the field was undertaken, utilising a combination of both qualitative and quantitative data collection and analysis. The field test was undertaken with a labour market program for women over 45 years of age wishing to re-enter the workforce. The research has resulted in the development of a model that offers career development researchers and practitioners an alternative holistic, group-based and community-based approach to career development for disadvantaged groups.

37581320

The effect of Coulomb interactions on nonlinear thermovoltage and thermocurrent in quantum dots. In the present work, we theoretically study the nonlinear regime of charge transport through a quantum dot coupled to the source and drain reservoirs. The investigation is carried out using a nonequilibrium Green's function formalism beyond the Hartree-Fock approximation. Employed approximations for the relevant Green's functions allow to trace a transition from Coulomb blockade regime to Kondo regime in the thermoelectric transport. Effects arising when electrons move in response to thermal gradient applied across the system are discussed, including experimentally observed thermovoltage zeros.

9712220

An application of the decomposition method for second order wave equations In this paper we study the solution of a linear and nonlinear damped wave and dissipative wave equations by Adomian decomposition method. We illustrate that the analytic solutions and a reliable numerical approximation of the damped wave and dissipative wave equations are calculated in the form of a series with easily computable components. The nonhomogeneous problem is quickly solved by observing the self-canceling"noise"terms whose sum vanishes in the limit. In comparison to traditional techniques, the series based technique of Adomian decomposition method is shown to evaluate solutions accurately and cheaply.

2047170

Frontier Equity Markets: Risk Parity Lessons for Asset Allocation Are frontier markets the next emerging markets? And if so, should global equity investors include them in their portfolios? From a risk parity perspective, investors can benefit from a frontier markets allocation well in excess of the market weight of the asset class. A risk parity portfolio tends to outperform a market-cap-weighted portfolio during periods of positive equity returns, while delivering comparable returns during crisis periods. Historical data shows that even if portfolio managers cannot follow a risk parity asset allocation strategy due to benchmark tracking considerations, overweighting frontier markets can help them outperform their benchmarks during upside periods without increasing downside risks significantly.

154454520

Delayed hypersensitivity and granulomatous response after immunization with protein antigens associated with a mycobacterial glycolipid and oil droplets. A myocardial glycolipid (P3) mixed with protein antigens in oil-in-water emulsion induced lasting delayed hypersensitivity (DH) and granulomatous inflammation after intradermal injection into guinea pigs. This did not occur when P3 and bovine serum albumin (BSA) were given in Freund's incomplete adjuvant. The oil-in-water emulsions consisted of microscopic oil droplets suspended in aqueous medium. By separating oil and aqueous phases from BSA + P3 emulsion it was shown that antigen retained with oil droplets led to DH and granuloma formation. The association of antigen with oil droplets was P3 dependent and was quantitated with 125I-labeled BSA. The same phenomenon occurred with 125I-labeled rabbit gamma-globulin (RGG) + P3 emulsion. Fluorescein-conjugated RGG was observed in a particulate state within or on oil droplets in emulsion containing P3. These physical characteristics of antigen + P3 emulsion appeared to be important for immunogenicity.

41869820

The Choice of Adopting Inflation Targeting in Emerging Market Economies : Do Institutions Matter ? Over the last decade, a growing number of emerging market economies has adopted inflation targeting as monetary policy framework. In a recent paper, Freedman and Laxton (2009) ask the question “Why Inflation Targeting?”. This paper empirically investigates this question by analyzing a large set of institutional and political factors potentially associated with a country’s choice of IT in a sample of 50 emerging countries over the period of 1986-2005. Using a panel probit model, our results suggest that central bank independence, policymakers’ incentives and characteristics of political system (such as the number of veto players in government, the political stability, or the degree of federalism) play an important role in the choice of IT regime, while financial market development not matters.

8408670

The Vitamin D Status Among Tibetans UVB from the sun and intake from food are the only human sources of vitamin D. Tibet is a unique region for comparisons of these sources: (1) it lies at a low latitude and at a high altitude and has very large annual fluences of UVB; (2) the traditional Tibetan food is poor in vitamin D. Blood samples were taken from 63 persons of different age, with different occupations and staying at different places. UVB doses at these places were measured. The samples were analyzed by a standard radioimmune assay for determination of the serum concentration of 25 hydroxyvitamin D (25(OH)D). The main finding was that among nomads, there seems to be severe vitamin D deficiency (serum levels of 25(OH)D < 30 nm). We tentatively propose that the low level of 25(OH)D of nomads is related to their clothing and sun exposure habits. For persons of other occupations (students, teachers and farmers) the levels are higher, although a significant fraction of these persons also have lower levels than 75 nm, by many regarded as a limit for insufficiency related to a number of negative health conditions. The annual dose of vitamin D‐generating UVB is about five times larger in Lhasa than in Oslo. Despite this, the average vitamin D status seems to be similar, except in the case of nomads. This phenomenon is certainly related to food habits. In conclusion, the 25(OH)D status among nomads in Tibet appears to be alarmingly low. However, for people of other occupations the status

205950620

is more normal.

205950620

[A rarely isolated bacterium in microbiology laboratories: Streptococcus uberis]. Streptococcus uberis is a gram-positive bacterium that is mostly responsible for mastitis in cattle. The bacterium rarely has been associated with human infections. Conventional phenotyphic methods can be inadequate for the identification of S.uberis; and in microbiology laboratories S.uberis is confused with the other streptococci and enterococci isolates. Recently, molecular methods are recommended for the accurate identification of S.uberis isolates. The aim of this report is to present a lower respiratory tract infection case caused by S.uberis and the microbiological methods for identification of this bacterium. A 66-year-old male patient with squamous cell lung cancer who received radiotherapy was admitted in our hospital for the control. According to the chest X-Ray, patient was hospitalized with the prediagnosis of ''cavitary tumor, pulmonary abscess''. In the first day of the hospitalization, blood and sputum cultures were drawn. Blood culture was negative, however, Candida albicans was isolated in the sputum culture and it was estimated to be due to oral lesions. After two weeks from the hospitalization, sputum sample was taken from the patient since he had abnormal respiratory sounds and cough complaint. In the Gram stained smear of the sputum there were abundant leucocytes and gram-positive cocci, and S.uberis was isolated in both 5% sheep blood and chocolate agar media. Bacterial identification and antibiotic susceptibility tests were performed by VITEK 2 (Biomerieux, France) and also, the bacterium was identified by matrix assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) based VITEK MS system as S.uberis. The isolate

21405870

was determined susceptible to ampicillin, erythromycin, clindamycin, levofloxacin, linezolid, penicillin, cefotaxime, ceftriaxone, tetracycline and vancomycin. 16S, 23S ribosomal RNA and 16S-23S intergenic spacer gene regions were amplified with specific primers and partial DNA sequence analysis of 16S rRNA polymerase chain reaction (PCR) products were performed by 3500xL Genetic Analyzer (Applied Biosystems, USA). According to the partial 16S rRNA gene sequencing results, bacterium was confirmed as S.uberis. This report makes a significant contribution to the number of case reports of human infections caused by S.uberis as the identification was performed by current microbiological methods in our case. In conclusion, S.uberis should be evaluated as an opportunistic pathogen among the immunosuppressed patients and in addition to phenotypic bacteriological methods, the other recent microbiological methods should also be utilized for the identification.

21405870

Sensitivity Analysis of Epistemic Uncertainty on Input Parameters and System Structure Using Dempster-Shafer Theory In this article, a method is proposed to conduct a global sensitivity analysis of epistemic uncertainty on both system input and system structure, which is very common in early stage of system development, using Dempster-Shafer theory (DST). In system reliability assessment, the input corresponds to component reliability and system structure is given by system reliability function, cut sets, or truth table. A method to propagate real-number mass function through set-valued mappings is introduced and applied on system reliability calculation. Secondly, we propose a method to model uncertain system with multiple possible structures and how to obtain the mass function of system level reliability. Finally, we propose an indicator for global sensibility analysis. Our method is illustrated, and its efficacy is proved by numerical application on two case studies.

233906720

Type VII collagen and squamous cell carcinoma Recessive dystrophic epidermolysis bullosa (RDEB), an inherited blistering disease, is caused by mutations in COL7A1, the gene encoding type VII collagen (Col7), which is the main component of anchoring fibrils. Affected individuals have decreased or undetectable Col7 with skin and mucosal fragility, blistering and scarring. Over 78 7% of patients with severe generalized RDEB will die from metastatic squamous cell carcinoma (SCC) by the age of 45 years, suggesting a link between loss of Col7 and aggressive SCC. Treatment of RDEB by attempting to restore Col7 by protein, cell or gene therapy is currently the subject of intensive research, and existing and likely future clinical trials. In this issue of BJD, Pourreyron et al. engineer SCC keratinocytes derived from RDEB tumours and various controls to overexpress Col7 (up to 35 5-fold vs. normal endogenous levels), using recombinant COL7A1 cDNA in a retroviral vector. They show that high levels of Col7 expression generally induce increased migration and invasion in RDEB SCC keratinocytes, associated with an increase in activation of the phosphoinositide 3-kinase pathway, a pathway involved in regulation of migration/invasion. The authors conclude that caution should be exercised when considering therapeutic strategies where delivery of Col7 is likely to exceed greatly the levels seen under normal physiological conditions. Different models of loss/overexpression of Col7 produce varied results; however, in my opinion, the consensus view is veering towards loss of Col7 being proinvasion. Data from a Ras/IjBa-driven tumorigenesis model suggest that the noncollagenous (NC1) domain of Col7 is necessary for tumour

44376470

formation by RDEB keratinocytes. However, many RDEB tumours do not express Col7. In ultraviolet-induced SCC cell lines expressing Col7, knock-down of Col7 using small inhibitory RNA promoted cell invasion and disorganized epithelial differentiation in vitro with an increase in transforming growth factor (TGF)-b signalling, a known contributor to cancer progression. In the hypomorphic mouse model of RDEB (10% Col7 expression), chemical carcinogenesis protocols produced more highly invasive tumours compared with benign papillomas in wild-type mice. The extracellular matrix composition in RDEB is permissive for tumour development, and invasion and tumour formation of RDEB SCC keratinocytes can be decreased by overexpressing Col7 in dermal fibroblasts. Finally, detailed proteome analysis of fibroblasts of patients with RDEB compared with control fibroblasts showed a decrease in basement membrane matrix components and an increase in dermal matrix proteins, TGF-b and metalloproteinase expression, but not activity, in RDEB. Patients with dominant dystrophic epidermolysis bullosa who have one normal COL7A1 allele, hence approximately 50% normal Col7, rarely develop SCC. One would hope that restoring Col7 expression in RDEB to close to 50% of normal levels would decrease TGF-b signalling, improve wound healing, decrease scarring and chronic inflammation, and restore basement membrane function towards normal levels, thus reducing the risk of SCC. However, Col7 is a powerful matrix signalling molecule and, as cautioned by Pourreyron et al., if overexpression is planned, preclinical dose–response studies will be needed in animal models.

44376470

L2 Writing Task Representation in Test-Like and Non-Test-Like Situations This mixed-methods study investigates writers’ task representation and the factors affecting it in test-like and non-test-like conditions. Five advanced-level L2 writers wrote two argumentative essays each, one in test-like conditions and the other in non-test-like conditions where the participants were allowed to use all the time and online materials they needed. The writing was done on computers, and we recorded the writing process and keystrokes using the Screen Capture Video and Inputlog programs. We audio recorded stimulated recall interviews after each writing session, with the writers reporting and commenting on their writing strategies and their reasons for following them. The findings of this study suggest that there are several factors that play a role in task representation, such as previous education, personal beliefs, and task conditions. Although these factors were present in all participants’ responses, the differences in the writers’ approaches to interpret and execute the writing were marked. The results highlight various pedagogical issues and options related to teaching writing in general and to the place of task representation on writing programs in particular.

203071570

Relaxation drinks and their use in adolescents. OBJECTIVES A new class of beverages called relaxation drinks advertises calming effects and an easy way to wind down when life gets stressful. This article examines these drinks in the context of their use in adolescents. METHODS A review of the literature relevant to relaxation drinks and their functional ingredients was conducted. RESULTS The beverages contain ingredients such as melatonin, valerian, kava, tryptophan, and other products traditionally thought to play a role in sleep, sedation, or neurocognitive function. Studies of the efficacy and safety of these supplements are limited and many have significant methodological limitations. Despite appropriate warnings placed on the labels of relaxation drinks, marketing is cleverly designed to appeal to young consumers and often evokes the experiences produced by alcohol and drug use. CONCLUSION Although moderate consumption of these beverages by healthy individuals is likely safe, an objective reduction in stress is improbable and associated adverse effects are possible.

206146970

[Distant wave interaction in the early embryogenesis of the loach Misgurnus fossilis L]. Groups of loach (Misgurnus fossilis L.) embryos of different ages were kept in different quartz cuvettes for 20-24 h so that only optic contact between the groups was possible. Subsequent observations showed that parameters of their development deviated from those in the control groups. Wave-mediated biocorrection proved to have both positive and negative effects, depending on the developmental stages of the interacting groups. Changes in spectral characteristics and polarization of biological radiation affected the results of the experiments. Various developmental abnormalities caused by distant wave-mediated interactions of embryos and specific to each combination of developmental stages and conditions of optic communication are described.

33209770

Comparing Theory of Mind Deficits and Symptoms of Attention Deficit -Hyperactivity in Smokers and Non-smokers Background and purpose: Previous studies have shown that smokers are deficient in social skills and it is possible that they have deficits in theory of mind. The aim of this study was to compare theory of mind and symptoms of attention deficit-hyperactivity between smokers and non-smokers. Materials and methods: This study was conducted in 160 man (80 smokers and 80 nonsmokers) who were selected by convenience sampling. Data was collected using the Persian version of Reading Mind from Voice (FVRMFV), Conners' Adult ADHD Rating Scale and a demographic questionnaire. Data was analysed in SPSS V. 16 applying multivariate analysis of variance and independent t-test. Results: The findings showed higher scores of smokers in attention deficit (P<0.005), hyperactivity (P<0.006), impulsivity (P<0.007), problems in self-imagination (P<0.004), and whole range of ADHD symptoms (P<0.001) compared to non-smokers, but in mind reading test, smokers performed significantly weaker than non-smokers (P<0.001(. Conclusion: Deficits in theory of mind is seen in smokers, therefore, deficits in social skills could be due to this reason in such groups.

54764660

In defense of weight phobia as the central organizing motive in anorexia nervosa: historical and cultural arguments for a culture-sensitive psychological conception. OBJECTIVE Recently several proposals at dropping weight phobia as the central criterion for the differential diagnosis of anorexia nervosa have been advanced, aiming at establishing a new diagnostic category including any self-induced weight loss. The validity of weight phobia as a diagnostic criterion is defended. METHODS After summarizing clinical arguments, four groups of culturally or historically remote cases of self-induced weight loss or refusal of food are analyzed in regard to the presence of weight phobia and clinical similarity to modern anorexia nervosa (extreme fasting in the Third World, in the European late Middle Ages, early modern times, and late 19th century). RESULTS It is demonstrated that modern Western anorexia nervosa with weight phobia is clearly distinct from other groups of cases of extreme fasting without weight phobia. DISCUSSION It is concluded that the psychological motive of weight phobia should remain the central criterion for the differential diagnosis of anorexia nervosa.

401010

Experimental Rock Deformation—the Brittle Field This is a monograph by one of the most distinguished authorities on this subject. It is an attempt to present the subject-matter in such a way that suitably advanced students will be able to understand the framework of the subject and to be able quickly to gain access to the literature. Because the work lists more than 25o0 cited references, it will serve enduringly as a reference source for those actively engaged in research in rock deformation. Though the approach emphasizes the fundamental physical aspects of brittle behaviour of rocks, i.e. a 'materials science' approach, the book should prove invaluable particularly to those interested in engineering and Earth science applications Because it is basically a guided tour of the literature the text is essentially non-mathematical. The author has clearly considered that it is more important to set out concisely the conceptual framework of each aspect of theory and experimental data. No mathematical derivations 9 of formulae are given at all. The text is organized into seven main chapters. These deal first with experimental techniques and generalizations about the phenomenology of the brittle failure stress. Then follows a discussion of the problems of the approach to a theory of brittle failure. The bulk of this chapter is built around the attempts to set up physical models of the fracture process, based on the work of Griffith. The next chapters deal with friction and sliding phenomena. Then follows a review of the physical property changes that accompany loading towards failure, through the peak

131089310

stress and into the post-failure regime. Dilatancy, acoustic emission, elastic wave velocity, and attenuation changes and transport property changes are dealt with here. The concluding chapter considers the transition from brittle to ductile behaviour, which tends to occur with increasing confining pressure and temperature. There is an appendix, which aims to introduce the basic ideas of the 'fracture mechanics' approach used in engineering. In view of its growing importance in rock mechanics, I was surprised that it was relegated to the status of an appendix. Furthermore, little attention was given in this section to the phenomenon of slow crack growth and atomistic aspects of fracture. However, it is difficult to be critical of a work that sets out to present an author's personal overview of a large and growing subject area. Different readers will inevitably feel that the coverage is patchy in some areas. There can be no doubt that this book will be widely welcomed as a valuable and unique contribution to an interdiscipline between materials science, engineering rock mechanics, structural geology, and geophysics.

131089310

8-Prenylnaringenin, the phytoestrogen in hops and beer, upregulates the function of the E-cadherin/catenin complex in human mammary carcinoma cells. The E-cadherin/catenin complex is a powerful invasion suppressor in epithelial cells. It is expressed in the human MCF-7 breast cancer cell line family, but functionally defective in the invasive MCF-7/6 variant. Previous experiments have shown that IGF-I, tamoxifen, retinoic acid and tangeretin are able to upregulate the function of this complex in MCF-7/6 cells. We investigated the effect of 8-prenylnaringenin (8-PN), the phytoestrogen present in hops and beer, on aggregation, growth and invasion in MCF-7/6 cells. 8-PN was found to stimulate E-cadherin-dependent aggregation and growth of MCF-7/6 cells in suspension. These effects could be inhibited by the pure anti-estrogen ICI 182,780. 8-PN did not affect invasion of MCF-7/6 cells in the chick heart assay in vitro. In all these aspects 8-PN mimics the effects of 17beta-estradiol on MCF-7/6 cells.

42394110

Landmark advances in the development of erythropoietin This is a Minireview covering landmarks or milestones in the development of erythropoietin (EPO). Thirty-nine landmark advances have been identified, which cover the period 1863–2003. Several reports are included that directly support these original landmark advances. This Minireview also updates some of the advances in EPO research since my last Minireview update on EPO published in this journal in 2003. The areas of EPO research updated are: sites of production; purification, assay and standardization; regulation; action; use in anemias; extraerythropoietic actions; adverse effects; and blood doping. The new reports on the use of EPO in the therapy of myocardial infarction; stroke and other neurological diseases; diabetic retinopathy and other retinal diseases are also covered.

26360360

Collaborative Context-Awareness and Reasoning for Optimised Service Delivery This paper illustrates an infrastructure based system designed to collect and interpret contextual information in ubiquitous networking environments. Its aim is to support optimised delivery of end-user telecommunication services as well as provide to network self-management functions enriched information about users' perspective on the network performance they get for the services and applications they use. To achieve these aims we exploit collaborative context-awareness amongst end-users and their devices. Per-user and per-network aggregation of contextual information allow the representation of respectively the users' telecommunication environment and the networks' performance status. The paper also contributes a novel decision making algorithm to deliver telecommunication services that match in the best possible way end-user's requirements to current environment resources in terms of e.g. available networks and devices. The resulting model, based on fuzzy logic principles, makes the best service delivery decision given a set of network/device selection criteria and accounts also for relative importance amongst those criteria as well as for the quality of context information.

12435410

Biosynthesis and characterization of silver nanoparticles prepared using seeds of Sisymbrium irio and evaluation of their antifungal and cytotoxic activities Abstract Recent studies have shown that green synthesis of silver nanoparticles (AgNPs) and their application in the control of phytopathogenic fungi is a burgeoning field. Sisymbrium irio (Si) (London rocket) is a well-known weed that grows abundantly in Saudi Arabia from February to May. The present study is concerned with the rapid synthesis of silver nanoparticles from the aqueous seed extract of Si) in the presence of sunlight. The biosynthesized Si-AgNPs were characterized using UV-Visible spectroscopy (UV-Vis), energy dispersive X-ray (EDX) microanalysis, dynamic light scattering analysis (DLS), transmission electron microscopy (TEM), and Fourier transform infrared spectroscopy analysis (FTIR). The UV-Vis spectrum revealed a prominent surface plasmon resonance (SPR) absorption band (∼439 nm) characteristic of AgNPs. As revealed by TEM analysis, the Si-AgNPs were predominantly spheroidal in shape and measured between 4 and 51 nm, while the Z average of nanoparticles was 94.81 nm as revealed by the DLS spectrum. The FTIR spectrum displayed peaks related to important functional groups (amines, phenols, carboxylic acids, flavonoids, aromatic compounds, and esters) that aid in the reduction, encapsulation, and stability of AgNPs. The Si-AgNPs were further investigated against a panel of potent fungal phytopathogens that included Alternaria alternata, A. brassicae, Fusarium solani, F. oxysporum, and Trichoderma harzianum. The cytotoxic activity of the biosynthesized nanoparticles against human cervical cancer cell lines (HeLa) was also tested. Si-AgNPs at 80 µg·mL−1 demonstrated a marked reduction in mycelial growth and spore germination. Similarly, Si-AgNPs

248562460

exhibited dose-dependent cytotoxic activity against the HeLa cell line, with an IC50 value of 21.83 ± 0.76 µg·mL−1. The results of the present study demonstrate the robust cytotoxic and antifungal activities of Si-AgNPs. Based on the findings, Si-AgNPs can be exploited to design formulations that can effectively act as anticancer agents, controlling the proliferation of cancer cells while also combating fungal phytopathogens. However, future research to understand their toxicity mechanisms is needed.

248562460

RETINAL HAEMORRHAGES IN THE NEWBORN The present study shows the frequency and severity of retinal haemorrhages in 200 newborn, of which 100 were delivered spontaneously, 51 delivered by vacuum extractor and 49 by forceps. The incidence of retinal haemorrhages was highest in the vacuum group (50%), lowest in the forceps group (16%), while the spontaneously delivered children showed an incidence of 41%.

8441510

Comparison of Rigid and Flexible Transbronchial Needle Aspiration in the Staging of Bronchogenic Carcinoma In staging bronchogenic carcinoma by transbronchial needle aspiration (TBNA), rigid histology needles are generally preferred to flexible cytology needles owing to the widespread opinion that rigid needles have higher diagnostic yield and less false-positive results. The objective of this study was to compare the efficacy and safety of the rigid and flexible TBNAs in staging bronchogenic carcinoma to establish whether a flexible cytology needle method can replace the rigid needle. A prospective study was conducted in 138 consecutive patients with extra- or endobronchial masses suggestive of bronchogenic carcinoma and amenable to surgical procedures. All 8 mm and larger paratracheal, carinal, hilar and/or main bronchial lymph nodes determined before bronchoscopy by computed tomography (CT) were sampled by successive 18-gauge rigid and 21-gauge flexible TBNAs in the same session. The anatomic landmarks were followed precisely during TBNAs, and a proper technique applied in sampling and specimen processing. Malignant lymph node involvement was specified in 97 (72%) cases of bronchogenic carcinoma by rigid, and in 89 (66%) by flexible TBNA. There were 4 (100%) benign cases (3 with tuberculosis and 1 with sarcoidosis) of 101 (73%) with positive rigid TBNAs (82 with histological and 19 with cytological specimens). TBNAs determined malignant lymph node involvement in a total of 104 (78%) patients. Of 30 TBNA-negative patients, 14 were proven to have false-negative TBNAs by mediastinoscopy/mediastinotomy/minithoracotomy, and 16 to have true-negative TBNAs by thoracotomy. Thoracotomy confirmed true positivity in 52 rigid and 49 flexible TBNAs, and false

46782210

negativity in 4 rigid and 7 flexible TBNAs. Further staging was confirmed in these 7 cases. Four had proven false-negative results by both methods. The presence of small cell carcinoma (21) or N3 disease (27) presented a contraindication to thoracotomy in 48 TBNA-positive patients. Adequate-quality and malignant lymph node specimens were more frequently obtained by both techniques at advanced tumor and node stages. However, malignant lymph node invasion was significantly more frequent in rigid and flexible TBNA specimens only in the presence of advanced tumor status and abnormal endoscopic appearance. The sensitivities of rigid and flexible TBNAs were 74 and 70%, respectively (p > 0.05), but both had a specificity of 100%. Neither false-positive results nor serious complications other than hemorrhage of 30–100 ml (rigid: 5%, flexible: 2%) were encountered with either technique. These results indicate that in bronchogenic carcinoma, hilar and mediastinal lymph nodes can be staged by 21-gauge flexible TBNA (76%) as accurately as by 18-gauge rigid TBNA (79%) if a proper technique is applied and anatomic landmarks are followed precisely (p > 0.05).

46782210

Classification of Sculpture images Recognizing smooth objects, such as sculptures, is an unsolved problem in computer vision and pattern recognition. We study the sculpture features and aim to design a scalable classification of sculpture images. This paper serves as a design, implementation and result evaluation document, illustrating that the classification we implemented has a simpler structure and comparable matching performance. The classification we built can be used in a larger image retrieval system, as well as has potential extension on classifying other smooth objects.

6185710

Stability analysis of some periodic orbits in the hydrogen atom in parallel electric and magnetic fields The stability of some prominent periodic orbits in the hydrogen atom in parallel electric and magnetic fields is studied. For small field strengths, the application of classical perturbation theory allows for analytic treatments and provides useful information on possible types of classical motion and corresponding quantum states. Non-perturbative numerical and analytic stability analysis and calculations of the Liapunov exponent are performed for the straight-line orbit along the direction of the fields in the region of the zero-field ionization threshold. Bifurcation phenomena are discussed and related to recent photoexcitation experiments.

250798960

PLC Programmable Control Technology in the Mine Pit Transportation System This paper summarizes the definition, function, and characteristics of the programmable control technology, and especially analyzes the operation mode of the 750V DC traction power supply system, the protection setting, the defects of the original system and the factors influencing the safety of power supply. Aimed at the equipment of the PLC programmable control system used in the mine transportation system in recent years, combining parts of the PLC programmable control system equipment used and installed in Tong Ting Coal Mine, this paper introduces the role of the PLC programmable control system and the economic benefits and safety effect.

109716710

Non-determinism: An abstract concept in computer science studies Non-determinism is one of the most important, yet abstract, recurring concepts of Computer Science. It plays an important role in Computer Science areas such as formal language theory, computability theory, distributed computing, and operating systems. We conducted a series of studies on the perception of non-determinism. In the current research, we studied and analyzed undergraduate Computer Science students' solutions to assignments in a course on automata and formal languages. Our findings shed some light on students' perceptions of non-determinism, their tendency to use non-determinism, and the characteristics of their non-deterministic solutions. This paper describes the current research and its results, and suggests several teaching applications.

41928460

Power of 'phase 0' chronobiologic trials at different signal-to-noise ratios and sample sizes. Clinical trials would gain from incorporating 'Phase 0' chronobiologic pilot designs both from the viewpoint of (statistical) power and cost-effectiveness. Herein, this statement is documented by power computations and is further illustrated by clinical examples answering specific questions. Power computations show the merits both of chronobiologic designs (that assign samples at equidistant intervals to cover one full cycle of anticipated pertinent rhythms) and of chronobiologic analyses (the cosinor versus the analysis of variance). Randomized clinical trials would gain from incorporating a concern for timing as well as dosing in all three stages of clinical trials (Phase I, II and III focusing on toxicity, efficacy and a comparison with the current best treatment, respectively) and could be cost-effectively preceded by 'Phase 0' trials so as to detect, sooner and with smaller sample sizes, desired or undesired effects that may otherwise be missed.

27938610

Symptoms and signs in dementia: synergy and antagonism. This paper addresses the synergy and antagonism between symptoms and signs among 2,914 elderly Canadians diagnosed in 15 categories, including no cognitive impairment, cognitive impairment but no dementia, mild, moderate and severe forms of Alzheimer's disease and vascular dementia, 4 subtypes of possible Alzheimer's disease, Parkinson's dementia, unspecified other dementias and unclassified dementias Attention is paid to the relationships between symptoms and signs rather than conventional analyses which assume independent signs. We demonstrate that dementia progression and specific aetiologies have characteristic patterns of decline and destruction from the strong synergy that exists between symptoms and signs among the population with no cognitive impairment. These findings have potential implications for the incorporation of new diagnostic criteria into existing databases.

6778560

[Hyperspectral remote sensing image classification based on radical basis function neural network]. Based on the radial basis function neural network (RBFNN) theory and the specialty of hyperspectral remote sensing data, the effective feature extraction model was designed, and those extracted features were connected to the input layer of RBFNN, finally the classifier based on radial basis function neural network was constructed. The hyperspectral image with 64 bands of OMIS II made by Chinese was experimented, and the case study area was zhongguancun in Beijing. Minimum noise fraction (MNF) was conducted, and the former 20 components were extracted for further processing. The original data (20 dimension) of extraction by MNF, the texture transformation data (20 dimension) extracted from the former 20 components after MNF, and the principal component analysis data (20 dimension) of extraction were combined to 60 dimension. For classification by RBFNN, the sizes of training samples were less than 6.13% of the whole image. That classifier has a simple structure and fast convergence capacity, and can be easily trained. The classification precision of radial basis function neural network classifier is up to 69.27% in contrast with the 51.20% of back propagation neural network (BPNN) and 40. 88% of traditional minimum distance classification (MDC), so RBFNN classifier performs better than the other three classifiers. It proves that RBFNN is of validity in hyperspectral remote sensing classification.

25352810

Computational Screening of CCR5 Inhibitors as Potential Entry Inhibitor Microbicides Using 3D-QSAR Studies, Docking and Molecular Dynamics Simulation. BACKGROUND The chemokine receptor CCR5 acts as a co-receptor for HIV binding and it is considered as an important target by CCR5 antagonists. Entry inhibitor based microbicides gain much importance nowadays as these drugs act at an early stage of HIV lifecycle and thus hinder the viral replication process in humans. The present study intends to identify a CCR5 antagonist which could be developed as a microbicide using computational approaches. METHODS The pharmacophore modeling and 3D QSAR studies was used to screen CCR5 antagonists with enhanced antagonist activity. The docking studies ranked the compounds according to their binding affinity and molecular dynamics simulation validated the stability of the enzymeligand complex. RESULTS A five point pharmacophore hypothesis HHPRR (2 hydrophobic; 1 positively ionisable; 2 aromatic ring) was generated. A statistically significant 3D QSAR model with 3 PLS factors was gen- erated for common pharmacophore hypothesis HHPRR.3 with good correlation coefficient value (R2=0.7483). The docking studies revealed that molecular interaction of CCR5 antagonists having good binding affinity are better than the microbicides taken for this study. The QSAR maps revealed the regions as a combined effect of hydrogen bond donors, hydrogen bond acceptors and hydrophobic groups which denoted the substitution of groups indicating the favorable and unfavorable regions for antagonist activity of hydroxypiperidine derivatives. The docking analysis and molecular dynamics simulation screened and validated CCR5 antagonists. CONCLUSION The present study was successful in identifying a CCR5 antagonist which could be

32252910

developed as a microbicide.

32252910

Probing Dark Current Random Telegraph Signal in a Small Pitch Vertically Pinned Photodiode CMOS Image Sensor After Proton Irradiation The dark current degradation and dark current random telegraph signal (DC-RTS) after proton irradiation are studied in new scale silicon microvolumes by using a commercial CMOS image sensor. Results show that previously reported empirical models describing the displacement damage-induced degradations are still valid despite the 10–100 times smaller depletion volume used. In addition, no evidence of significant total ionizing dose effects is observed. Finally, the reduction of the fraction of RTS pixels detected and the fraction of multilevel RTS pixels is directly linked to the reduction in pixel volume.

247530760

Sarcopenia in the elderly versus microcirculation, inflammation status, and oxidative stress: A cross-sectional study. BACKGROUND Age-related mechanisms of sarcopenia associated with vascular function have been recently suggested. This study compared and tested associations between muscle mass and strength, microcirculation, inflammatory biomarkers, and oxidative stress in older adults classified as sarcopenic and non-sarcopenic. METHODS Thirty-three physically inactive individuals (72±7 yrs) were assigned to age-matched sarcopenic (SG) and non-sarcopenic (NSG) groups. Between-group comparisons were performed for appendicular skeletal mass (ASM), handgrip and isokinetic strength, microvascular function and morphology, C-reactive protein, insulin-like growth factor-1, tumor necrosis factor-alpha, interleukin-6 (IL-6), soluble vascular cell adhesion molecule-1, soluble intercellular adhesion molecule-1, endothelin-1, and oxidized low-density lipoprotein. RESULTS ASM and knee isokinetic strength were lower in SG than NSG (P < 0.05). No difference between groups was found for outcomes of microvascular function and morphology, but log-transformed IL-6 concentration was twice greater in SG vs. NSG (P = 0.02). Correlations between ASM index, handgrip and knee isokinetic strength vs. markers of microcirculatory function, capillary diameters, vascular reactivity, and endothelial injury were found only in SG. CONCLUSION Decreased ASM index and strength have been associated with microcirculatory profile, indicating that microcirculation impairment may be involved somehow in Sarcopenia development. The inflammation status, particularly elevated IL-6, seems to play an important role in this process.

237491460

Impact of Medicaid Expansion on the Diagnosis, Treatment, and Outcomes of Stage II and III Rectal Cancer Patients. BACKGROUND Insurance status has been associated with disparities in stage at cancer diagnosis. We examined how Medicaid expansion (ME) impacted diagnoses, surgical treatment, use of neoadjuvant therapies (NCRT), and outcomes for Stage II and III rectal cancer. STUDY DESIGN We used 2010-2017 American College of Surgeons National Cancer Database (NCDB) to identify patients ages 18-65, with Medicaid as primary form of payment, and were diagnosed with Stage II or III rectal cancer. Patients were stratified based on Census bureau division's ME adoption rates of High, Medium, Low. Overall trends were examined, and patient characteristics and outcomes were compared before and after ME date of 1/1/2014. RESULTS Over 8 years of NCDB data examined, there was an increasing trend of Stage II and III rectal cancer diagnoses, surgical resection, and use of NCRT for Medicaid patients. We observed an increase in age, proportion of White Medicaid patients in Low ME divisions, and proportion of fourth income quartile patients in High ME divisions. Univariate analysis showed decreased use of open surgery for all 3 categories after ME, but adjusted odds ratios (aOR) were not significant based on multivariate analysis. NCRT utilization increased after ME for all 3 ME adoption categories and aOR significantly increased for Low and High ME divisions. ME significantly decreased 90-day mortality. CONCLUSIONS Medicaid expansion had important impacts on increasing Stage II and III rectal cancer diagnoses, use of NCRT, and decreased 90-day mortality for patients with

247130110

Medicaid. Our study supports increasing health insurance coverage to improve Medicaid patient outcomes in rectal cancer care.

247130110

Applying Wireless Sensor Networks to Context-Awareness in Ubiquitous Learning Context aware ubiquitous learning is pervasive and persistent, allowing learners to access education calmly, flexibly and seamlessly. The objective of context aware ubiquitous learning is to move e- learning and mobile learning a step further from learning at anytime anywhere to be at the right time and right place with right learning resources and right learning peers. In recent years, wireless sensor networks have become an evolving technology that has a wide range of potential applications in ubiquitous computing. We introduced an image of context- awareness in ubiquitous learning based on wireless sensor networks. We showed the architecture of context-awareness in ubiquitous learning in general, introduced the components of a sensor node and protocol stack of wireless sensor networks, and pointed out conclusions and open research issues with regard to context aware ubiquitous learning.

46603060

International Conference on the Evolution of Language ( Evolang 9 ) The 1990’s have witnessed a resurrection of an interest in the origins of language (in fact, such an interest had never actually faded). Although pin-pointing the exact triggers behind the initial sparkles is difficult, one may advocate for the integration of a number of scientific advances, including the first computer simulations of the self-organized emergence and convergence of linguistic conventions (Hurford 1989, Steel 1996), the significant progress in the systematic analysis of mtDNA or Y chromosome genetic distributions across the world (Cann et al. 1987, Underhill et al. 2000), the synthesis of the data from genetics, archaeology, and linguistics (Cavalli-Sforza et al. 1988, 1992), and many others. In 1996, the first Conference on the Evolution of Language (Evolang) was held in Edinburgh for the purpose of fostering a dialog between scholars of diverse backgrounds. At the center of discussions — and in opposition to a generativist framework minimizing the value of such an attempt (Chomsky 1972, Berwick 1998) — laid an effort to account for the properties of the faculty of language in light of modern evolutionary theory (Hurford et al. 1998). The 9th Evolang conference (Evolang9), which took place in Kyoto 13–16 March 2012, was once again an opportunity for scholars from a wide range of disciplines to gather and bridge their lines of arguments (McCrohon et al. 2012, Scott-Phillips et al. 2012). Since the origins and evolution of language have long been the research foci in both evolutionary linguistics and biolinguistics, we provide

13963410

here a review of the variety of reports that was brought forward during Evolang9. Without being able to pay justice to the wide scope of all contributions that were made, we mainly summarize and frame the primary arguments that echoed during the conference, highlight significant evolutions of the field both in terms of methods and content, and present our opinions on future research in this line.

13963410

Histopathological changes in tear-secreting tissues and cornea in a mouse model of autoimmune disease The tear film covers the cornea, and its abnormalities (including immunological) induce dry eye. Using autoimmune disease model mice, BXSB/MpJ-Yaa (BXSB-Yaa), histopathological changes in the eye and tear-secreting tissues were examined using histopathology, immunohistochemistry, and electron microscopy at 8, 20, and 28 weeks for early, middle, and late disease stages. Early and middle stage BXSB-Yaa showed increased serum autoantibody and spleen weight-to-body weight (S/B) ratio, respectively, and higher tear volume than controls, BXSB/MpJ (BXSB), at early stages, which decreased with ageing and negatively correlated with autoimmune disease indices. Smaller Meibomian gland acini, intraorbital lacrimal glands, and Harderian gland acinar cells were seen in late stage BXSB-Yaa than in BXSB; the latter two indices decreased with ageing and negatively correlated with the S/B ratio. Cell infiltration occurred in the middle stage BXSB-Yaa extraorbital lacrimal gland, and acinar cells were smaller than BXSB. The conjunctival goblet cells decreased from early to middle stages in both strains, but in BXSB-Yaa, they increased at late stages with a partial lack of microvilli on the cornea and were inversely altered with anterior epithelium thickness through ageing, suggesting that they compensated for anterior epithelium damage. In conclusion, the tear film was unstable due to an autoimmune disease condition in BXSB-Yaa. Impact statement Cornea, an outermost layer of mammalian eye, is protected by tear film and abnormalities of tear film causes dry eye. Dry eye injures the cornea which results lower vision in patients. Several factors cause dry eye,

218837110

including altered systemic conditions, environment, and immunological abnormality of the patient in autoimmune disease like Sjögren’s syndrome (SS). However, the detailed pathology of autoimmune abnormality-mediated dry eye is unclear. Here we demonstrated that systemic autoimmune abnormality in BXSB-Yaa mice was associated with histological changes in the exocrine glands and cornea of the eyes. We also showed that BXSB-Yaa mice developed mild or early stage dry eye-like disease and explain the existence of a compensatory mechanism associated with the dysfunction of these tissues. Thus, BXSB-Yaa could be a model for SS-like disease-associated dry eye and these data would contribute to the understanding of the pathogenesis of autoimmune-related dry eye disease.

218837110

The Last Dragonslayer by J. Fforde Fforde, Jasper. The Last Dragonslayer. Toronto: HarperCollins, 2011. Print. Almost-16-year-old Jennifer Strange is caught in a unique situation. As an orphan and an indentured servant of Kazam Mystical Arts, an employment agency for the magically gifted, Jennifer suddenly finds herself running the agency due to the mysterious disappearance of her boss, Mr. Zambini. Even worse, magical power has been dwindling everywhere and rumors are swirling about the forthcoming death of the last dragon. Accompanied by her faithful Quarkbeast, Jennifer sets out to investigate these strange events, find Mr. Zambini, and stop the disappearance of magic from her world. Along the way, she becomes the central figure in a firestorm of media intrigue and faces the combined threats of fame, prophecies, jail, assassination attempts, and 16 marriage proposals. Known primarily for his adult novels, The Last Dragonslayer is Jasper Fforde’s first foray into fiction for teens; however, his trademark quirky humour, original thinking, and dry wit are present in abundance. Furthermore, Fforde’s characters are complex, well-drawn, and extremely relatable; in particular, Jennifer’s cool-headed intelligence and wry observations will appeal to teen girls and boys alike. Parents who (rightfully) lament the dearth of teen girl role models in YA fiction will enjoy handing this book to their daughters. There is no denying that Dragonslayer is complicated; Fforde never condescends to his young audience, and he pulls no punches when introducing and playing with complex ideas. However, Jennifer’s first-person narration ably guides readers through the wackiness of her world, making a convoluted, diverse,

61418760

suspenseful plot ultimately, and satisfyingly, character-driven. This could be the best book your teen reads all year. Highly recommended: 4 out of 4 stars Reviewer: Amy Paterson Amy Paterson is a Public Services Librarian at the University of Alberta’s H. T. Coutts Education Library. She was previously the Editor of the Dalhousie Journal of Interdisciplinary Management and is very happy to be involved in the Deakin Review and the delightful world of children’s literature.

61418760

DNA content by in situ fluorescence imaging and S-phase detection, with chromatin structure preserved. OBJECTIVE To test the feasibility of in situ DNA quantitation of adherent cells' nuclei by fluorescence imaging, preserving chromatin structure and to follow-up S phase, in relation to DNA content, in order to assess the precision of DNA measurements. STUDY DESIGN Double labeling experiments involved total DNA staining with Hoechst 33342 and BrdU immunostaining (after either Br photolysis and DNA strand break labeling by terminal transferase or acid denaturation) to detect replicating DNA. An epifluorescence microscope was used, images captured with a CCD camera and quantitative total DNA measurements done in 12 bits with IPLab software. BrdU results were related to DNA content on an individual cell basis. Cell cycle analyses were run with Imastat software (developed in the laboratory) on Hoechst-stained cells and on double labeled cells. RESULTS In cells progressing through the cycle, as assessed by BrdU, a corresponding increase in DNA content was measured. Early S differed from G1 (P < .05). Imastat analyses gave a CV for GI peak of 6-7%. CONCLUSION Quantitative fluorescence imaging allows a sensitive determination of DNA content for adherent-cell nuclei in situ. Topologic analyses of nuclear components will be possible in relation to DNA content.

20545060

DNA gyrase gyrA mutations in quinolone-resistant clinical isolates of Staphylococcus haemolyticus Staphylococci are significant human pathogens. Coagulasepositive Staphylococcus aureus causes a variety of infections. Recently, coagulase-negative staphylococci have been recognized as important pathogens. Fluoroquinolones have been widely used to treat staphylococcal infections. However, quinolone-resistant strains have been clinically isolated among S. aureus and Staphylococcus epidermidis. One of the mechanisms of resistance to quinolones is an alteration of DNA gyrase. DNA gyrase contains the two subunits of GyrA and two subunits of GyrB encoded by the gyrA and gyrB genes, respectively. DNA gyrase catalyzes ATP-dependent supercoiling of DNA and is a target of the quinolones (3). Ser-843Leu, Ser-843Ala, Ser-853Pro, Glu-883Gly, and Glu-883Lys changes were identified in S. aureusGyrA (1) and a Ser-843Phe mutation was observed in S. epidermidis GyrA (2). These mutations fall within a small area of the Nterminal portion of the GyrA protein. Therefore, this region is designated the quinolone resistance-determining region (QRDR) of the gyrA gene (4). Studies of quinolone resistance in the coagulase-negative staphylococci, except for S. epidermidis, are not advanced. In this study, we cloned and sequenced the QRDR of the gyrA genes from clinical isolates of coagulase-negative Staphylococcus haemolyticus and identified the mutation in quinoloneresistant strains. Twenty-seven S. haemolyticus strains were clinically isolated from urine samples between 1991 and 1994. Among these strains, 15 were quinolone resistant (MIC of ciprofloxacin, ^6.25 mg/ml). Chromosomal DNAs were prepared from quinolone-susceptible and -resistant S. haemolyticus strains, and PCR was performed to amplify the gyrA fragment, including the QRDR, with two nucleotide primers, 59TTAAATGAACA AGGTATGAC39

27594310

and 59GCCATACCTACCGCGATACC39, which were identical in sequence to nucleotide positions 157 to 176 or complementary in sequence to positions 520 to 539 of the S. aureus gyrA gene, respectively. PCR products were cloned in pT7Blue T-vector (Novagen, Madison, Wis.) and sequenced by the dideoxy chain termination method. The sequence of the QRDR in quinolone-susceptible S. haemolyticus 11068 (nucleotide sequence accession number D78568) showed 85% identity with that of S. aureus. Consequently, the deduced amino acid sequence of this region in S. haemolyticus differed at 2 positions from that in S. aureus. S. aureus had Glu and Asp residues at the NH2-terminal 88th and 96th positions in GyrA, whereas S. haemolyticus had Asp and Thr at those positions, respectively (Fig. 1). Table 1 shows MIC testing of the five clinical isolates. Four quinolone-resistant strains exhibited a fivefold or greater increase in the MICs of fluoroquinolones compared with those for susceptible isolates. The sequence of the QRDR in these four quinolone-resistant S. haemolyticus gyrA fragments differed at only 1 nucleotide position from that of the quinolone-susceptible strain 11068. The strains carried a C3T transition at the position corresponding to position 251 in S. aureus gyrA, resulting in a Ser-843Leu mutation in GyrA. These results indicate that quinolone resistance in both S. haemolyticus and S. aureus is commonly associated with the Ser843Leu mutation in GyrA. Until now, this type of change has been most frequently found in E. coli and S. aureus (1). Changes in the amino acid at the equivalent position were also observed in other quinolone-resistant species.

27594310

Our results add to the accumulating evidence that a change of Ser84 in GyrA may be responsible in part of quinolone resistance.

27594310

Conditions for Consent to the Use of Neurotechnology: A Preparatory Neuroethical Approach to Risk Assessment and Reduction New developments in deep brain stimulation (DBS) enable both openand closed-loop modulation of brain structures and functions that are important to the clinical treatment of a number of neuropsychiatric disorders and conditions. Ongoing clinical trials and investigator-initiated research (IIR) in DBS have generated results that expand both (1) current understanding of neural network mechanisms operative in several neuro-cognitive, emotional and behavioral processes, and (2) the potential viability and use of DBS to alter neuro-cognitive function in clinical settings, as well as for nonclinical purposes (e.g., cognitive task performance optimization and/or emotional performance alteration). It may be that we are poised upon new horizons of possibility to employ DBS (and other neuromodulatory technologies) as treatment of brain disease, disorder, and injury, and to facilitate and/or enhance defined aspects of human thought and behavior. Frederic Gilbert (2015) revisits several fundamental neuroethical issues and questions arising from the use of interventional neurotechnology in light of these new developments in DBS. As Gilbert notes, many neuropsychiatric conditions impair patients’ sense of agency and autonomy. This fosters interest in the viability and value of DBS in restoring self-determination, and often is a strong motivation for patients seeking such treatment in the first place. Such desires can also be fueled, at least in part, by the relative “push” of a growing technological trend—what has been regarded as a technological imperative—in neuroscience and its clinical translation and applications in neurology and psychiatry. Additionally, there is an

146373510

equal, if not greater, “pulling” force exerted by increasing demand-side influences and market valuation of neurotechnology (Giordano and Benedikter 2013). On one hand, patients and the public may be seduced by the lure of new technology, and may misrepresent the potential benefits that can realistically be gained. On the other, patients and the public may be intimidated by (if not frankly fearful of) possibilities for “mind control” and other deleterious (or unanticipated) effects (Giordano 2012). Thus, at the core is a need for realistic determination, and communication, of the actual capabilities and limitations of DBS or any neurotechnology (Giordano 2015). Before a neurotechnology can be advocated for use, it is essential that clinicians address a number of key questions (i.e., the “6-Ws”) that must then be framed within specific domains and dimensions of utility and effect (i.e., the “6-Cs”). This approach entails and obtains detailed assessment of the nature, intent, and realistic effect(s) and consequences of the treatment; settings and contexts of use and outcomes; how intervention can and likely will incur both the therapeutic end goal(s) and other aspects of patients’ cognitive and emotional status; and the needs for, and assurances of, continuity of clinical care and

146373510

Wastewater Analysis Indicates that Genetically Diverse Astroviruses, Including Strains Belonging to Novel Clades MLB and VA, Are Circulating within Japanese Populations ABSTRACT Human astroviruses (HAstVs) are a common etiological agent of infantile gastroenteritis. Recent studies revealed that novel astrovirus (AstV) strains of the MLB clade (MLB-AstVs) and VA clade (VA-AstVs), which are genetically distinct from the classic HAstVs, are circulating in the human population. In the present study, we quantified classic HAstVs as well as carried out a genetic analysis of classic and novel HAstVs in wastewater in Japan. The concentration of classic HAstVs in the influent water samples ranged from 104 to 105 copies per liter, and the amount removed by wastewater treatment was determined to be 2.4 ± 0.3 log10. Four types of classic HAstV strains (HAstV types 1, 2, 5, and 4/8) as well as novel AstV strains belonging to the MLB-2, VA-1, and VA-2 clades were identified using reverse transcription-PCR (RT-PCR) assays, including assays newly developed for the detection of strains of the MLB and VA clades, followed by cloning and nucleotide sequencing. Our results suggest that genetically diverse AstV strains are circulating among the human population in Japan. The newly developed (semi)nested RT-PCR assays for these novel AstV clades are useful to identify and characterize the novel AstVs in environmental waters.

6477460

Developments in the Synthesis of Mycobacterial Phenolic Glycolipids The highly lipophilic outer barrier of mycobacteria, such as M. tuberculosis and M. leprae, is key to their virulence and intrinsic antibiotic resistance. Various components of this mycomembrane interact with the host immune system but many of these interactions remain ill‐understood. This review covers several chemical syntheses of one of these components, mycobacterial phenolic glycolipids (PGLs), and outlines the interaction of these PGLs with the human immune system, as established using these well‐defined pure compounds.

238202360

[Polysaccharide-protein complexes isolated from different strains of Neisseria meningitidis serogroup B]. Fractionation of the biomass of 3 serogroup B N. meningitidis strains, obtained from solid serum-free and liquid synthetic media, by increasing concentrations of cetavlone revealed that the formation of natural polysaccharide-protein complexes with the ratio of their components approaching 1:1 was possible under the conditions ensuring the intensive synthesis of capsular polysaccharide. Two strains, 125 and 1642, grown on a solid amino peptide-containing medium regularly produced two polysaccharide-protein complexes with the protein/polysaccharide ratio approaching 1:1. One of these complexes passed easily into the supernatant fluid and could be precipitated with 0.1% cetavlone. The second complex was more firmly bound to the outer membrane of the cell and could be precipitated with 1% cetavlone. In most experiments an additional fraction with high protein content in relation to sialic acid was isolated from the biomass.

22273660

Picosecond photodetector for 257 nm to 1 mum laser pulses. Picasecond temporal response and broad spectral response photodetectors have been fabricated using commercially available diode chips. Improved photoresponse sensitivity is achieved by removing the anode gold contact which obscures the active region. Junction geometry is such that the depletion region is approximately normal to the surface being illuminated, making the device especially useful for fast UV photodetection.

32130960

Origins of attitude importance: self-interest, social identification, and value relevance. Five studies examined the relations between attitude importance and 3 of its hypothesized determinants: self-interest, social identification with reference groups or reference individuals, and cherished values. Verbal protocols, multivariate analysis of survey data, and laboratory experimentation revealed that (1) people's theories of the causes of attitude importance pointed to all 3 hypothesized predictors, (2) the 3 predictors each had significant, unique statistical associations with importance, and (3) a manipulation of self-interest yielded a corresponding change in importance. These results help clarify the nature and origins of attitude importance, challenge the widely believed claim that self-interest has little or no impact on political cognition, and identify new likely consequences of social identification processes and values.

13280260

Ecological Efficiency of Life Cycle of Concrete Fabricated Composite Slab in Earthquake Area With the development of prefabricated buildings, the construction mode of buildings has changed greatly. Infilled wall is an important part of architecture. The traditional manual masonry method is not suitable for the construction of prefabricated buildings. Precast concrete infilled wall, as a form of infilled wall suitable for the construction of prefabricated buildings, came into being. Infilled wall has a great influence on the performance of frame structure. Compared with the traditional masonry infilled wall, the concrete infilled wall has greater stiffness, better integrity and stronger bearing capacity. Based on the existing research, this paper analyzes the influence of the height width ratio of the concrete infilled wall, the wall thickness, and the tie mode with the frame on the structural performance through the finite element software Atena. Combined with the results of practical engineering modal analysis, this paper evaluates the value method of natural vibration period of concrete frame infilled wall structure, and puts forward some suggestions for Chinese codes.

245823910

Control of a high torque density seven-phase induction motor with field-weakening capability In this paper, a rotor-flux-oriented control scheme for seven-phase induction motor drives is presented. At low speed the proposed control scheme is able to increase the motor torque by adding a third harmonic component to the air-gap magnetic field. Above the base speed the control system reduces the motor flux in such a way to ensure the maximum torque capability. The validity of the proposed control scheme is confirmed by experimental tests.

35990410

[Hypothermia prevention during surgery: comparison between thermal mattress and thermal blanket]. This study aimed to compare the efficiency of the thermal blanket and thermal mattress in the prevention of hypothermia during surgery. Thirty-eight randomized patients were divided into two groups (G1 - thermal blanket and G2 - thermal mattress). The variables studied were: length of surgery, length of stay in the post-anesthetic care unit, period without using the device after thermal induction, transport time from the operating room to post-anesthetic care unit, intraoperative fluid infusion, surgery size, anesthetic technique, age, body mass index, esophageal, axillary and operating room temperature. In G2, length of surgery and starch infusion longer was higher (both p=0.03), but no hypothermia occurred. During the surgical anesthetic procedure, the axillary temperature was higher at 120 minutes (p=0.04), and esophageal temperature was higher at 120 (p=0.002) and 180 minutes (p=0.03) and at the end of the procedure (p=0.002). The thermal mattress was more effective in preventing hypothermia during surgery.

26953410

Guest Editors' Note: Global Drug Development THE SCOPE OF DRUG discovery and development has expanded and accelerated in recent years. Research efforts in drug discovery have broadened to include start-up biotechnology companies, research institutes within major domestic and international pharmaceutical companies, and useful collaborations between industry and academia. Development programs are no longer limited to one country or even one continent, but are conducted simultaneously in multiple countries geared to multiple regulatory agencies. The Cornell Symposium on Global Drug Development at which the following articles were presented was convened as a forum to exchange concepts and ideas about the worldwide nature of drug development. Topics of interest were selected to provoke education and controversy. Strategic planning and coordination of multistate trials is a major focus of activity within the industry and received substantial discussion at the symposium. Current and newer techniques for information tracking and dissemination were described. The symposium devoted considerable attention to a detailed consideration of regulatory and quality assurance issues. Of particular interest was the continuing evolution of the European Community’s approach to drug registration and marketing authorization. Finally, industry experts provided a perspective on the business ramifications of the global development process as manifest by mergers, acquisitions, and co-development planning. The symposium was among the first efforts of industry to address the opportunities, challenges, and specific issues which are associated with global scientific efforts. There is no doubt that as the pace of drug development efforts increase in the setting of a world made smaller by technological advances such as high speed

72502610

data transfer through optical fibers, all of the parties involved in the drug development process will need to adapt. Research scientists will routinely collaborate with colleagues on another continent. Clinical programs will be conceived in one nation and implemented and monitored in many others. Regulatory agencies of many nations will review filings for new agents and deal with issues of worldwide safety and efficacy reporting. The global nature of the drug development process has become a reality, with a more rapid and broader development process bringing therapeutic benefit to increased numbers of patients.

72502610

Controlling Memristance and Negative Differential Resistance in Point‐Contacted Metal–Oxides–Metal Heterojunctions: Role of Oxygen Vacancy Electromigration and Electron Hopping Nonvolatile resistive switching memristance devices with a high on/off ratio are desirable for nanoelectronics such as resistive random‐access memory (RRAM) and in‐memory computing. Here, bipolar resistive switching in point‐contacted W/LaAlO3/SrTiO3(111) heterojunctions is reported, in which a Schottky barrier is formed at the metal/oxides interface, and 2d electron gas is formed at the interface of perovskite oxides. A negative differential resistance is observed in the RESET process. The result shows that the observed resistive switching is strongly associated with oxygen‐vacancies (OVs) in oxides with dominating contributions from electron hopping between OV trap sites, and can be controlled by oxygen annealing and electron injection. Remarkably, a method is developed by continuous RESET processes to increase the high resistance state by 1–3 orders of magnitude, with an on/off ratio enhanced from ≈10 to ≈104. The work provides a promising pathway to understand conduction mechanism of oxides memristors and promote its application in RRAM and in‐memory computing.

248077860

A Mathematical Approach to Modeling Physics for the Vertical Position in Synchronized Swimming In Synchronized Swimming, arguably the most demanding sport known to man, one of the most basic positions is called a vertical. In this position a swimmer’s upper body is submerged in water and their legs are held above the surface while their body is kept in a straight line. Along with the buoyancy forces of the surrounding water and the air in the lungs, swimmers must also support themselves by making movements called sculls with their arms that propel them upwards. This additional force is the applied force. The goal of this research is to use physics principles to create a mathematical model that will help assist synchronized swimmers in maximizing their scores for the vertical position. The math done in this model confirmed that the amount of applied force inversely correlates with the buoyancy force needed to lift the synchronized swimmer out of the water. Additionally, the total force pushing the synchronized swimmer upwards is the same at each level. When the collected data is fitted to a second-order polynomial comparing applied sculling force to desired score, the graph shows that the data had an R2 fit of 0.984. This knowledge could ultimately inform athletes about how to use buoyancy and other forces to their advantage which could increase their performance levels.

229471010

The effect of guar gum on the distribution of a radiolabelled meal in the gastrointestinal tract of the rat 1. The effect of addition of guar gum (5 and 10 g/l) to a radiolabelled, homogenized, baked-bean test meal on the distribution of that meal in the gastrointestinal tract was investigated in groups of male rats killed at 25, 50, 100, 200, 300 and 400 min after gavage. 2. Addition of 5 and 10 g guar gum/l significantly increased the proportion of the meal remaining in the stomach at 25 and 50 min after gavage (P <0·01). 3. The heads of the control meal and meals containing guar gum reached the distal small intestine within 25 min after gavage but radioactivity was not observed in the caecum until 100 min after administration of each of the meals. Addition of guar gum (5 and 10 g/l) delayed caecal filling even though the head of each meal reached the caecum at the same time after gavage. 4. The geometric centres of guar-gum-containing meals were proximal to that of the control meal at all times after gavage. 5. The observed delay in the passage of a guar-gum-containing meal through the stomach and small intestine is probably due to the viscous nature of the meal resisting the propulsive and mixing effects of the gastrointestinal contractions, thereby reducing access of the glucose to the absorptive epithelium. This could contribute to the observed reductions in postprandial glycaemia seen in previous studies after incorporating guar gum into a meal.

15833160

DEVELOPMENT OF THE RUSSIAN LAW OF OBLIGATIONS IN THE 1905 DRAFT CIVIL CODE The author analyzes the level of development of the civil legislation on the example of the law of obligations by means of its comparative analysis with the civil legislation in force in Russia in 1914 – the Code of Civil Laws. Examples of legal novelty in the articles of the draft Civil Code, indicating the development of the Russian law of obligations, are considered. The conclusion is made that the civil legislation developed in the draft was, in quantitative and qualitative terms, a significant step forward, bringing Russian law of obligations closer to European law.

252749460

Dietary intake, nutritional status and rehabilitation outcomes of stroke patients in hospital. BACKGROUND Nutrition affects rehabilitation through its influence on physical and mental functioning, although little attention has been paid to effects on rehabilitation outcomes. The present study aimed to describe nutritional status and food consumption in stroke patients within 2 weeks of hospital admission and before discharge, as well as to investigate the effects of nutritional and dietary factors on rehabilitation outcomes. METHODS One hundred patients from a consecutive cohort admitted to a metropolitan hospital with acute stroke were recruited and assessed by a single researcher, with 38 reassessed at discharge. Nutritional status was assessed using Mini-Nutritional Assessment and anthropometric indices and dietary intake was assessed by 1-day weighed dietary records. Rehabilitation outcomes were changes in Barthel index scores and the rehabilitation efficiency index. RESULTS Few (n = 9; 10%) consumed ≥100% of the estimated average requirement (EAR) for energy within 2 weeks of admission and 13 (33%) had energy intakes <50% of EAR before discharge. A small but increasing proportion (7% at admission, 13% at discharge) were identified as being malnourished across the inpatient stay. Younger age, lower Barthel index and a higher energy intake in the early stages of admission predicted the extent and rate of restoration of functional abilities by discharge (F = 7.503, P = 0.001; F = 14.558, P < 0.001). CONCLUSIONS Given a general finding of nutritional deterioration identified for these patients, as well as the identification of energy intake as a modifiable influence on the extent and rate

23990060

of recovery, there is clearly scope for the multidisciplinary development of nutritional support for stroke patients to improve rehabilitation outcomes.

23990060

Lasers in Applied and Fundamental Research S Stenholm 1985 Bristol: Adam Hilger xiv + 273 pp price £9.95 (IOP members' price £7.95) ISBN 0 85274 808 6 This book contains four contributions that were first published as review articles in Reports on Progress in Physics, together with an introduction setting the scene for each paper and describing developments which have occurred since the articles were first written. The four topics are the interaction of laser radiation with free atoms (S Feneuille), optical bistability (E Abraham and S D Smith), nonclassical effects in the statistical properties of light (R Loudon) and Bell's theorem (J F Clauser and A Shimony).

125664410

Panitumumab-Induced Paronychia: A Case Report and a Brief Review of the Literature Panitumumab is a recombinant, fully humanized IgG2 monoclonal antibody targeting the epidermal growth factor receptor (EGFR). Panitumumab is indicated for patients with metastatic colorectal cancer with progressive refractory disease. Targeted therapies are well known to be well tolerated; however, they may induce toxicities that are distinct from those of classical chemotherapeutic agents. For instance, EGFR inhibitors (EGFRIs) are associated with some specific dermatological adverse effects, one of which is nail toxicity. Since panitumumab is fully humanized, unlike most of the other EGFRIs, it has been reported to have reduced incidence of adverse reactions. Nail-related adverse effects are frequently observed with EGFRIs. A literature search has yielded a list of reviews describing panitumumab-induced nail toxicity. However, as far as we know, there is no case report detailing this adverse effect of panitumumab. Here, we present a case of panitumumab-induced paronychia in a 60-year-old woman with metastatic colon cancer. With this case report, we would like to review the literature and discuss the possible underlying mechanisms of this condition.

229438610

[Chromosome aberrations and sister chromatid exchanges in a human lymphocyte culture exposed to diethylstilbestrol dipropionate]. Frequency of chromosome aberrations and sister chromatid exchanges (SCE) was studied in human lymphocyte culture treated with the synthetic nonsteroidal estrogen diethylstilbestrol-dipropionate in doses of 1.3 . 10(-7) M, 1.3 . 10(-6) M and 1.3 . 10(-5) M. Doses of 1.3 . 10(-6) M and 1.3 . 10(-5) M are shown to induce a significant increase in the chromosome aberration level mostly due to a rise in the number of polyploid cells. The same doses increase the frequency of SCE.

24217260