added python file + dummy data

dummy/PLOS/test.json

@@ -0,0 +1 @@
+{"id": "journal.ppat.1003207", "year": "2013", "title": "Cooperativity Between CD8+ T Cells, Non-Neutralizing Antibodies, and Alveolar Macrophages Is Important for Heterosubtypic Influenza Virus Immunity", "sections": [["Influenza virus remains a significant threat to global health , and results in 200 , 000 hospitalizations and 3 , 000\u201349 , 000 deaths each year in the United States [1]\u2013[3] .", "The ability of influenza virus to rapidly mutate and/or undergo reassortment , allows the virus to evade protective immunity obtained from previous infections or vaccinations [4] .", "Annual influenza vaccines induce an antibody response specific for the highly variable surface glycoproteins of influenza: neuraminidase ( NA ) and hemagglutinin ( HA ) .", "These seasonal vaccines typically take months to produce and rely on the accurate prediction of the influenza serotypes that will be circulating in the next flu season [5] .", "Thus , if the prediction is not accurate or a pandemic strain emerges , current vaccines offer little protection .", "Much research has therefore , focused on the development of a \u201cuniversal\u201d vaccine that will target the conserved , internal regions of the influenza virus , and confer protection against multiple influenza virus serotypes .", "Significant research in the influenza field has focused on the design of vaccines capable of eliciting influenza virus-specific CD8+ T lymphocytes [6]\u2013[8] .", "Since , CD8+ T cells are able to recognize internal , conserved regions of the influenza virus , these cells may be able provide cross-subtype , or heterosubtypic , protection against the influenza virus [9]\u2013[13] .", "A large body of work supports the potential viability of a CD8+ T-cell based vaccine [14]\u2013[17] .", "In mice , vaccination with internal proteins such as influenza nucleoprotein ( NP ) , leads to higher frequencies of NP-specific CD8+ T cells prior to infection , and lower viral titers after challenge with H1N1 and H3N2 strains of influenza [18]\u2013[22] .", "Furthermore , influenza virus-specific memory T cells are detected in the peripheral blood of healthy adolescents and adults , and there is some evidence for heterosubtypic immunity in humans that has been proposed to be due to T cells [23]\u2013[25] .", "However , several groups have reported that the number of influenza virus-specific memory CD8+ T cells in the lung airways of mice declines over time corresponding with a loss of heterosubtypic protection [26]\u2013[29] .", "While there is some conflicting data over whether heterosubtypic protection wanes , if true this gradual loss of the virus-specific CD8+ T cell population represents a serious concern in the generation of CD8+ T cell based vaccines [30] .", "Interestingly , recent work suggests that non-neutralizing antibodies targeting the internal proteins of influenza , specifically NP , can provide some protection against the influenza virus infection through a mechanism involving Fc receptors [31]\u2013[34] .", "Unlike neutralizing antibodies , which are able to prevent viral entry or exit , non-neutralizing antibodies typically target antigens that reside inside virions and/or infected cells .", "Despite recent progress , it is still not clear what role T cells play in non neutralizing antibody-mediated heterosubtypic protection elicited in an immune competent host .", "Additionally the mechanisms by which non-neutralizing antibodies can provide protection against the influenza virus remain elusive .", "Several groups have also noted the potential role of CD4+ T cells in providing protection against influenza virus [6] , [35] , [36] .", "These reports indicated that CD4+ T cells can form a lung-resident population following influenza virus infection where they can serve a protective role in mediating enhanced viral clearance and survival following lethal challenge through a variety of mechanisms including IFN\u03b3 secretion [35] , [37] .", "Recent studies using human volunteers infected with influenza virus also point to a key role for pre-existing CD4 T cell responses in limiting the severity of influenza virus infection and disease [38] .", "Intriguingly , influenza-specific memory CD4+ T cells have also been reported to synergize with na\u00efve B cells and CD8+ T cells to provide protection against influenza viral infection [36] .", "Whether virus-specific CD8 T cells also exhibit such cooperativity in protective immunity is unclear .", "In this study , we demonstrate that , in most settings , influenza virus-specific CD8+ T cells alone are insufficient to provide optimal protection against influenza virus .", "However , when virus-specific non-neutralizing antibodies are present together with virus-specific CD8+ T cells , complete protection is achieved against a lethal influenza virus challenge .", "Moreover , this cooperative protection is dependent , at least in part , on the presence of alveolar macrophages ( AM ) or other respiratory tract phagocytes , suggesting that non-neutralizing antibodies are able to eliminate influenza virus-infected cells through antibody-dependent cell-mediated cytotoxicity ( ADCC ) and/or phagocytosis .", "We demonstrate a novel mechanism by which antibodies and CD8+ T cells targeted against the conserved regions of the influenza virus act in concert to provide heterosubtypic protection .", "Our results complement recent work on the synergy between memory CD4+ T cells and na\u00efve B and CD8 T cells [36] and suggest that elicitating multiple arms of the adaptive immune response may represent a potent mechanism by which heterosubtypic protection against the influenza virus can be achieved ."], ["It has been reported that CD8+ T cell activity correlates with reduced influenza virus shedding following rechallenge [13] .", "Since , CD8+ T cell epitopes are often located in the internal , conserved regions of the influenza virus , the generation of influenza virus-specific CD8+ T cells may provide protective immunity against heterosubtypic influenza strains .", "Thus , we tested whether influenza virus-specific CD8+ T cells could mediate protective immunity using a recombinant viral approach to identify and track responses .", "We used influenza viruses in which the GP33-41 epitope from lymphocytic choriomeningitis virus ( LCMV ) , was inserted into the NA stalk region of the H3N2 influenza X31 ( X31-GP33 ) and H1N1 influenza PR8 ( PR8-GP33 ) viruses [39] , [40] .", "Influenza viruses expressing the GP33 epitope have been shown to induce a robust GP33 response in mice [39] , [41] .", "Mice were primed with either LCMV Armstrong or X31-GP33 intranasally ( i . n . ) and rechallenged , along with a control group of na\u00efve mice , with PR8-GP33 30 days later .", "The antibodies generated against the surface glycoproteins of the H3N2 X31-GP33 virus do not neutralize the H1N1 PR8-GP33 challenge virus [42]\u2013[44] .", "The GP33-specific CD8+ T cell population elicited from primary viral challenge , however , should be capable of responding to the secondary infection , allowing the role of CD8+ T cells in protection against the influenza virus to be investigated .", "The level of protection conferred upon secondary challenge was determined using three assays .", "Morbidity was assessed by weight loss .", "Pulse oximetry was also used to evaluate lung function .", "Finally , real time quantitative ( qRT-PCR ) was used to detect viral RNA and determine viral load at several time points following infection .", "X31-GP33 primed mice were completely protected from influenza rechallenge by all 3 measures ( Fig . 1A ) .", "These mice experienced almost no impairment of lung function or loss in weight , and had low viral load at all time points measured .", "In contrast , the LCMV Armstrong immunized mice , despite generating a robust GP33-specific CD8+ T cell response , exhibited little if any protection from the PR8-GP33 rechallenge .", "Apart from a slight delay in compromised lung function , the LCMV Armstrong immune mice were indistinguishable from the na\u00efve group and experienced a 25% decline in weight and lung function by day 9 post rechallenge .", "To determine if the difference in protection between the X31-GP33 and LCMV Armstrong immune groups was due to the X31-GP33 immune mice having a larger influenza virus-specific CD8+ T cell response , we quantified the total immune response in these mice 6 days after rechallenge in the lung , bronchoalveolar lavage ( BAL ) , and spleen .", "Responses were analyzed using intracellular staining to evaluate the number of cells in these mice able to produce interferon gamma ( IFN\u03b3 ) in response to stimulation with overlapping peptide pools for the influenza virus proteins HA , NA , non-structural protein 1 ( NS1 ) , NS2 , polymerase acidic ( PA ) , polymerase basic ( PB ) , NP , as well as the LCMV GP33 peptide .", "We found that the LCMV Armstrong immune mice had a similar or slightly larger antiviral CD8+ T cell response directed against the recombinant influenza virus following rechallenge in both the lung and BAL despite lack of protection ( Fig . 1B ) .", "Similar results were obtained using mice immunized intraperitoneally ( i . p . ) with LCMV Armstrong ( Fig . S1A , S1B , S1C ) , though LCMV i . n . immunized mice had slightly enhanced viral control compared to the LCMV i . p . primed mice ( Fig . S2 ) .", "Overall , while the route of priming may have some impact , these results indicate that the magnitude of the virus-specific CD8+ T cell response alone might not be a major determinate of protection against influenza viral challenge and suggest that other factors could be responsible for protection against influenza virus in X31-GP33 immune mice .", "We first sought to evaluate whether the agent used to prime the mice could have an impact on protection in our system .", "The specific priming agent used has been reported to confer differences in protection against influenza virus in several vaccine studies [45] , [46] .", "Thus , mice were primed with LCMV Armstrong , Listeria-GP33 ( LM-GP33 ) , or Vaccinia-GP33 .", "Each group of mice had a similar GP33-specific CD8+ T cell population despite being immunized with different bacterial or viral agents .", "We found that regardless of the priming agent used , all groups experienced severe weight loss , decline in lung function , and high viral load following rechallenge with PR8-GP33 ( data not shown ) .", "Thus , in this setting , the priming agent did not have an obvious direct correlation with whether or not protection was achieved .", "We next examined whether the epitope against which the CD8+ T cells were primed impacted protection .", "Different epitopes have been shown to elicit varying levels of protection to the influenza virus [47] .", "We therefore tested whether priming with another CD8 epitope shared between X31-GP33 and PR8-GP33 , the dominant Db-restricted NP366-374 ( NP366 ) epitope from influenza virus nucleoprotein , could elicit better protection than the GP33 response .", "Mice were primed with recombinant viruses ( or bacteria ) expressing GP33 , NP366 , or a non-influenza determinant ( the LCMV nucleoprotein ) , and challenged 30 days later .", "None of these approaches achieved substantial protection against PR8-GP33 rechallenge , as each group had substantial weight loss , high viral load and reduced lung function ( Fig . 2A ) .", "Thus , at least for the determinants examined , the specific epitope was not a major factor in the lack of protection observed in this model system .", "Next , we used a prime-boost strategy to test whether the more robust immune response induced upon boosting was superior in providing protection compared to non-boosted memory CD8+ T cells .", "Mice were immunized with LM-GP33 and then boosted with LCMV Armstrong 30 days after initial priming .", "These mice were then rechallenged with PR8-GP33 either 8 days or 30 days after the boost .", "We also immunized a group of mice with LCMV Armstrong and rechallenged with PR8-GP33 8 days later .", "The mice rechallenged with influenza virus 8 days after initial priming displayed delayed morbidity with the initiation of weight loss on \u223cday 6 post rechallenge rather than at \u223cday 2\u20133 in na\u00efve mice ( Fig . 2B ) .", "This transient delay in weight loss suggested that GP33-specific effector CD8+ T cell response present at 8 days after acute LCMV infection was capable of providing some initial protection following influenza virus infection .", "This group , however , still lost significant weight by day 9 post rechallenge and had reduced lung function as well as high viral load .", "It is worth noting that the dose of LCMV Armstrong used here has been demonstrated in our lab and others to be cleared by day 8 [48] .", "The prime boost group that was rechallenged 30 days after the \u201cboost\u201d did not experience this transient delay in weight loss and showed kinetics of morbidity similar to the LCMV Armstrong immune groups described above in terms of magnitude of weight loss and decline of lung function suggesting that the greater magnitude of GP33-specific CD8+ T cell response in this group was insufficient to mediate protection .", "In contrast , the prime-boost group that was rechallenged 8 days after the \u201cboost\u201d showed no signs of influenza-related pathology in terms of weight loss and lung function .", "Despite this lack of morbidity these mice still had very high viral loads until day 9 post rechallenge ( Fig . 2B ) .", "While priming ( and the prime-boost regimen ) was able to induce a robust population of GP33-specific response capable of producing IFN\u03b3 and tumor necrosis factor ( TNF\u03b1 ) in response to stimulation ( Fig . S3 ) , this response was still insufficient to mediate viral clearance .", "Thus , although this prime boost group is similar to the X31-GP33 group in terms of weight loss and lung function following rechallenge , viral control was relatively poor .", "The protection from morbidity in the mice challenged 8 days after boosting was not due simply to elevated bystander inflammation as mice subjected to two other prime-boost strategies that lacked CD8+ T cells specific for influenza virus showed rapid weight loss ( Fig . 2C ) .", "Furthermore , the lack of weight loss achieved by the virus-specific prime-boost strategy was recapitulated when LM-GP33 was substituted with VV-GP33 ( Fig . 2C ) , suggesting that the lack of weight loss in these mice is not dependent on the identity of the priming agent , but on the rapid initiation of an influenza virus-specific CD8+ T cell response .", "These results are in line with reports that \u201cboosted\u201d memory CD8+ T cells are better than primary memory CD8+ T cells in controlling some acute infections [49] , [50] .", "However , while pathology was reduced , this immune response was not sufficient to efficiently control viral load .", "We next investigated whether we could achieve enhanced CD8+ T cell-mediated protection using adoptive transfer strategies analogous to adoptive transfer approaches used for influenza virus-specific CD4+ T cells [35] , [36] .", "Ly5 . 1+ mice were immunized with LM-GP33 and 30 days later boosted with LCMV Armstrong .", "On day 8 following the boost , CD8+ T cells were isolated and 0 . 8\u00d7106 , or 1 . 6\u00d7106 GP33+ CD8+ T cells were adoptively transferred to Ly5 . 2+ na\u00efve mice .", "The recipient mice were rechallenged with PR8-GP33 the next day .", "Little to no protection was observed as measured by weight loss and viral load compared to a PBS-treated control group ( Fig . 3A\u2013B ) , despite high numbers of GP33 specific CD8+ T cells present in the lungs of these mice 6 days after rechallenge ( Fig . 3C ) .", "To determine whether the observed lack of protection was due to an insufficient number of in vivo primed adoptively transferred GP33-specific CD8+ T cells , we primed P14 TCR-transgenic CD8+ T cells ( specific for LCMV GP33-41 ) using an in vitro approach that allowed the generation of large numbers of activated GP33-specific CD8+ T cells .", "We then adoptively transferred 2\u00d7106 , 10\u00d7106 or 20\u00d7106 GP33-specific CD8+ T cells into na\u00efve mice and challenged these mice with influenza virus .", "Mice given 20\u00d7106 or 10\u00d7106 GP33-specific CD8+ T cells were almost completely protected from influenza-related morbidity and experienced virtually no decline in weight or lung function ( Fig . 3D ) .", "Additionally , even the group given 2\u00d7106 GP33-specific CD8+ T cells exhibited improved protection with only a 15% decline in weight and a 20% reduction in lung function .", "Despite the greatly reduced morbidity in these mice , the viral loads measured by qRT-PCR for viral RNA were almost indistinguishable from the PBS-treated control group .", "This lack of difference in viral control was confirmed using an assay for infectious virus to ensure that qRT-PCR-based approach was accurately reflecting replicating virus rather than residual viral debris or viral RNA independent of replicating virus ( Fig . S4 ) .", "Thus , similar to the prime-boost group described above ( Fig . 2C ) , the immune response elicited by the adoptively transferred , in-vitro generated effector CD8+ T cells was insufficient to reduce viral load despite the improvement in measures of morbidity .", "Overall , these results indicate that both in vivo and in vitro generated GP33-specific CD8+ T cells alone were insufficient to provide optimal protection against a pathogenic influenza virus challenge .", "While CD8+ T cells in large enough numbers are able to provide some protection as measured by weight loss and lung function , they are unable to significantly reduce viral load .", "Moreover , our results suggest that the mechanism of cross-subtype protection in X31-GP33 immune mice is unlikely to be exclusively CD8+ T cell-dependent .", "To evaluate the mechanism of cross-subtype protection in X31-GP33 primed mice , we next examined the dependence of protection in this setting on T cells ( Fig . 4 ) .", "CD8+ and/or CD4+ T cells were depleted from X31-GP33 immune mice prior to PR8-GP33 rechallenge with depletion being verified as >97% in the lungs .", "In all cases , depletion of CD8+ and/or CD4+ T cells did not increase the severity of weight loss .", "There was a slight but non-significant decrease in oxygen saturation following the depletion of CD8+ T cells , which was amplified when both CD4+ and CD8+ T cells were depleted ( Fig . 4A ) .", "( Note , that CD4+ and CD8+ T cells were depleted simultaneously using anti-Thy1 . 2 , which may also deplete double negative T cells , natural killer ( NK ) cells and innate lymphoid cells ) .", "Interestingly , the depletion of CD8+ T cells resulted in a considerable increase in viral load while CD4+ T cell depletion caused no significant difference in viral load .", "The viral load of the CD8+ T cell depleted group was still lower than that found in na\u00efve mice challenged with PR8-GP33 ( see Fig . 1A ) , although this difference was non-significant .", "Furthermore , the viral load was identical between the group in which only CD8+ T cells were depleted and the one in which both CD8+ and CD4+ T cells were depleted ( Fig . 4A ) .", "This result agrees with previous reports that CD4+ T cells play only a minor role in modulating influenza viral titers , and that depletion of CD4+ T cells does little to alter the course of viral infection [51] , [52] .", "While it is known that memory CD4+ T cells can cooperate with na\u00efve B or CD8+ T cells in the context of influenza infection [36] , it is unknown whether a similar cooperativity occurs with influenza virus-specific CD8+ T cells .", "It is interesting that CD8+ T cells in this setting were needed for control of virus while in the previous experiments ( Fig . 2B , 3D ) CD8+ T cells seemed to be able to control weight loss but not viral load .", "This difference may be due to differences in depletion versus immunization or adoptive transfer approaches or other mechanisms such as changes in immunopathology because of larger numbers of CD8 T cells suppressing other responses ( e . g . CD4 T cells ) .", "X31-GP33 immune mice are largely protected against symptoms of influenza virus infection in the absence of CD8+ and CD4+ T cells , suggesting other possible mechanisms contributing to protection .", "One possibility is that B cells have a role through the action of non-neutralizing antibodies specific for determinants shared between the X31 and PR8 influenza strains .", "To test this notion , we immunized \u00b5MT mice , which lack B cells [53] , with X31-GP33 .", "When challenged 30 days later these mice demonstrated no protection against PR8-GP33 despite a very similar influenza virus-specific CD8 T cell response compared to B6 mice ( Fig . 4B and C ) .", "These data suggested that B cells are essential for heterosubtypic protection .", "One concern is that the immunological response may be altered in \u00b5MT mice due to the total lack of B cells .", "Therefore , we examined MD4 transgenic mice that have normal numbers of B cells , but have a transgenic B cell receptor specific for hen egg lysozyme [54] and are therefore unable to generate an influenza virus-specific antibody response .", "Similar to the \u00b5MT mice , however , MD4 mice immunized with X31-GP33 were also not protected and experienced severe weight loss upon rechallenge with PR8-GP33 ( Fig . 4B ) .", "X31-GP33 immune MD4 mice also had reduced lung function and high viral load ( Fig . 4B ) .", "To test whether the lack of non-neutralizing antibodies might underlie the defect in X31-GP33 immune MD4 mice , we transferred serum collected from X31-GP33 immunized B6 mice ( referred to as X31 serum ) into X31-GP33 primed MD4 mice and rechallenged with PR8-GP33 .", "Protective immunity , as measured by all three parameters was improved ( Fig . 5 ) .", "Collectively , these data suggested that an influenza virus-specific B cell response was essential for X31-GP33 based heterosubtypic protection .", "As cross-neutralizing antibodies are not induced between the X31 and PR8 influenza strains [42]\u2013[44] , non-neutralizing antibodies are likely contributing to protection .", "One possible interpretation of the data presented thus far is that both CD8+ T cells and non-neutralizing antibodies might be necessary for optimal protection .", "To evaluate whether non-neutralizing antibodies in conjugation with influenza virus-specific CD8+ T cells can elicit robust heterosubtypic protection in B6 mice , we transferred serum from X31-GP33 immune mice into LCMV Armstrong immune mice .", "When given X31-GP33 serum , LCMV immune mice containing GP33-specific memory CD8+ T cells displayed significantly reduced weight loss and viral load compared to the LCMV Armstrong immune group that had received PBS or serum from na\u00efve mice ( Fig . 6A ) .", "LCMV immune mice that received X31-GP33 serum also maintained nearly 100% blood oxygen saturation following PR8-GP33 challenge .", "The protection achieved by transfer of X31-GP33 serum to LCMV Armstrong-immune mice in terms of weight loss and lung function was nearly equivalent to that achieved with transfer of serum from PR8-GP33 immune mice containing neutralizing antibodies , although PR8 serum resulted in more effective control of viral replication ( Fig . 6A ) .", "To determine whether the protective factor in the serum was indeed antibodies , we administered serum that had been depleted of IgG and IgA to LCMV Armstrong immune mice and challenged with PR8-GP33 [55] .", "These mice exhibit no evidence of protection indicating that X31-GP33 mediated protection is antibody-dependent ( Fig . 6A ) .", "While it is possible that there may be more total IgG in the transferred X31 serum compared to na\u00efve serum , there was no obvious correlation between the total IgG levels and protection in these experiments ( data not shown ) .", "Our results indicate that optimal heterosubtypic protection against influenza is elicited only when both GP33-specific CD8+ T cells and non-neutralizing antibodies are present .", "While many previous studies have demonstrated that antibodies induced by X31 do not neutralize PR8 and vice versa [42]\u2013[44] , it was possible that a new neutralizing determinant might have been formed due to the insertion of the GP33 sequence into the NA stalk .", "Thus , we transferred X31-GP33 serum into na\u00efve mice one day prior to challenge with PR8-GP33 .", "These mice displayed no signs of protection and experienced severe weight loss and decline in lung function ( Fig . 6B ) .", "The na\u00efve group given PR8 serum was completely protected from challenge with PR8-GP33 due to the presence of neutralizing antibodies ( Fig . 6B ) .", "This result strongly suggested that the antibodies found in X31-GP33 serum were non-neutralizing .", "Additionally the lack of protection found in the na\u00efve group given X31-GP33 serum indicates that both antigen-specific CD8+ T cells and non-neutralizing antibodies were needed for protection .", "To further examine the cooperativity between non-neutralizing antibodies and virus-specific CD8+ T cells in heterosubtypic protection we transferred X31-GP33 serum , na\u00efve serum , or PBS into LCMV Armstrong immune mice .", "We then rechallenged these mice with PR8-WT instead of PR8-GP33 .", "In this setting the LCMV Armstrong primed mice given X31-GP33 serum , as well as the groups given na\u00efve serum or PBS were not protected from PR8-WT rechallenge by any measure ( Fig . 6C ) .", "Thus , the protective immunity in this setting was dependent on both non-neutralizing antibodies and recognition of viral determinants by primed CD8+ T cells .", "To explore whether this cooperativity-based protection could be achieved using natural influenza-virus derived epitopes we immunized mice with VVNP366 to induce an influenza virus-specific T cell response .", "We then waited 30 days and transferred X31 or na\u00efve serum into these mice one day prior to challenge with the H1N1 swine influenza virus strain SW/33 .", "SW/33 is not genetically engineered , but , like PR8-GP33 , is pathogenic in mice .", "Similar to LCMV Armstrong immune mice , VV366 immune mice given X31 serum were protected against viral challenge in terms of both weight and lung function , with these mice also having a trend to lower viral load compared to mice given na\u00efve serum ( Fig . 6D ) .", "This finding strongly indicates that the cooperativity-based protection is not simply an artifact of out recombinant influenza virus system , but rather a likely physiologically relevant mechanism of protection against influenza virus challenge .", "The means by which non-neutralizing antibodies operate in cooperative protection is unclear .", "Among the possible mechanisms are: antibody-dependent cell-mediated cytotoxicity ( ADCC ) , Fc receptor ( FcR ) mediated phagocytosis , and the complement pathway .", "To distinguish between these possibilities we used mice either lacking FcR\u03b3 or interleukin-15 ( IL-15 ) .", "FcR\u03b3 -/- mice are deficient in the gamma chain subunit of the FcgRI , FcgRIII and FceRI receptors resulting in functionally impaired macrophages , neutrophils , mast cells , basophils and Natural Killer ( NK ) cells .", "IL-15 -/- mice , on the other hand , are deficient in NK cells , but not these other cell types allowing the role of NK cell-mediated ADCC in heterosubtypic protection to be tested .", "Wild type , FcR\u03b3 -/- , and IL15 -/- mice were primed with LCMV Armstrong , rested 30 days , and then given either X31-GP33 serum or na\u00efve serum 1 day prior to rechallenge .", "The LCMV immune IL-15-/- mice given X31-GP33 serum were protected upon PR8-GP33 challenge , although the decrease in viral load in these mice was only a trend .", "These results might reflect the moderate defect in CD8 T cell memory in these mice [56]\u2013[58] , although influenza virus-specific T cell memory in the respiratory tract appears independent of IL-15 [59] .", "In contrast , the FcR\u03b3 -/- mice were not protected against infection as measured by any parameters tested regardless of whether the mice were given X31-GP33 or na\u00efve serum ( Fig . 7A ) .", "Together , these results suggested that non-neutralizing antibody-based protection was FcR\u03b3-dependent , but that NK cells were non-essential .", "To further examine cooperative heterosubtypic immunity we first immunized B6 mice with X31-GP33 .", "After 30 days we treated these mice i . n . with clodronate-loaded liposomes to deplete alveolar macrophages ( AM ) ( and possibly other airway-resident phagocytes ) , cobra venom factor to deplete complement , or anti-NK 1 . 1 to deplete NK cells .", "Another group was given empty liposomes as a control .", "Following PR8-GP33 rechallenge , the only group left unprotected was the clodronate treated group in which AM were depleted .", "These mice experienced severe morbidity and high viral load despite having an unimpaired CD8+ T cell response ( Fig . S5A ) .", "All other groups remained healthy and controlled the infection ( Fig . 7B ) .", "This result suggested that heterosubtypic immunity mediated by non-neutralizing antibodies and CD8+ T cells was , at least in part , dependent on cells depleted by clodronate liposomes including AM .", "It is important to note that while we found clodronate liposome treatment to be non-toxic to uninfected mice and to result in \u223c70% depletion of alveolar macrophages in the BAL fluid three days following a single clodronate treatment ( Fig . S5B ) , it is possible that depletion of other airway populations such as dendritic cell or inflammatory macrophages could occur .", "The unimpaired CD8+ response seen in clodronate liposome treated mice however , suggests that any clodronate depletion of dendritic cells in the airway was insufficient to significantly impact presentation of antigen to CD8+ T cells .", "Furthermore , preliminary studies using adoptive transfer of alveolar macrophages obtained from the BAL of na\u00efve mice into LCMV Armstrong immune FcR\u03b3 -/- mice suggested that reintroducing alveolar macrophages could partially rescue weight loss in half the mice when given in conjunction with X31 serum ( Fig . S6 ) .", "While further studies are necessary , these data are consistent with the notion that AM are involved in cooperative heterosubtypic protection .", "To further evaluate the role of AM and NK cells in cooperative heterosubtypic protection , we depleted AM or NK cells in LCMV Armstrong immune mice as described above , and administered X31-GP33 serum to these mice one day prior to rechallenge .", "We found that only the group treated with clodronate liposomes exhibited severe weight loss and a decline in lung function ( Fig . 7C ) .", "The group depleted of NK cells did display a trend towards higher viral loads then the group given only X31-GP33 serum , but this difference was not significant and this group still experienced almost no weight loss or decline in lung function , further suggesting that NK cells ( or perhaps other NK1 . 1+ cells ) only play a minor role in the mechanism of non-neutralizing antibody-based protection .", "Overall , this finding strongly indicates that the mechanism of non-neutralizing antibody-based protection is dependent on cells depleted by clodronate liposomes , including AM , likely through FcR-dependent AM phagocytosis or ADCC of influenza virus-infected cells ."], ["The aim of universal influenza vaccination approaches is to provide long-lasting protection against a wide range of viral serotypes .", "Creating a universal vaccine by inducing CD8+ T cells specific for conserved internal proteins of influenza virus has received considerable attention , but remains an unrealized goal .", "In this study , we demonstrate that influenza virus-specific CD8+ T cells can cooperate with non-neutralizing antibodies to provide efficient cross-subtype influenza virus-specific protection .", "While non-neutralizing antibodies against M2e or other conserved determinants have recently been examined , our data indicate a previously unappreciated role for cooperativity between non-neutralizing antibodies and CD8+ T cell responses in the induction of optimal protection from serologically distinct influenza virus strains .", "This mechanism represents a novel approach by which a universal influenza vaccine could be developed .", "Currently there are several promising universal influenza vaccine candidates in development .", "Among these candidates are broadly neutralizing antibodies , which are able to target the conserved stem region of the influenza virus [60]\u2013[64] .", "These broadly neutralizing antibodies have been found to be cross reactive among different H1 or H3 influenza subtypes and are likely to represent a major advance in generating more effective influenza virus vaccines .", "However , current antibodies specific for the H1 stem are largely effective only against heterologous H1 and H5 viruses , and antibodies against the H3 stem are only effective against H3 viruses [60] .", "Interestingly , neutralizing antibodies were sometimes induced following vaccination with a pandemic H1N1 vaccine , but were of too low magnitude to induce robust heterosubtypic protection [64] .", "Until neutralizing antibodies can be generated against an antigen conserved between many different influenza subtypes , humans will remain vulnerable to the threat of a pandemic from a novel influenza strain such as H7N7 , H9N2 , etc .", "[65] .", "Another promising potential universal influenza vaccine targets the ectodomain of matrix protein 2 ( M2e ) [66] .", "The M2e sequence is conserved across influenza virus subtypes , and humoral anti-M2e immunity has been shown to protect against influenza virus challenge in mice [67] , [68] .", "However , M2e-based protection does not prevent or resolve infection and is of a lower potency that HA-specific antibodies , making an M2e-dependent therapy more likely to act as a safety net in the case of the emergence of pandemic influenza strains rather than a replacement for current vaccines [69] .", "One concern associated with both broadly neutralizing antibodies and M2e based vaccines is that widespread use of these vaccines will introduce immune pressure promoting the evolution of antigenic escape viruses [66] .", "There have already been reports of escape viruses being generated in response to M2e antibodies , with one study finding that virus mutants with antigenic changes in M2e emerged in 65% of virus-infected mice treated with anti-M2e , although some level of protection remained despite these mutations [69] .", "An interesting avenue of future research will be to determine if cooperativity between T cells and non-neutralizing antibody can be used to boost the protection elicited through these vaccination strategies .", "Virus-specific CD8+ T cells do not seem to be generated by HA-stalk or M2e immunization strategies [70] , so a vaccine in which CD8+ T cells can be elicited specific for conserved influenza virus determinants , combined with approaches to generate HA-stalk or M2e targeting antibodies , may offer improved protection .", "Furthermore , the overlapping protection provided by virus-specific CD8+ T cells should help reduce the possibility of an escape virus emerging .", "Recent reports have implicated NP-specific IgG in heterosubtypic immunity to influenza virus [28] , [29] .", "This previous work found that NP protein was detectable in the BAL and nasal washes of influenza virus-infected mice , thereby allowing the NP antigen to interact with NP-specific antibodies and form complexes to stimulate antiviral immune responses .", "These studies also demonstrated that 5 daily antibody injections starting 3 days prior to infection were required to reduce viral load in na\u00efve mice , using a 0 . 25 lethal dose 50% ( LD50 ) influenza rechallenge .", "Our findings extend this work in determining that cooperativity between influenza virus-specific CD8+ T cells and antibodies is important for heterosubtypic protection in immune competent mice .", "NP-specific antibodies are likely to be a primary component of the X31-GP33 serum used in our work .", "The cooperativity we demonstrated may mean that excessively high amounts of non-neutralizing antibodies might not be required if virus-specific CD8+ T cells are also present .", "Since previous influenza virus infections or vaccinations have likely induced anti-NP antibodies and influenza virus-specific memory CD8+ T cells in most adults , it is interesting that more heterologous protection does not seem to exist in humans .", "One reason may be that sufficiently high titers of anti-NP antibodies are not present in adults to mediate cooperative protection .", "Indeed one report indicates that trivalent inactivated influenza virus vaccine ( TIV ) only rarely and modestly boosted existing levels of anti-NP IgG [32] .", "Alternatively , perhaps such cooperative immunity is , in fact , one reason for the relatively low mortality in healthy adults for most strains of influenza virus .", "Our results suggest that it will be interesting to test whether this cooperative immunity might wane with increasing age , a theory supported by several reports [26]\u2013[29] .", "It is possible that the lack of CD8 T cell boosting by the yearly vaccine allows CD8 T cell memory to decline over time even in healthy young adults .", "Future studies will be necessary to test some of these ideas in humans .", "The mechanism by which non-neutralizing antibodies operate in the setting of heterosubtypic immunity remains poorly understood .", "Unlike neutralizing antibodies , non-neutralizing antibodies do not prevent viral entry into host cells and must therefore employ a different means of action to reduce viral load .", "FcRs have been reported to be important mediators of this process , but the specific cell types directly involved in reducing influenza viral load and pathology by this mechanism are unclear .", "Alveolar macrophages have been shown to play a critical role in influenza virus protection , likely through ADCC or phagocytosis [71] , [72] .", "Some reports have also suggested that NK-cells may be involved in influenza virus protection through ADCC [59] , although several recent studies have found this to be unlikely [73] , [74] .", "The complement pathway could also have an important role due to the ability of complement to bind and lyse infected cells or enveloped virus in the presence of antibodies .", "Complement has been demonstrated to be able to neutralize the influenza virus in the presence of natural antibodies [75] , and complement component C3 may be important in T cell priming and migration to the lungs [76] .", "Indeed , C3 deficiency in humans correlates with recurrent infections of the upper and lower respiratory tract [77] .", "In the current studies we found that heterosubtypic protection was dependent , at least in part , on alveolar macrophages .", "Intranasal administration of clodronate liposomes have been shown to selectively deplete alveolar macrophages while leaving the interstitial macrophage population as well as other cell types in the lungs intact [71] , [78]\u2013[80] .", "However , the possibility of off target effects of the clodronate liposome approach cannot be fully excluded .", "The unimpaired CD8+ T cell response found in clodronate-treated mice ( Fig . S3A ) however , suggested that depletion of dendritic cells was unlikely to be responsible for the lack of protection in this setting .", "Thus , alveolar macrophages are likely a major cell type impacted by this treatment and are expected to act to help reduce viral load through recognition of the Fc region of non-neutralizing antibodies .", "This recognition can lead to ADCC and/or antibody-dependent cell-mediated phagocytosis directed against infected cells bound by non-neutralizing antibodies .", "The reduced effectiveness of seasonal influenza vaccines and greater infection-related morbidity and mortality in the elderly is thought to be due to alterations in both the innate and adaptive immune response that occur with age [3] , [81]\u2013[84] .", "Among the alterations reported in the elderly that could influence immunity to infection are changes in macrophages , NK cells , neutrophils , pathogen recognition via Toll-like receptors , innate cell cytokine production [85] , [86] , as well as decreased numbers , proliferation and signaling of B and T cells [87]\u2013[91] .", "Interestingly , there have also been reports of changes in FcRs that occur with age , which could lead to defects in FcR-dependent effector functions [92] .", "While it has been shown that CD8+ T cell and neutralizing antibody-based protection obtained at a young age is still protective many years later [93]\u2013[95] , less is known about non-neutralizing antibody-dependent protection .", "Since this type of protection relies on FcR-dependent effector mechanisms to clear infected cells it will be important to determine if the heterosubtypic protection observed in young mice is also seen in aged groups of animals .", "A major goal of \u201cuniversal\u201d influenza vaccines is to elicit cross-subtype influenza virus protection in both young and aged populations .", "Hence , age-related defects in the immune system are a critical issue that must be addressed in future studies to determine if cooperative protection is an effective strategy in eliciting heterosubtypic influenza protection .", "Collectively , we have shown that influenza virus-specific CD8+ T cells in cooperation with non-neutralizing antibodies are able to provide optimal protection against a lethal influenza virus rechallenge .", "This protection is only exhibited when both influenza virus-specific CD8+ T cells and non-neutralizing antibodies are present .", "Furthermore , non-neutralizing antibodies likely contribute to influenza virus clearance , possibly through a mechanism involving alveolar macrophages .", "It should be pointed out that while we have focused largely on CD8+ T cells , it is possible that cooperative protection will occur for CD4+ T cells and non-neutralizing antibodies .", "Indeed , there is good evidence that CD4+ T cells can contribute to protective immunity to influenza virus [35] , [96] , [97] and cooperate with na\u00efve B and CD8+ T cells [36] .", "It will be important to address this issue in the future .", "This work provides novel insights into cross-subtype influenza virus protection and could have implications for the development of a universal influenza vaccine ."], ["This study was carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health .", "Protocols were approved by the Institutional Animal Care and Use ( IACUC ) committees of the Wistar Institute , ( animal welfare assurance number A3432-01 ) or University of Pennsylvania ( animal welfare assurance number A3079-01 ) .", "The Wistar and University of Pennsylvania Animal Care and Use Programs are fully accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International ( AAALAC ) .", "C57BL/6 and Ly5 . 1+ mice were purchased from the National Cancer Institute ( Frederick , MD ) or Jackson Laboratories ( Bar Harbor , ME ) .", "Age- and sex matched IL-15-/- mice were obtained from Taconic ( Germantown , NY ) , FcR\u03b3 knockout mice ( FcR\u03b3 KO; strain name B6 . 129P2-Fcer1gtm1RavN12 ) were purchased from Taconic Farms , Inc . ( Hudson , NY ) , and B cell-deficient B6 . 129S2-IghtmICgn/J ( \u00b5MT ) mice and anti-HEL B-cell receptor ( BCR ) -transgenic C57BL/6-TgN ( IghelMD4 ) mice ( referred to as MD4 ) were obtained from the Jackson Laboratory .", "For primary or secondary infections , mice were inoculated using the following pathogens , doses and routes: with LCMV Armstrong ( LCMV Arm; 2\u00d7105 PFU i . p . or 5\u00d7104 PFU i . n ) ; recombinant X31 influenza virus expressing the LCMV GP33 epitope ( X31-GP33; 1 . 6\u00d7105 TCID50 i . n . ) ; vaccinia virus ( VV ) expressing the LCMV GP33 epitope ( VVGP33 ) , VV expressing the influenza virus NP366 epitope ( VVNP366 ) , and VV expressing LCMV Nucleoprotein ( VV-NP ( LCMV ) ) all used at 3\u00d7105 PFU i . n . ; Listeria ( LM ) expressing the GP33 epitope ( LM-GP33; i . v . ) ; Vesicular stomatitis virus expressing the ovalbumin ( OVA ) epitope ( VSV-OVA; 2\u00d7106 PFU i . v . ) ; LCMV Armstrong V35A which lacks the GP33 epitope ( LCMV-V35A; 2\u00d7105 PFU i . p . ) .", "For rechallenge experiments , mice were given either recombinant PR8 influenza virus expressing the LCMV GP33 epitope ( PR8-GP33; 3 LD50 i . n . ) ; wild type PR8 influenza virus ( PR8-WT; 3 LD50 i . n . ) ; wild type swine influenza virus ( SW/33; 3 LD50 i . n ) .", "For both strains of PR8 1LD50\u200a=\u200a\u223c250 TCID50 .", "Prior to i . n . infections , mice were anesthetized by i . p . injection of ketamine hydrochloride and xylazine ( Phoenix Scientific , San Marcos , CA ) in 0 . 2 ml Life Technologies HBSS ( Invitrogen , Carlsbad , CA ) .", "In some experiments , mice were anesthetized with 2 . 5% Avertin ( 0 . 2\u20130 . 35 ml ) i . p . Recombinant influenza virus strains containing the LCMV GP33\u201341 epitope inserted in the neuraminidase stalk region were obtained from Dr . Richard J . Webby ( St . Jude Children's Research Hospital , Memphis , TN ) and have been previously described [35] , [36] .", "These viruses were propagated in eggs , and stored at \u221280\u00b0C .", "The replication and pathogenicity of these recombinant X31 and PR8 strains were not substantially different from their nonrecombinant counterparts ( data not shown ) .", "Viral titers were determined by plaque assay on Vero cell monolayers ( for LCMV and VV ) or on Madin-Darby canine kidney cell monolayers ( for X31-GP33 and PR8- GP33 ) as previously described [98] .", "For all experiments , na\u00efve C57BL/6 mice were also infected with influenza virus to allow comparison of weight loss , viral load , and pulse oximetry between different experiments .", "The concentration of infectious virus in lungs was determined by titration of homogenized tissues in Madin-Darby canine kidney cell ( MDCK ) microcultures as described previously [6] .", "Lung titers are expressed as dilution of lung extract at which 50% of the MDCK cultures revealed virus growth ( TCID50/ml ) .", "For all adoptive transfer experiments , congenic mice differing in Ly5 ( Ly5 . 1 versus Ly5 . 2 ) were used .", "For adoptive transfers CD8+ T cells were purified ( 90% purity ) using magnetic beads ( CD8+ T cell isolation kit , MACS beads; Miltenyi Biotec , Auburn , CA ) .", "The MouseOx Pulse-oximeter ( Starr Life Sciences , Oakmont PA ) was used to measure blood oxygen saturation ( SpO2 ) in PR8-GP33 infected mice during the course of infection .", "A depilatory agent ( Nair , Church & Dwight Co . ) was applied to the neck of anesthetized mice 1 day prior to influenza infection to remove hair and delay future hair growth .", "For readings , the oximeter clip was placed on the neck and percent SpO2 was measured each second over several minutes , data shown is the average of SpO2 readings recorded over 3\u20135 minutes per mouse .", "Alveolar macrophages were isolated and transferred as previously described [71] .", "Briefly AM were isolated from BAL with PBS-EDTA from C57BL/6 mice .", "10 mice were sacrificed as donors for every recipient mouse .", "A 23-gauge cannula was inserted into the trachea , and cells were collected by washing the airway lumen with 3\u00d70 . 5 ml PBS-EDTA .", "The obtained BAL fluid was centrifuged , and cells were washed twice with PBS , counted , and resuspended in PBS .", "4 . 5\u00d7105 cells were then transferred i . n . into recipient mice at a volume of 50 ul/mouse .", "NK1 . 1 cells were depleted in vivo by i . p . injection ( 0 . 2 mg/injection ) of rat mAb PK136 .", "CD8+ T cells were depleted by i . p . injection of rat mAb 53 . 6 , CD4+ T cells were depleted using rat mAb GK1 . 5 and both CD4+ and CD8+ T cells were depleted simultaneously using anti-Thy1 . 2 ( 0 . 2 mg/injection; clone 30H12 , isotype Rat IgG2b obtained from BioXCell ) .", "All antibody treatments were givens days -3 , -1 , 2 , and 5 post PR8-GP33 rechallenge .", "Depletion was confirmed by flow cytometric analysis on day 6 post rechallenge in the lungs .", "All in vivo mouse antibodies were purchased from Bio X Cell ( West Lebanon , NH ) .", "Alveolar macrophages were depleted using the liposome-mediated macrophage depletion technique based on the intracellular delivery of the drug dichloromethylene diphosphonate ( clodronate ) .", "Preparation of clodronate-liposomes and applications of the technique was done as previously described [79] .", "Alveolar macrophages were depleted by i . n . administration of 50 ul of clodronate-liposomes on days -3 , -1 , and 2 post PR8-GP33 rechallenge .", "Viral quantitative real-time RT-PCR was performed essentially as previously described [26] .", "Briefly , total RNA was purified from lungs of PR8-GP33 infected mice using the RNeasy Mini Kit ( Qiagen , Valencia , CA ) .", "Reverse transcriptions were primed with random primers and performed using the High Capacity cDNA Reverse Transcription Kit from Applied Biosystems ( Foster City , CA ) .", "Real-time quantitative PCR ( qRT-PCR ) was performed on cDNA using TaqMan Universal PCR Master Mix ( Applied Biosystems ) and probes and primers specific to the influenza PA protein with all samples analyzed in triplicate .", "Reactions were run on a real-time PCR system ( ABI7500; Applied Biosystems ) .", "Amount of influenza viral RNA per sample was then calculated using known standards .", "The total amount of virus per lung was then calculated using the mass of the lung portion taken for viral RNA determination in relation to the total lung mass .", "The TCID50 of each sample was determined by calculating the volume of virus per lung ( using the viral RNA determination of the PR8-GP33 stock ) and then calculating the total TCID50 in the lungs using the known TCID50 per unit volume of the viral stock .", "The limit of detection was determined by performing qRT-PCR on lung samples from uninfected mice and represented by a dashed line .", "PA sense: CGGTCCAAATTCCTGCTGAT .", "PA antisense: CATTGGGTTCCTTCCATACA .", "PA probe: 6FAMCCAAGTCATGAAGGAGAGGGAATACCGCTTAMRA Lymphocytes were isolated from tissues as previously described [99] .", "Briefly , mice were euthanized and the hepatic vein cut .", "Lungs were perfused by injection of PBS into the hepatic artery or the right heart ventricle .", "Lungs were cut into pieces and incubated in 0 . 2 mg/ml collagenase D ( Roche Diagnostic , Indianapolis , IN ) at 37\u00b0C for 35 min .", "Spleens and lymph nodes were homogenized using a cell strainer .", "In all tissues , red blood cells ( RBCs ) were lysed using ACK lysing buffer ( Quality Biologicals , Gaithersburg , MD ) , and lymphocytes were washed and counted .", "Serum was collected from na\u00efve and day 30+ X31-GP33 , or PR8-GP33 infected mice .", "Serum samples from individual mice were pooled and 1 ml of pooled serum/mouse was injected i . p . into mice on day -1 prior to PR8-GP33 rechallenge .", "In some instances to verify that the antibodies present in the serum were responsible for any protective effects , serum was depleted of IgG and IgA using Protein A and G SpinTrap ( GE Healthcare , Pittsburgh , PA ) according to manufacturer's instructions .", "Effector CD8 T cells were generated in vitro by peptide-stimulation of TCR-transgenic splenocytes ( obtained from a P14 transgenic mouse ) specific for the LCMV glycoprotein peptide ( P14 mice specific for GP33-41 ) .", "Briefly , spleen cells were incubated with 5 \u00b5M GP33 peptide for two hours .", "The peptide was washed off , media replaced and the cells were cultured for 48 hrs in 24-well plate , and maintained afterwards in 75T culture flasks in IL-2 - supplemented media for 5 days .", "The media was changed every 48 hours .", "A daily sample from the culture was examined by flow cytometry for the expression level of the activation markers , CD44 and CD25 .", "On day 5 , the cells were harvested , washed in PBS , counted and resuspended in PBS for adoptive transfer .", "Lymphocytes were stained using standard techniques and analyzed by flow cytometry .", "Virus-specific CD8 T cells were quantified using MHC class I peptide tetramer staining .", "MHC class I peptide tetramers were made and used as described [98] .", "Antibodies to CD8 and CD44 were purchased from eBioscience ( San Diego , CA ) .", "Staining and analysis were performed as previously described [92] .", "Function was investigated by intracellular cytokine staining following antigen stimulation ( IFN\u03b3 , TNF\u03b1 , IL-2 , CD40L ) .", "Briefly , 1\u00d7106 splenocytes were cultured in the absence or presence of the indicated peptide ( 0 . 2 mg/ml ) and brefeldin A for 5 h at 37\u00b0C .", "Influenza virus pooled peptides were used to evaluate the influenza virus-specific CD8+ T cell responses .", "This pool contains 147 overlapping peptides from influenza virus NP and M proteins , and we also included the GP33 peptide in this pool .", "For later experiments the overall influenza-specific CD8+ T cell response was evaluated via intracellular cytokine staining following stimulation with peptides from the influenza proteins HA , NA , NS1 , NS2 , PA , PB , NP , as well as the LCMV epitope GP33 .", "Following staining for surface antigens as described above , cells were stained for intracellular cytokines using the Cytofix/Cytoperm kit ( BD Biosciences ) .", "Samples were collected using an LSRII flow cytometer ( BD Biosciences ) .", "Results represent the mean \u00b1 SEM unless indicated otherwise .", "Statistical significance was determined by paired or unpaired Student's t test .", "Statistical analyses were performed using Prism GraphPad software v5 . 0 .", "( * , p<0 . 05; ** , p<0 . 01; *** , p<0 . 001 ) .", "Neuraminidase-956530; Interferon gamma-15978; Tumor necrosis factor-21926; Hemagglutinin- 956529; Nucleoprotein ( Influenza ) -956531; Nucleoprotein ( LCMV ) -956592; Non-structural protein 1\u2013956533; Non-structural protein 1\u2013956532; Polymerase acidic-956535; Fc receptor-109615; Glycoprotein ( LCMV ) -956590; Matrix protein 2\u2013956528; Interleukin 15\u201316168 .", "All accession ID numbers are recorded from the Entrez Gene database ."]], "headings": ["Introduction", "Results", "Discussion", "Materials and Methods"], "abstract": ["Seasonal epidemics of influenza virus result in \u223c36 , 000 deaths annually in the United States .", "Current vaccines against influenza virus elicit an antibody response specific for the envelope glycoproteins .", "However , high mutation rates result in the emergence of new viral serotypes , which elude neutralization by preexisting antibodies .", "T lymphocytes have been reported to be capable of mediating heterosubtypic protection through recognition of internal , more conserved , influenza virus proteins .", "Here , we demonstrate using a recombinant influenza virus expressing the LCMV GP33-41 epitope that influenza virus-specific CD8+ T cells and virus-specific non-neutralizing antibodies each are relatively ineffective at conferring heterosubtypic protective immunity alone .", "However , when combined virus-specific CD8 T cells and non-neutralizing antibodies cooperatively elicit robust protective immunity .", "This synergistic improvement in protective immunity is dependent , at least in part , on alveolar macrophages and/or other lung phagocytes .", "Overall , our studies suggest that an influenza vaccine capable of eliciting both CD8+ T cells and antibodies specific for highly conserved influenza proteins may be able to provide heterosubtypic protection in humans , and act as the basis for a potential \u201cuniversal\u201d vaccine ."], "summary": ["Influenza virus continues to pose a significant risk to global health and is responsible for thousands of deaths each year in the United States .", "This threat is largely due to the ability of the influenza virus to undergo rapid changes , allowing it to escape from immune responses elicited by previous infections or vaccinations .", "Certain internal determinants of the influenza virus are largely conserved across different viral strains and represent attractive targets for potential \u201cuniversal\u201d influenza vaccines .", "Here , we demonstrated that cross-subtype protection against the influenza virus could be obtained through simultaneous priming of multiple arms of the immune response against conserved elements of the influenza virus .", "These results suggest a novel strategy that could potentially form a primary component of a universal influenza vaccine capable of providing long-lasting protection ."], "keywords": ["medicine", "infectious diseases", "immunology", "biology"]}

dummy/PLOS/train.json

@@ -0,0 +1 @@
+{"id": "journal.pgen.0030189", "year": "2007", "title": "The cdx Genes and Retinoic Acid Control the Positioning and Segmentation of the Zebrafish Pronephros", "sections": [["The kidney eliminates metabolic waste in the body using highly specialized structures called nephrons .", "Individual nephrons are composed of a blood filter ( renal corpuscle ) , a tubule that recovers or secretes solutes , and a collecting duct [1] .", "The renal corpuscle contains epithelial cells called podocytes that form the slit-diaphragm filtration barrier and allow collection of substances from the blood [2] .", "In a number of vertebrate species , including some mammals , the renal corpuscle is connected to the tubule by a short stretch of ciliated epithelium called the neck segment that guides filtrate entry into the tubule [3\u20135] .", "The mammalian nephron tubule is subdivided into a series of proximal and distal segments connected to a collecting duct [1 , 6] .", "The polarized epithelial cells in the tubule segments have a unique ultrastructure and express a select cohort of solute transporters [1] .", "Thus , each segment is functionally distinct and performs the transport of particular solutes that are required for proper renal function .", "In higher vertebrates , three kidneys of increasing complexity arise sequentially from the intermediate mesoderm ( IM ) : the pronephros , the mesonephros , and the metanephros [7] .", "The pronephros and mesonephros degenerate in succession , with the metanephros serving as the adult kidney .", "Lower vertebrates , such as fish and amphibians , develop a pronephros during embryonic stages , and then form a mesonephros that will be used throughout their adult life [8\u201310] .", "Each of these kidneys contains the nephron as its basic functional unit [8] .", "To date , much of our knowledge of kidney development has come from gene-targeting studies in the mouse [7 , 11 , 12] .", "These experiments have identified a number of genes that play essential roles in the early stages of metanephros development , but there is a limited understanding of the molecular pathways governing the later stages of kidney ontogeny , when individual nephrons form and become segmented [7] .", "The zebrafish is an ideal genetic and developmental model system for dissecting the molecular mechanisms of nephron formation because of the anatomical simplicity of the pronephros , which contains two nephrons as opposed to the thousands of nephrons in a mammalian metanephros [9] .", "During zebrafish development , bilateral stripes of IM lying on either side of the trunk undergo a mesenchymal-to-epithelial transition to form the pair of pronephric nephrons .", "The anteriormost renal progenitors differentiate into podocytes , which migrate medially and fuse at the midline to form a single renal corpuscle .", "The nephrons also fuse posteriorly at the cloaca to form a shared exitway .", "From a functional standpoint , these pronephric nephrons have been thought to consist of three parts: ( 1 ) the blood-filtering renal corpuscle , ( 2 ) a very short tubule region that transports solutes , and ( 3 ) long pronephric ducts that convey the resulting waste to the cloaca [9] .", "Contrary to this model , recent studies have suggested that the \u2018duct' region possesses regional segmentation , based on the restricted expression boundaries of solute transporter orthologues known to be expressed in the tubule segments of metanephric nephrons .", "For example , a rostral stretch of the pronephric duct expresses the endocytic receptor megalin ( lrp2 ) [13] and the sodium bicarbonate transporter NBC1 ( slc4a4 ) [14] , which are expressed in the proximal tubule in mammals .", "These reports raise the possibility that portions of the pronephros considered to be duct might in fact be tubule , thus suggesting that the organization of the zebrafish pronephros is more complex than previously appreciated .", "However , a complete model of the molecular anatomy of the zebrafish pronephros and whether there is a functional correlation to the segments of the mammalian nephron remain unclear .", "Furthermore , the pathway ( s ) directing segmentation of the pronephros along the embryonic axis are unknown .", "Numerous factors are known to control segmental patterning along the anterior-posterior ( A-P ) axis during vertebrate development and thus provide candidate pathways that might act to establish pronephros segmentation .", "Retinoic acid ( RA ) signaling is vital for directing the A-P regionalization of tissues deriving from all three germ layers , such as the hindbrain , paraxial mesoderm , and gut [15\u201319] .", "Control of RA production via retinaldehyde dehydrogenase ( RALDH ) synthesizing enzymes [20] and the degradation of RA via the CYP26 catabolizing enzymes establishes both the location and timing of RA signaling [21 , 22] .", "In addition to RA , the caudal ( cdx ) transcription factors ( Cdx1 , Cdx2 , and Cdx4 in mammals and cdx1a and cdx4 in zebrafish ) are responsible for determining vertebral identity and directing posterior body formation [23\u201331] .", "cdx genes are known to act as master regulators of the homeobox ( hox ) transcription factors [25] , and in turn , overlapping domains of hox gene expression along the A-P axis are thought to confer segmental identities [32] .", "In mice , loss of Cdx function causes posterior shifts in Hox gene expression that are associated with abnormal vertebral patterning , and posterior truncations due to defects in the extension of the embryo axis [23 , 25\u201327 , 33] .", "Similarly , studies in zebrafish have shown that the loss of cdx4 function or deficiency of both cdx1a and cdx4 causes shifts in hox gene expression domains , a shortened body axis , and altered patterning of the blood , vascular , and neural tissues [24 , 28\u201331] .", "These lines of evidence indicate that the cdx genes play essential roles in controlling cell fates along the embryonic axis; however , the molecular mechanisms underlying these effects have not been elucidated [34] .", "In this study , we undertook a functional genomics approach to identify new markers of the zebrafish pronephros .", "From this analysis , we found that the pronephros is composed of at least eight regions , including two proximal and two distal tubule segments .", "We explored how segmental identity is controlled during nephrogenesis by testing the roles of RA signaling and the cdx genes .", "We found that RA is required to induce proximal segment fates and prevent the expansion of distal segment fates , whereas the cdx genes are necessary for positioning the pronephros along the embryonic axis .", "Embryos deficient in cdx1a and cdx4 displayed a posterior shift in the location of the pronephros and formed proximal but not distal nephron segments .", "The cdx genes were found to control the expression boundaries of raldh2 ( aldh1a2 ) and cyp26a1 , suggesting a model in which the cdx pathway influences where the pronephros forms along the body axis by localizing the source of RA , while subsequent RA signaling acts to direct the segmentation of the pronephros ."], ["To gain insight into the molecular mechanisms that control vertebrate renal development , we undertook a functional genomics approach to identify genes expressed in the kidney .", "We mined two gene collections , one comprising developmentally expressed genes from embryonic zebrafish cDNA libraries [35] and another compiled from an adult zebrafish kidney library [36] .", "Gene expression patterns were analyzed by whole-mount in situ hybridization using wild-type zebrafish embryos between the 5 somite stage and 144 hours post fertilization ( hpf ) .", "We identified a number of genes , including 15 solute transporters , that were expressed within specific subregions of the pronephros .", "In total , eight distinct regions could be visualized , with some genes expressed in more than one region ( Figure 1A ) .", "Representative examples of region-specific genes include wt1b , slc20a1a , trpm7 , slc12a1 , stc1 , slc12a3 , and gata3 , as compared to expression of cdh17 , which is found in all tubule and duct progenitors [37] ( Figure 1A ) .", "We investigated where the mouse or human orthologues of some of these genes are expressed in the mammalian metanephric kidney , and found that many corresponded to segment-specific domains within the nephron .", "For example , Slc9a3 is expressed in podocytes , the proximal convoluted segment ( PCT ) and proximal straight segment ( PST ) ( Figure 1B ) [38] .", "Slc20a1 is expressed throughout the entire nephron epithelium , although stronger expression was observed in proximal tubule segments ( Figure 1B ) .", "Transcripts for Slc13a3 are found in the PST [39] , while Slc12a1 is restricted to the thick ascending limb ( TAL ) and macula densa ( MD ) ( Figure 1B ) [40 , 41] .", "Slc12a3 is expressed in the distal convoluted tubule ( DCT ) ( Figure 1B ) [41] .", "Lastly , GATA-3 expression specifically marks the collecting ducts ( CD ) ( Figure 1B ) [42 , 43] .", "Based on this cross-species gene expression comparison , the following identities were assigned to the zebrafish pronephros segments we observed ( going from proximal to distal ) : podocytes ( pod ) , neck ( N ) , PCT , PST , distal early ( DE ) , corpuscle of Stannius ( CS ) , distal late ( DL ) , and the pronephric duct ( PD ) ( Figure 1A and 1E ) .", "Our division of PCT and PST within the tubule is based on the observation that the slc20a1a-expressing PCT cells undergo morphogenesis from a linear tube into a coiled structure by 5 days post-fertilization ( dpf ) , while the trpm7- and slc13a1-expressing PST segment maintains a linear structure ( Figure 1C ) .", "Expression of trpm7 and slc13a1 is discontinuous within the PST , an observation that has been shown recently to reflect the presence of two cell types in this region: transporting epithelia and multiciliated cells [44 , 45] .", "The renal corpuscle connects to the PCT via a short segment of cells that express the transcription factor rfx2 , and fails to express almost all of our PCT solute transporters ( Figure 1D ) .", "As rfx2 marks ciliated cells and rfx genes are essential regulators of ciliogenesis [46 , 47] , we hypothesize that this region corresponds to the ciliated neck segment found in other fish species as well as mammals [3\u20135] .", "However , a more detailed analysis is needed to confirm this hypothesis .", "In addition to the neck segment , rfx2 expression was also detected in presumptive ciliated cells along the length of the PST and DE segments , as described previously [44 , 45] .", "For the distal tubule , we adopted the DE/DL nomenclature used in Xenopus [48] , although the zebrafish DE appears analogous to the TAL segment in mammals and the DL appears analogous to the mammalian DCT segment according to our gene expression comparison .", "We included the CS as a discrete segment , as it initially arises from the tubular progenitors within the pronephros , but by 48 hpf , it is located just dorsal to the DE/DL boundary [49 , 50] ( unpublished data ) .", "The DL segment expresses slc12a3 and connects to the cloaca via a short segment that expresses gata3 and likely represents the PD .", "Our data are consistent with the notion that the zebrafish pronephric kidney resembles a \u2018stretched-out\u201d' mammalian nephron , and suggests that rather than being composed of mostly nephric duct ( as currently believed ) , it is made up of extensive proximal and distal tubule epithelium ( Figure 1E ) .", "Between 24 and 48 hpf ( the start of blood filtration ) , the pronephros undergoes significant morphogenesis , including the midline migration of podocytes and the growth/extension of the tubules [9] .", "In order to better quantitate these morphological changes , as well as to precisely define the anatomical boundaries of each segment , we mapped the expression domains of segment-specific markers relative to the somites by performing double whole-mount in situ hybridization with myosin heavy chain ( mhc ) at 24 and 48 hpf ( Figures 2 and S1\u2013S4 ) .", "At 24 hpf , podocyte and neck progenitors are arranged in a slight curve at the level of somite 3\u20134 with the anterior boundary of the PCT level with somite 5 ( Figures 2 and S1 ) .", "By 48 hpf , the podocyte progenitors have fused at the midline ( level with somite", "3 ) with the presumptive neck region forming a lateral extension that connects with the PCT also situated at the level of somite 3 ( Figures 2 and S3 ) .", "During this time , the length of the PCT , PST , and DE segments increased , possibly due to cell division within each segment ( Figure 2 and S1\u2013S4 ) .", "This growth may provide the driving force that is responsible for the shift in the anterior boundary of the PCT from somite 5 to somite 3 between 24 and 48 hpf , and for the coiling morphogenesis of the PCT observed between 72 and 144 hpf ( Figure 1C ) .", "However , the DL segment did not increase in length between 24 and 48 hpf , indicating that there is not a uniform expansion in all segments during development .", "During juvenile development ( 2\u20133 wk post-fertilization ) the DL segment is proportionately larger than the other segments , suggesting that its expansion predominates at later stages of development ( unpublished data ) .", "Interestingly , at 24 hpf , we observed an overlap of the DL and PD expression domains at the level of somite 17 ( Figure 2 and Figure S2 ) .", "This overlap may indicate the presence of an additional segment ( such as a discrete CNT equivalent ) , though to date we have not discovered any genes expressed solely in this domain .", "In addition to mapping the morphological changes that occur between 24 and 48 hpf , we also noted segment specific changes in gene expression patterns during this time .", "For example , transcripts for the solute transporters slc13a1 ( inorganic sulphate transporter ) , slc13a3 ( sodium-dicarboxylate carrier ) , and slc22a6 ( organic anion transporter ) were all absent from the PST segment at 24 hpf but were found expressed at 48 hpf ( Figures 2 and S3; and unpublished data ) .", "Similarly , transcripts for trpm7 ( divalent cation-selective ion channel ) and slc41a1 ( Mg 2+ transporter ) were not found in cells of the CS at 24 hpf but could be detected at 48 hpf ( Figure 2 and unpublished data ) .", "The up-regulation of these genes likely reflects the maturation/differentiation of the segment epithelia before the onset of blood filtration , which begins around 40 hpf [51 , 52] .", "However , the glomerulus does not fully mature until 4 dpf , based on the size exclusion of different-sized fluorescent dextrans [53] .", "Further profiling of segment expression patterns at later stages is needed to investigate whether the maturation of the transporting epithelial is also an ongoing process .", "We next sought to characterize the developmental pathways that establish the segmentation pattern of the pronephros .", "Retinoic acid ( RA ) is essential for the development of numerous tissues during embryogenesis [25] .", "In vertebrates , a gradient of RA in the upper trunk is responsible for directing the A-P patterning of the hindbrain into segmental compartments [15 , 54] , and gain or loss of RA also affects vertebral identity [25] .", "Interestingly , RA has been reported to regulate pronephros formation in Xenopus [55] .", "To explore whether RA was needed for pronephros segmentation , we injected wild-type zebrafish embryos with a morpholino to retinaldehyde dehydrogenase 2 ( raldh2 ) , which encodes an enzyme required to produce RA [20] .", "We then examined raldh2 morphants at 48 hpf with our panel of segment-specific markers , in combination with mhc expression to map segment length and location relative to the somites .", "Embryos deficient in raldh2 had fewer podocytes , as evidenced by punctate staining of the podocyte markers wt1b , wt1a , and mafb ( Figure 3A and unpublished data ) .", "Both proximal tubule segments were slightly shortened , based on the reduced expression domains of slc20a1a ( PCT ) and trpm7 ( PST ) ( Figure 3 ) .", "Conversely , the distal tubule was expanded in length , with the clck transporter ( marking both the DE and DL ) expressed in a greater proportion of the cdh17-positive pronephric tubule ( note that the overall length of raldh2 morphants is reduced compared to wild-type ) ( Figure 3 ) .", "Each segment within the distal tubule was moderately expanded , with a lengthened DE shown by expanded slc12a1 expression , enlarged clusters of stc1-expressing cells that comprise the CS , and lengthened DL shown by slc12a3 expression ( Figure 3 ) .", "The expression domain of gata3 ( PD ) was also expanded ( Figure 3 ) .", "In contrast , the cloaca marker aqp3 was unchanged ( Figure 3A ) .", "These data suggest that RA signaling is necessary for podocyte formation and/or survival , as well as for establishing the normal pattern of nephron segmentation .", "Multiple enzymes are capable of synthesizing RA and a recent analysis of the neckless ( nls ) ( now called aldh1a2 ) mutant , which is defective in raldh2 , demonstrated that there are additional sources of raldh-like enzyme activity in the zebrafish embryo [56\u201358] .", "Based on this , we hypothesized that the nephron phenotype in raldh2 morphants represented the effect of reducing RA production , rather than a complete inhibition .", "To more fully block RA signaling , we utilized a competitive , reversible inhibitor of raldh enzymes , 4-diethylaminobenzaldehyde ( DEAB ) [59] , which has been used to effectively prevent de novo RA synthesis in zebrafish embryos [58 , 60] .", "Wild-type embryos were treated with DEAB starting at 60% epiboly ( early gastrula ) until the 15 somite stage , and nephron segmentation was assayed at 48 hpf by double whole-mount in situ hybridization using mhc expression to mark the somites .", "Expression of the podocyte markers wt1b , wt1a , and mafb was absent in DEAB-treated embryos , suggesting that podocyte development was completely blocked ( Figure 3 and unpublished data ) .", "Expression of the PCT and PST markers slc20a1a and trpm7 was also absent , suggesting that these segments had failed to be specified ( Figure 3 ) .", "In contrast , clck expression ( marking the DE and DL segments ) was dramatically expanded , such that it was present throughout the entire tubule territory ( Figure 3 ) .", "These findings suggest that the pronephric tubule adopts a distal tubule identity when RA synthesis is inhibited .", "Within this \u2018distal-only' pronephros , the DE marker slc12a1 was expressed from the anterior limit of the tubule to almost the middle of its length , the DL marker slc12a3 was expressed from the middle of the tubule to near its posterior limit , and the PD marker gata3 was expanded by an additional four somite lengths ( Figure 3 ) .", "A marked expansion of stc1-expressing cells was also detected , with multiple clusters of cells arranged in bilateral stripes , as opposed to the small groups of stc1-expressing cells seen in wild-type embryos ( Figure 3 ) .", "Expression of aqp3 was not altered , suggesting that progenitors of the cloaca are unaffected by the inhibition of RA production over this developmental interval ( Figure 3 ) .", "It is not known if the observed DEAB phenotype represents a full loss of RA signaling , as trace amounts of maternal RA have been detected in the yolk [61] and as zygotic raldh2 transcripts are expressed prior to 60% epiboly [56 , 57] .", "Nevertheless , our results demonstrate that RA , produced by raldh2 and possibly one or more unknown raldh enzymes , plays an essential role in the formation of proximal nephron fates ( podocytes , PCT , PST ) and in suppressing the expansion of distal fates ( DE , CS , DL , PD ) .", "To determine more precisely when RA signaling was needed for the development of proximal segment fates , we performed a DEAB timecourse experiment ( Figure 3 ) .", "Blocking RA signaling from 90% epiboly ( late gastrula ) to the 5 somite stage caused a milder phenotype than the longer 60%- 15-somite exposure that was characterized by a loss of podocytes , reduced lengths of the PCT and PST segments , and small increases in the lengths of the distal segments ( Figure 3 ) .", "A slightly longer DEAB treatment , from 90% epiboly to the 10 somite stage , expanded distal segments further than the raldh2 morphants or DEAB 90% epiboly-5 somite treated embryos ( Figure 3 ) .", "In addition , examination of the slc20a1a and trpm7 expression patterns showed that the PST segment was ablated , while the PCT was only slightly shortened ( Figure 3 ) .", "Loss of PST identity was also confirmed by the absence of slc13a1 and slc22a6 transcripts , which are additional PST markers ( Figure 2 and unpublished data ) .", "These findings suggest that , at least for this DEAB time window , the expansion of distal fates occurs at the expense of the PST segment .", "Finally , we tested whether DEAB treatment during somitogenesis would affect pronephros segmentation .", "DEAB treatment from 5\u201315 somites or 10\u201315 somites had no effect on the segmentation pattern of the pronephros ( unpublished data ) , thus suggesting that an inhibition of RA signaling must be initiated prior to the 5 somite stage in order to affect nephron patterning .", "Taken together , our DEAB timecourse data indicate that RA signaling is required to induce proximal nephron fates and to prevent an expansion of distal fates , thereby establishing the normal pronephric segmentation pattern .", "Interestingly , our data suggest that different segments have different temporal requirements for RA signaling .", "RA is essential between 90% epiboly and the 5 somite stage to induce podocytes , between 90% epiboly and 10 somites to induce PST formation , and between 60% epiboly and 15 somites to form the PCT .", "The PCT segment is the most refractory to RA inhibition and is only lost following the longest DEAB treatment window ( 60% epiboly to 15 somites ) .", "Given these findings , we tested whether increasing the concentration of RA by exogenous treatment would promote proximal nephron fates at the expense of distal fates .", "We exposed wild-type zebrafish embryos to RA during similar developmental intervals used for our DEAB experiments , and then assayed segment marker expression at 24 hpf by double in situ hybridization with mhc to mark the somites .", "Wild-type embryos treated with 1 \u00d7 10\u22127 M RA between 90% epiboly and 5 somites developed a normal number of podocytes , as evidenced by wt1b expression , but displayed expanded proximal tubule domains , shown by expression of slc9a3 ( marking both the PCT and PST ) , slc20a1a ( PCT ) , and trpm7 ( PST ) ( Figure 4 ) .", "Conversely , the clck-expressing distal tubule domain was reduced , due to reductions in the length of the DL ( marked by slc12a3 ) and PD ( marked by gata3 ) ( Figure 4 ) .", "However , the DE segment ( marked by slc12a1 ) was unaffected ( Figure 4 ) .", "The position of the stc1-expressing CS segment cells was shifted posteriorly , and the level of expression was slightly reduced ( Figure 4 ) .", "A longer treatment window , from 60% epiboly\u201315 somites resulted in a more severe \u2018proximalized' phenotype with a longer expanse of proximal tubule and a greater reduction in each distal tubule domain ( Figure 4 ) .", "In these embryos , the position of the stc1-expressing CS population was shifted even more posteriorly , and was located at the distal edge of the yolk sac extension ( Figure 4A ) .", "We next treated wild-type embryos with higher dose of RA ( 1 \u00d7 10\u22126 M ) over this same 60% epiboly\u201315 somites time window , as well as two shorter time periods: 60% epiboly\u20135 somites , and 90% epiboly\u20135 somites .", "Embryos treated for any of these time windows displayed a completely \u2018proximalized' phenotype with the tubule domain being comprised entirely of proximal segment identities ( Figure 4 and unpublished data ) .", "In these embryos , the proximal marker slc9a3 was expressed throughout the cdh17-expressing tubule population ( Figure 4 and unpublished data ) .", "Within this \u2018proximal-only' pronephros , the PCT marker slc20a1a was expressed from the anterior limit of the tubule to somite 13 , and the PST marker trpm7 was expressed from somite 14 to the posterior limit of the tubule , where the trpm7-expressing tubules fused at the prospective site of the cloaca ( Figure 4 and unpublished data ) .", "Expression of all distal segment markers was absent , suggesting that the DE , CS , DL , and PD had failed to be specified ( Figure 4 and unpublished data ) .", "These results show that exogenous RA treatment from gastrulation stages until the 5 somite stage is sufficient to \u2018proximalize' the pronephros , suggesting that this time period is the critical window when RA signaling is required for proximo-distal patterning of pronephric progenitors .", "To further explore the notion that RA alters the patterning of renal progenitors prior to the 5 somite stage , we examined the expression patterns of the Notch ligands deltaC ( dlc ) and jagged2a ( jag2a ) , and the renal transcription factors wt1a , pax2a , pax8 , and evi1 , as these genes are detected in the IM during early somitogenesis and have been implicated in early nephron patterning [44 , 62\u201364] .", "Wild-type embryos were treated with DMSO , DEAB , or 1 \u00d7 10\u22126 M RA from 60% epiboly until the 6 somite stage , and then IM gene expression was assayed by whole-mount double in situ hybridization together with myoD to mark the somites .", "Transcripts for pax2a and pax8 , which label all pronephric progenitors , were found throughout the IM domain in a similar pattern in wild-type , DEAB-treated , and RA-treated embryos ( Figure S5 ) .", "Consistent with our previous results , wt1a expression was absent in DEAB-treated embryos , and wt1a was strongly up-regulated in RA-treated embryos ( Figure S5 ) .", "The expression domains of deltaC and jag2a , normally restricted to a proximal region of the IM adjacent to somites 2\u20135 , were absent in DEAB-treated embryos , and expanded posteriorly in RA-treated embryos ( Figure S5 ) .", "Expression of evi1 , found in the distal portion of the IM starting around somite 6 , was shifted anteriorly to somite 3 following DEAB treatment and reduced to the most posterior group of IM cells following RA treatment ( Figure S5 ) .", "These findings demonstrate that changes in RA dosage during gastrulation to early somitogenesis are associated with gene expression changes in IM progenitors , far in advance of their mesenchymal-to-epithelial transition that creates the pronephric tubules .", "In addition to RA , multiple tissues along the embryonic axis are segmentally patterned by the cdx genes [25 , 34] .", "Loss of cdx gene function leads to an expansion of anterior trunk fates and axial elongation defects that result in a loss/truncation of the posterior trunk and tail [23\u201330 , 34] .", "In zebrafish , cdx4\u2013/\u2013 mutant embryos display expanded wt1a expression at the 15-somite stage , suggesting that the podocyte lineage might be expanded and thus implicating cdx genes in pronephros patterning [24] .", "We therefore examined the formation of the pronephros in cdx4\u2013/\u2013 and cdx1a/4-deficient ( herein referred to as cdx-deficient ) to assess development of the renal corpuscle , tubule , and pronephric duct .", "In addition , we used differential interference contrast ( DIC ) optics to visualize the somite boundaries and determine the size and position of each segment relative to the somites .", "It is important to note that the size of posterior somites in cdx4\u2013/\u2013 embryos , and both the size and number of the somites in cdx-deficient embryos , is greatly reduced toward the posterior , due to the axial elongation defect [24 , 29\u201330] .", "A similar defect has also been observed in mouse Cdx mutants [34] .", "At 24 hpf , wild-type embryos expressed wt1a in presumptive podocytes ( located adjacent to somite 3 , marked by an arrow in Figure 5A ) as well as a population of presumptive mesenchymal cells located next to somites 1\u20133 in a broad lateral domain ( indicated by a bracket and \u2018M' in Figure 5A ) .", "cdx4\u2013/\u2013 embryos had expanded wt1a expression at 24 hpf that ranged from a position anterior to somite 1 to approximately somite 7 , and cdx-deficient embryos showed an even more dramatic posterior expansion that reached somite 12 ( Figure 5A ) .", "As the expansion of wt1a in cdx mutant embryos could indicate increased numbers of podocytes and/or the mesenchymal population , we examined wt1b expression , which specifically marks podocytes [65] .", "Equivalent numbers of wt1b-expressing podocytes were formed in cdx4\u2013/\u2013 mutant and wild-type embryos , but podocytes in cdx4\u2013/\u2013 embryos were located more posteriorly , at the level of somite 5 ( Figure 5A ) .", "cdx-deficient embryos developed a normal number of wt1b-expressing podocytes , though they were arranged in a pair of somewhat irregular linear groupings ( rather than forming bilateral spherical clusters ) , and they were also located more posteriorly , adjacent to somite 7 ( Figure 5A ) .", "We conclude from these observations that the loss of cdx4 and cdx1a/4 function progressively expands wt1a expression without increasing the number of podocytes and leads to podocyte formation at more posterior locations along the embryonic axis .", "To assess tubule formation in cdx mutants , we examined the expression of cdh17 at 24 hpf .", "While cdx4\u2013/\u2013 embryos formed complete tubules that fused at the cloaca , cdx-deficient embryos displayed cdh17 expression that was reduced and discontinuous , with the tubules failing to fuse ( Figure 5A ) .", "Consistent with the posterior shifts in podocyte position , the A-P position of the tubule , marked by cdh17 transcripts , was shifted caudally in both cdx4\u2013/\u2013 and cdx-deficient embryos .", "In wild-type embryos , the tubule spans the length of somites 4\u201318 , but was located from somites 6\u201320 in cdx4\u2013/\u2013 embryos , and from somites 8\u201313 in cdx-deficient embryos ( Figure 5A ) .", "We next characterized the tubule segmentation pattern in cdx mutant embryos by examining the expression patterns of slc20a1a ( PCT ) , trpm7 ( PST ) , slc12a1 ( DE ) , stc1 ( CS ) , slc12a3 ( DL ) , gata3 ( PD ) , and aqp3 ( cloaca ) .", "cdx4\u2013/\u2013 embryos showed a slight expansion of the PCT , which spanned an additional two somites compared to wild-types ( Figure 5A and unpublished data ) .", "The PST , DE , CS , and PD were all shorter than normal in cdx4\u2013/\u2013 embryos , with the PD displaying the most severe reduction in length ( Figure 5A and unpublished data ) .", "Transcripts for aqp3 were not detected in cdx4\u2013/\u2013 embryos , suggesting a defect in cloaca development ( Figure 5A ) .", "These results indicate that loss of cdx4 leads to a slight expansion in PCT fate with corresponding reductions in more distal fates .", "In contrast to cdx4\u2013/\u2013 embryos , cdx-deficient embryos showed discontinuous slc20a1a expression and failed to express trpm7 , slc12a1 , stc1 , slc12a3 , gata3 , or aqp3 ( Figure 5A ) .", "These results suggest that the tubule territory in cdx-deficient embryos acquires a PCT identity , while the remaining nephron segments fail to develop .", "These defects were not the result of delayed development , as at later developmental stages , cdx-deficient embryos continued to possess tubules that only expressed PCT-markers , and the tubules never fused caudally ( unpublished data ) .", "In addition , expression analysis of the podocyte marker mafB in cdx-deficient embryos at 48 hpf revealed that podocytes fail to fuse into a single renal corpuscle .", "Instead , the podocytes formed bilateral corpuscles that were dilated compared to wild-type and cdx4\u2013/\u2013 embryos , presumably due to fluid accumulation ( Figure 5B ) .", "Consistent with this , cdx-deficient embryos had developed glomerular cysts by 72 hpf , as well as severe pericardial edema , indicative of renal failure ( Figure 5C ) .", "In contrast , cdx4\u2013/\u2013 embryos never exhibited glomerular cyst formation or edema , suggesting that although various segment lengths were shortened , these embryos were able to maintain adequate kidney function ( Figure 5C ) .", "In summary , our expression analyses show that cdx deficiency causes a posterior shift in the location of the pronephros along the embryonic axis ( Figure 5D ) .", "While the podocytes and PCT populations formed relatively normally , the PST and distal tubule segments were reduced or absent in cdx4\u2013/\u2013 and cdx-deficient embryos , respectively ( Figure 5D ) .", "Thus the cdx genes , acting either directly or indirectly , are required for the formation of the distal nephron segments and establishing the normal segmentation pattern of the pronephros .", "Given the largely opposite effects of cdx-deficiency and loss of RA signaling on nephron patterning , as well as the recent report that cdx genes control how the hindbrain responds to RA during its patterning [30 , 31] , we wondered if an interplay between these pathways was operative during pronephros segmentation .", "The location and level of RA within tissues is dependent on the expression of raldh-synthesizing enzymes and cyp26-degrading enzymes [15 , 54] .", "We therefore investigated the expression of these genes in cdx-deficient embryos during early somitogenesis , as our previous experiments suggested that the IM is being influenced by RA signaling at this time .", "At the 5 somite stage , expression of raldh2 in the paraxial mesoderm was expanded posteriorly in cdx4\u2013/\u2013 embryos compared to wild-types ( Figure 6A ) .", "An even greater posterior expansion was seen in cdx-deficient embryos , with raldh2 transcripts being detected throughout the entire unsegmented paraxial mesoderm and tailbud region ( Figure 6A ) .", "Expression of the RA-catabolizing enzyme cyp26a1 in the upper trunk region was also expanded posteriorly in cdx4\u2013/\u2013 embryos at the 5 somite stage , and more extensively expanded in cdx-deficient embryos ( Figure 6A ) .", "To visualize how the combined changes in raldh2 and cyp26a1 expression altered the source of RA along the trunk , we generated digital overlays of these expression patterns .", "This analysis suggested that the anterior boundary of RA production ( i . e . , the junction of the cyp26a1 and raldh2 expression domains ) was located more posteriorly in cdx4\u2013/\u2013 mutants compared to wild-types , and that this posterior shift was more pronounced in cdx-deficient embryos ( arrows in Figure 6A ) .", "To better quantitate these posterior shifts , we examined expression of raldh2 and cyp26a1 at the 10 somite stage when the somites could be visualized by staining for myoD transcripts .", "We found that the raldh2 expression boundary in cdx4\u2013/\u2013 and cdx-deficient embryos was shifted posteriorly by 1 and 2 somites , respectively , compared to wild-type embryos ( Figure 6B ) .", "The cyp26a1 domain in wild-type embryos occupied the region of somites 2\u20133 , just rostral and slightly overlapping with raldh2 , as shown by double in situ hybridization ( Figure 6B ) .", "In cdx4\u2013/\u2013 embryos , cyp26a1 transcripts were detected in the region of somites 3\u20135 , whereas in cdx-deficient embryos they extended from somites 3\u20137 ( Figure 6B ) .", "These analyses reveal a striking correlation between the presumptive source of RA at the 10 somite stage and the axial position of the pronephros at 24 hpf in each genotype ( i . e . , the source of RA and the position of the pronephros both start at somites 3 , 5 , and 7 in wild-type , cdx4\u2013/\u2013 , and cdx-deficient embryos , respectively ) .", "The combination of these data , together with the results from our DEAB experiments , suggest a model in which the cdx genes act upstream of raldh2 and cyp26a1 to localize the source of RA along the A-P axis , and that RA , in turn , acts on the IM to induce the proximal segments and prevent an expansion of the distal segment fates .", "If our model is correct , then inhibiting RA synthesis in cdx-deficient embryos should rescue pronephric positioning and the formation of the distal tubule segments .", "To test this , we treated cdx4\u2013/\u2013 and cdx-deficient embryos with DEAB from 90% epiboly to the 5-somite stage and examined pronephros segmentation .", "In support of our model , we found that cdx4\u2013/\u2013 and cdx-deficient embryos exhibited a one-somite anterior shift in the position of the pronephros , as shown by expression of cdh17 ( Figure 7 ) .", "In addition , the development of podocytes was abrogated , and the length of the PCT was reduced in DEAB-treated cdx4\u2013/\u2013 and cdx-deficient embryos ( Figure 7 ) , consistent with our findings in wild-type embryos ( Figure 3 ) .", "We observed that the DE segment was increased in DEAB-treated cdx4\u2013/\u2013 embryos , as shown by an expansion of the slc12a1 expression domain ( Figure 7 ) .", "DEAB treatment also increased the number of CS cells in cdx4\u2013/\u2013 mutants , shown by the expression of stc1 , and increased the DL segment length , evidenced by expansion of the slc12a3 , romk2 , and clck expression domains ( Figure 7 and unpublished data ) .", "In cdx-deficient embryos treated with DEAB , formation of the DE , CS , and DL segments was rescued , shown by expression of slc12a1 , stc1 , and slc12a3 , respectively ( Figure 7 ) .", "A similar rescue of the expression of the DE and DL markers romk2 and clck was also observed ( unpublished data ) .", "These findings demonstrate that cdx gene function is not necessary to specify distal segment identity directly , but instead suggests that the abrogation of distal segment formation in cdx-deficient mutants is related to the level of RA that the renal progenitors are exposed to .", "Taken together with the above results , these finding provide good evidence that the pronephric positioning defect and failure to form the distal tubule identities in cdx-deficient embryos is caused by mis-localization of the RA source along the A-P axis ."], ["Retinoid signaling plays essential roles in the A-P patterning of a number of diverse tissues in the embryo .", "During early development , a source of RA in the upper trunk ( cervical ) region is produced by the action of the RA synthetic enzyme , Raldh2 , which is expressed in the anterior paraxial mesoderm [54] .", "The coordinate expression of RA-catabolizing Cyp26 enzymes in surrounding tissues creates a so-called \u2018sink' for this RA source [54] .", "Collectively , these enzymes are thought to create a gradient of RA activity that diffuses into surrounding tissues [34 , 54] .", "The functions of this RA source have been extensively studied in the developing hindbrain , where the effects of graded RA signaling are thought to create nested expression domains of RA-responsive genes that drive A-P segmentation of the hindbrain into a series of rhombomeres [15 , 54] .", "In addition to regionalizing the overlying neurectoderm , RA produced in the upper trunk paraxial mesoderm has been implicated in the regionalization of the underlying endoderm .", "Studies in zebrafish have shown that RA acts directly on the endoderm to specify hepatopancreatic progenitors that give rise to the liver and pancreas [17 , 18] .", "RA also influences mesodermal cell fate decisions during zebrafish development , including the formation of the pectoral fin field\u2014which arises from the lateral plate mesoderm adjacent to the upper trunk somites [56 , 57 , 66]\u2014and the heart [67] .", "In the latter case , inhibition of RA synthesis leads to an expansion of precardiac mesoderm , resulting in an excessive number of myocardial progenitors [67] .", "These findings indicate that , in addition to acting as an inducer of cell fates such as in the hindbrain and endoderm , RA also plays an important role in restricting certain cell fates .", "Our study now adds the IM as another mesodermal derivative that is patterned by RA .", "Our results show that RA production is essential during gastrulation and early somitogenesis for the induction of proximal nephron fates as well as to restrict the expansion of distal nephron fates .", "Over this period of development , RA is produced by the anterior paraxial mesoderm ( PM ) .", "The IM , which gives rise to the pronephros , is located lateral to the PM ( Figure 8 ) .", "Given the role of RA as a diffusible morphogen in other tissues , we hypothesize that RA diffuses from the PM and establishes a gradient along the IM , with high levels of RA inducing proximal fates and low RA levels being permissive for distal fates ( Figure 8 ) .", "Our time-course experiments with DEAB support this view , with the most severe reduction in proximal fates ( and concomitant expansion in distal segments ) corresponding to the longest treatment window .", "However , further work is needed to determine the nature of the RA gradient , as well as how dynamic fluctuations in retinoid availability [54] affect the dose and length of time that the renal progenitors are exposed to RA .", "A gradient-free model has recently been proposed for RA-dependent hindbrain patterning , based on the finding that sequential expression domains of the cyp26a1 , cyp26b1 , and cyp26c1 genes are essential for rhombomere boundary establishment [68 , 69] .", "It is unclear if a similar mechanism might operate during pronephros segmentation , as cyp26b1 and cyp26c1 do not show a nested pattern of expression in the IM .", "Overall , the effects of RA on the patterning of the IM can be regarded as \u2018anteriorizing .", "' Our finding that exogenous RA treatment induces proximal tubule fates to form throughout the pronephros supports this conclusion .", "Classically , RA is known as a \u2018posteriorizing' factor due to its effects on the central nervous system , where an inhibition of RA signaling causes an expansion of anterior neural fates in the hindbrain [15 , 54] .", "Thus we conclude that RA can actually have both anteriorizing and posteriorizing activities , depending on the tissue in question .", "A unified way to characterize these effects would be to consider the upper trunk RA source as an organizing center , akin to the dorsal organizer in the gastrula , that locally patterns cell types in all three germ layers .", "Previous studies have implicated RA as a regulator of renal development .", "Animal cap experiments in Xenopus showed that RA , together with Activin , is sufficient to induce the formation of pronephric tubules [70] .", "A more recent study in Xenopus reported that overexpressing various RA antagonists results in a complete loss of the pronephros ( glomus , tubules , and duct ) [55] .", "This phenotype is more severe than what we observed and may reflect differences in the efficacy of DEAB to completely block RA production compared with other RA antagonists .", "The pronephric tubules in Xenopus are segmented into proximal and distal segments [48] , similar to the zebrafish pronephros , however a role for RA in Xenopus nephron segmentation has not been reported .", "In mammals , it has long been known that vitamin A deficiency causes severe renal malformations [71] .", "Targeted mutagenesis of the RAR genes in mouse , followed by elegant rescue experiments , established an important role for RA as a dose-dependent inducer of the GDNF receptor Ret [72 , 73] .", "GDNF is an essential regulator of ureteric bud branching morphogenesis , and loss of GDNF signaling results most frequently in renal agenesis [74] .", "Because ureteric bud branching is an essential prerequisite for nephrogenesis , RA serves a key role in stimulating nephron formation .", "At present it is not known whether RA is also involved in the proximodistal patterning of metanephric nephrons .", "Interestingly , Raldh2 transcripts are found in podocyte progenitors , whereas Cyp26a1 is expressed by the tubule anlagen during metanephros development , suggestive of a role for RA in mammalian nephron patterning [75] .", "Transplantation studies in frogs suggest that RA may act directly on pronephric precursors [55] .", "However , the downstream targets of RA in the IM are not known .", "In the hindbrain , the presumptive RA gradient is thought to regulate rhombomere segmentation by activating the expression of the anterior , 3' Hox genes , i . e . , those comprising the 1st through 5th paralog groups [15 , 54 , 76] .", "In zebrafish , transcripts for hoxb1a , hoxb1b , and hoxb5a are found in proximal portions of the IM , thus making them potential candidates for mediating the effects of RA during pronephros segmentation [34] .", "Future studies using single , double , and triple morpholino injections can test the importance of these hox genes for renal development .", "The effects of RA on pronephric segmentation may also be coordinated by the action of non-Hox pathways .", "Our results suggest the intriguing possibility that RA signaling targets may include renal transcription factors as well as members of the Notch signaling pathway .", "The gene evi1 encodes a zinc-finger transcription factor that has been implicated in patterning distal regions of the pronephros in Xenopus , and overexpression of evi1 was found to inhibit proximal segment formation [63] .", "These data are consistent with our results showing that expression of evi1 in the IM was expanded following DEAB treatment , and reduced following exposure to exogenous RA .", "Another renal transcription factor candidate is the odd-skipped related transcription factor 1 ( osr1 ) encoding a zinc-finger repressor .", "Recent studies in Xenopus and zebrafish have shown that osr1 is expressed in the ventral mesoderm during gastrulation and later in an anterior domain of the IM [77] .", "Morpholino-mediated knock-down of osr1 leads to defects in the formation of podocytes and proximal tubule progenitors [77] , consistent with Osr1 participating in a common pathway with RA .", "The Notch pathway may also interact with RA during nephron segmentation .", "Conditional knockout of Notch2 in the mouse metanephros results in a loss of podocytes and proximal tubule fates , whereas distal markers are relatively unaffected [78] .", "In zebrafish , Notch signaling has been shown to regulate the differentiation of multiciliated cells and principle cells in the pronephric tubules [44 , 45] .", "However , a role for Notch signaling in the formation of proximal nephron fates is also suggested by the expression pattern of the Notch ligands deltaC , jag1b , and jag2a , which are restricted to proximal portions of the intermediate mesoderm [62 , 64] .", "Simultaneous knockdown of jag1b/2a results in an abnormally small renal corpuscle and dysmorphic proximal tubules , consistent with a conserved role for Notch signaling in proximal nephron development [79] .", "Our finding that DEAB treatment abrogates deltaC and jag2a expression in the proximal IM , while exogenous RA expands their expression , supports a role for RA acting upstream of the Notch pathway .", "Our study provides evidence that cdx genes control the expression domains of raldh2 and cyp26a1 along the embryonic axis .", "The boundaries of both raldh2 and cyp26a1 are progressively shifted toward the posterior in cdx4 and cdx1a/4-deficient embryos , suggesting that the upper trunk source of RA is posteriorly shifted .", "We hypothesize that this posterior shift in RA production results in a posterior shift in the position of the pronephros ( Figure 8 ) .", "We propose that this effect , combined with the axial elongation defects , leads to reduced or absent distal segment fates .", "The ability to rescue distal segments by treating cdx mutants with a pulse of DEAB is consistent with this model , and also demonstrates that cdx function is not requisite for the induction of distal fates from the intermediate mesoderm .", "Thus additional , as yet unidentified pathways , are responsible for directing distal fates .", "While our data supports the notion that Cdx factors exert their effects by the regulation of RA signaling , it does not rule out the possibility that Cdx factors may also function to repress proximal fates independent of RA signaling .", "Given the mounting evidence that the upper trunk RA source is an important organizing center , we would predict that both the patterning and positioning of numerous organs would be affected in cdx mutants .", "Consistent with this , defects in several mesodermal fates that arise in the anterior trunk region have been observed in cdx-deficient embryos .", "Vascular precursors are progressively expanded when cdx activity is abrogated , and blood precursors are both reduced and shifted posteriorly in cdx mutants [24 , 29] .", "In addition to mesodermal defects , cdx mutants also display patterning defects in the neurectoderm that gives rise to the anterior spinal cord [30 , 31] .", "We hypothesize that many , if not all , of these defects in cdx mutants are caused by the abnormal localization of RA along the A-P axis .", "The loss of cdx gene function in both zebrafish and murine models has been shown to cause global shifts in hox gene expression in the mesoderm and neurectoderm [24 , 25 , 29\u201330 , 34] .", "Given the rostral shifts and expansions of both raldh2 and cyp26a1 expression observed in cdx4 and cdx1a/4-deficient embryos , Hox transcription factors are attractive molecules for regulating raldh2 and cyp26a1 expression .", "Defects in blood formation in cdx4-null zebrafish can be rescued by the overexpression of several hox genes [24] , and the overexpression of hoxa9a also results in a partial rescue of the axis elongation defect in cdx4\u2013/\u2013 embryos [29] .", "Future studies are needed to examine whether hox gene overexpression ( s ) can rescue pronephros positioning and formation of distal segments in cdx mutant embryos .", "In conclusion , our studies have revealed an important link between the cdx genes and localization of RA , and provide evidence that RA signaling is a central determinant of pronephros A-P segmentation .", "Our results establish the zebrafish embryo as a simplified model of vertebrate nephron segmentation that will further our understanding of mammalian nephron segmentation , and provide insights into the causes of kidney birth defects and renal disease in humans ."], ["Zebrafish were maintained and staged as described [80 , 81] .", "T\u00fcbingen strain wild-type embryos were used for all experiments .", "DEAB and all-trans retinoic acid ( Sigma-Aldrich ) were dissolved in 100% dimethyl sulfoxide ( DMSO ) to make a 1 M stock and aliquots were stored at \u221280\u00b0C .", "For DEAB and RA treatments: embryos were incubated in 1 . 6 \u00d7 10\u22125 M DEAB/DMSO in E3 embryo media , 1 \u00d7 10\u22126 M or 1 \u00d7 10\u22127 M RA/DMSO in E3 embryo media , or 1 . 6 \u00d7 10\u22125 M DMSO ( control ) in E3 in the dark over particular developmental intervals , then washed five times with E3 and then fixed at 24 or 48 hpf .", "These experimental treatments were fully penetrant and produced consistent results at the doses and treatment windows that were examined .", "raldh2 morpholino ( CAACTTCACTGGAGGTCATCGCGTC ) was injected into 1-cell wild-type embryos .", "Incrosses of kggtv205 heterozygous adults ( maintained on the T\u00fcbingen strain ) were used to obtain cdx4\u2013/\u2013 embryos and were injected at the 1-cell stage with cdx1a morpholino ( CAGCAGATAGCTCACGGACATTTTC ) as described [29] to obtain cdx-deficient embryos .", "Both raldh2 and cdx1a morpholinos produced fully penetrant effects .", "Embryos were raised to appropriate stages and fixed in 4% paraformaldehyde ( PFA ) /1\u00d7PBST for gene expression analysis .", "For all reported gene expressions , at least 20 embryos were examined .", "Whole-mount in situ hybridization of zebrafish embryos was performed as previously described [24] .", "The expression patterns of cdh17 , clck , cyp26a1 , evi1 , gata3 , mhc , myoD , nbc1 , pax2a , pdzk1 , raldh2 , ret1 , sall1 , sglt1 , slc4a2 , slc20a1a , wt1a , and wt1b were previously reported [14 , 24 , 29 , 37 , 55 , 56 , 61 , 82\u201386] .", "For antisense probe production , we used the following IMAGE clone template plasmids , restriction enzymes for DNA linearization , and RNA enzymes: mafb: 7995399 , pExpress-1 , EcoR1 , T7; rfx2 , pBK-CMV , template was PCR amplified using primers GTGAATTGTAATACGACTCACTATAGGG and TTAACCCTCACTAAAGGGAACAAA , T7; slc9a3: 6996791 , pExpress-1 , EcoRI , T7; slc26a2: 4760214 , pBK-CMV , EcoRI , T7; slc13a1: 6793065 , EcoRV , t7; slc13a3: 4744276 , pCMV-sport6 . 1ccdb , EcoRI , T7; slc22a6: 4744276 , pBK-CMV , SalI , T7; slc12a1: pBK-CMV , EcoRI , T7; slc12a3: 7037010 , pExpress-1 , EcoRI , T7; stc1 was amplified from 24 hpf embryo cDNA using primers ATGCTCCTGAAAAGCGGATTT and TTAAGGACTTCCCACGATGGA and cloned into pGemTEasy , NcoI , Sp6 .", "Gene-specific primers spanning 700\u20131 , 000 bp of the coding sequence were used to amplify DNA fragments from E15 . 5/P0 kidney cDNA pools , and the PCR products of the right size were cloned into the pCRII-Topo vector ( primer sequences available upon request ) .", "DNA templates for riboprobe production were generated by PCR with T7 and Sp6 Ready Made primers ( Integrated DNA Technologies ) from PCRII-TOPO clones or T7 and T3 Ready Made primers from Bmap library clones .", "Digoxigenin-labeled anti-sense riboprobes were synthesized from the PCR product and purified with Micro Bio-spin columns P-30 Tris RNase-free ( Bio-Rad ) .", "Probes were diluted with prehybridization buffer ( 50% formamide , 5\u00d7SSC , pH4 . 5 , 50 \u03bcg/ml yeast tRNA , 1% SDS , 50 \u03bcg/ml heparin ) to 10 \u03bcg/ml and stored at \u221280 \u00b0C .", "Neonatal kidneys were dissected free of surrounding tissues except the ureter and fixed with 4% PFA at 4 \u00b0C for 24 h .", "After PBS washes , they were incubated with 30% sucrose at 4 \u00b0C overnight .", "Kidneys were swirled in five dishes of OCT to remove sucrose and mounted in OCT in a dry ice/ethanol bath .", "The OCT blocks were stored at \u221280 \u00b0C .", "Sections were cut at 20 \u03bcm and air dried .", "Sections were post-fixed with 4% PFA for 10 min , treated with 10 \u03bcg/ml proteinase K for 10 min and post-fixed for 5 min .", "Slides were acetylated ( 1 . 33% Triethanolamine , 0 . 065% HCl , 0 . 375% acetic anhydride ) for 10 min and dehydrated with 70% ethanol and 95% ethanol for 5 min each .", "Slides were air dried then incubated with 500 ng/ml digoxigenin-labeled riboprobes at 68 \u00b0C overnight .", "Hybridized sections were washed with 50% formamide , 1\u00d7SSC , pH4 . 5 for 30 min at 65 \u00b0C , treated with 2 \u03bcg/ml RNase for 15 min at 37 \u00b0C , and washed with 2\u00d7SSC , pH4 . 5 for 30 min , and twice with 0 . 2\u00d7SSC , pH4 . 5 for 30 min at 65 \u00b0C .", "Slides were washed three times at room temperature with 1\u00d7MBST ( 0 . 1 M maleic acid , 0 . 15 M NaCl , 0 . 1% Tween-20 , pH7 . 5 ) for 5 min each , and incubated with blocking solution ( 2% Boehringer Mannheim ( BM ) blocking reagent ) in 1\u00d7MBST , 20% heat-inactivated sheep serum ) for 1 h .", "After incubation with anti-digoxigenin antibody-AP ( Roche , 1:4000 ) at 4 \u00b0C overnight , sections were washed with 1\u00d7MBST at room temperature , 5 min for three times , then with NTMT ( 0 . 1 M NaCl , 0 . 1 M Tris-HCl , pH9 . 5 , 50 mM Mg2Cl , 0 . 1% Tween-20 , 2 mM Levimasole ) for 10 min , and developed with BM purple ( Roche ) .", "Color reactions were stopped with fixatives ( 4% PFA , 0 . 2% glutaraldehyde ) and sections mounted with glycergel mounting media ( DAKO ) .", "Images were captured with a Nikon DXM1200 digital camera attached to a Leitz DMRB microscope ."]], "headings": ["Introduction", "Results", "Discussion", "Materials and Methods"], "abstract": ["Kidney function depends on the nephron , which comprises a blood filter , a tubule that is subdivided into functionally distinct segments , and a collecting duct .", "How these regions arise during development is poorly understood .", "The zebrafish pronephros consists of two linear nephrons that develop from the intermediate mesoderm along the length of the trunk .", "Here we show that , contrary to current dogma , these nephrons possess multiple proximal and distal tubule domains that resemble the organization of the mammalian nephron .", "We examined whether pronephric segmentation is mediated by retinoic acid ( RA ) and the caudal ( cdx ) transcription factors , which are known regulators of segmental identity during development .", "Inhibition of RA signaling resulted in a loss of the proximal segments and an expansion of the distal segments , while exogenous RA treatment induced proximal segment fates at the expense of distal fates .", "Loss of cdx function caused abrogation of distal segments , a posterior shift in the position of the pronephros , and alterations in the expression boundaries of raldh2 and cyp26a1 , which encode enzymes that synthesize and degrade RA , respectively .", "These results suggest that the cdx genes act to localize the activity of RA along the axis , thereby determining where the pronephros forms .", "Consistent with this , the pronephric-positioning defect and the loss of distal tubule fate were rescued in embryos doubly-deficient for cdx and RA .", "These findings reveal a novel link between the RA and cdx pathways and provide a model for how pronephric nephrons are segmented and positioned along the embryonic axis ."], "summary": ["In the kidney , structures known as nephrons are responsible for collecting metabolic waste .", "Nephrons are composed of a blood filter ( glomerulus ) followed by a series of specialized tubule regions , or segments , which recover solutes such as salts , and finally terminate with a collecting duct .", "The genetic mechanisms that establish nephron segmentation in mammals have been a challenge to study because of the kidney's complex organogenesis .", "The zebrafish embryonic kidney ( pronephros ) contains two nephrons , previously thought to consist of a glomerulus , short tubule , and long stretch of duct .", "In this study , we have redefined the anatomy of the zebrafish pronephros and shown that the duct is actually subdivided into distinct tubule segments that are analogous to the proximal and distal segments found in mammalian nephrons .", "Next , we used the zebrafish pronephros to investigate how nephron segmentation occurs .", "We found that retinoic acid ( RA ) induces proximal pronephros segments and represses distal segment fates .", "Further , we found that the caudal ( cdx ) transcription factors direct the anteroposterior location of pronephric progenitors by regulating the site of RA production .", "Taken together , these results reveal that a cdx-RA pathway plays a key role in both establishing where the pronephros forms along the embryonic axis as well as its segmentation pattern ."], "keywords": ["developmental biology", "danio (zebrafish)", "vertebrates", "teleost fishes", "nephrology"]}

dummy/PLOS/val.json

@@ -0,0 +1 @@
+{"id": "journal.pgen.1002882", "year": "2012", "title": "Genetics and Regulatory Impact of Alternative Polyadenylation in Human B-Lymphoblastoid Cells", "sections": [["Naturally occurring genetic differences in gene regulation within populations underlie phenotypes of evolutionary and biomedical interest [1]\u2013[3] and can serve as the basis for inference of regulatory networks [4] , [5] .", "A key problem in the field is understanding the molecular mechanisms by which DNA sequence variants give rise to expression change .", "Recent work has emphasized the importance of sequence differences in regions upstream of gene loci that harbor cis-acting determinants of transcription factor binding [6]\u2013[10] and chromatin architecture [11]\u2013[13] .", "Much less is known about the role of 3\u2032-end regulation as a determinant of expression variation between individuals .", "Alternative polyadenylation represents a major regulatory strategy in the human genome , with analysis across tissue types detecting multiple 3\u2032 UTR forms of over half of all human genes [14] .", "Detailed genetic studies have implicated polymorphisms affecting transcript termination in both Mendelian and complex human disease [15]\u2013[20] .", "Genomic analyses have hinted at a broader role for genetic differences in RNA 3\u2032-end processing as a driver of expression variation [6] , [8] , [21] , [22] , but the prevalence and the mechanisms of these changes are incompletely understood .", "Progress in dissecting the genetics of 3\u2032-end processing has been limited in part by fundamental questions about the regulatory information encoded in 3\u2032 UTRs .", "Single-gene studies have made clear that , in addition to its interplay with exonic splicing [23] , [24] , RNA 3\u2032-end processing can dictate the extent of 3\u2032 UTR sequence incorporated into mature transcripts that governs half-life , translation , and localization [25]\u2013[29]; the efficiency of transcription termination itself can also influence steady-state expression level of a given length form [30]\u2013[34] .", "In general , however , identifying the regulatory elements that underlie relationships between 3\u2032 UTR sequence and gene expression remains a primary challenge , and for the majority of human genes , the regulatory impact of alternative polyadenylation is unknown .", "Likewise , the search for molecular players underlying cis-regulation of 3\u2032-end processing at individual gene loci [23] and genome-scale regulation of 3\u2032-end processing in trans [14] , [29] , [35]\u2013[40] is an area of active research .", "A complete understanding of the genetics of alternative polyadenylation will require maps of transcript end site usage and 3\u2032 cis-regulatory elements , and analysis strategies to integrate the data .", "Recently developed short-read sequencing methods for transcript ends [40]\u2013[46] have enabled the possibility of quantitative studies of the regulatory architecture of transcript end forms on a genomic scale .", "In this work , we set out to investigate mechanisms by which alternative polyadenylation impacts gene expression and its variation across genetically distinct human individuals .", "We used 3\u2032-end RNA-seq [42] to maximize the genomic coverage and precision of transcript end positions , and to measure quantitative expression levels of transcript forms .", "The results shed light on the architecture of transcript ends and regulatory elements in human 3\u2032 UTRs and the principles of genetic variation in 3\u2032 length form usage ."], ["To survey the 3\u2032 ends of transcripts in human B-lymphoblastoid cells , we isolated RNA from cell lines derived from six human individuals and subjected each replicate of each sample to 3\u2032-end RNA-seq , which sequences polyadenylated transcript ends on a genomic scale [42] with strong and significant reproducibility ( Figure S1 ) .", "Our analysis pipeline , described in Materials and Methods , filtered out likely products of mispriming from A-rich genomic regions [47] and categorized mapping reads in terms of well-defined peaks or dispersed regions of reads with no peak structure ( Table S1 ) .", "We considered the former to represent the strongest candidates for stable , functional transcript end forms , and focused on these for in-depth analysis , taking the last mapped base of each read as the likely site at which the nascent RNA was cleaved from the processing polymerase and polyadenylated [24] .", "Across such transcript ends mapping to nuclear-encoded loci , the vast majority of reads ( 87% ) originated from 3\u2032 UTRs of coding genes ( Figure 1A and Table S1 ) ; 80% of transcript ends were consistent with the 3\u2032 ends of previously annotated length forms ( Tables S1 and S2 and Figure S2 ) .", "Within 40 base pairs of the inferred cleavage position , most transcript end forms harbored a polyadenylation signal sequence: either the canonical A ( A/U ) UAAA [23] or a close variant , or an A-rich stretch [48]\u2013[50] ( Figure S3A ) .", "Reporter assays confirmed the regulatory importance of A-rich stretches upstream of the inferred cleavage positions in CPSF1 and WDR18 , whose 3\u2032 UTRs lacked canonical polyadenylation signal motifs ( Figure S3C ) .", "We set out to analyze our data set of 3\u2032 transcript ends with respect to alternative polyadenylation , focusing on a maximum of two abundant , distinguishable transcript forms in a given gene .", "We considered three patterns of transcript end usage [30]: class I , indicating genes with a single transcript form terminating in an annotated 3\u2032 UTR; class II , genes with alternative polyadenylation in the same annotated 3\u2032 UTR; and class III , genes in which the two alternative polyadenylation forms differed in their composition of coding sequence ( Figure 1B ) .", "We also observed a small fraction of genes with a single transcript form terminating inside annotated coding exons or introns ( Table S3 ) .", "The breakdown of transcript forms into these classes revealed alternative polyadenylation reaching our threshold of detection in \u223c30% of genes ( Figure 1B ) .", "Across these genes , we observed the expected enrichment of the A ( A/U ) UAAA polyadenylation signal motif in the distal relative to proximal polyadenylation signals ( Figure S3A ) , correlating with the higher expression levels of the long transcript forms [30] , [51] .", "The lower-abundance short transcript forms were more likely to harbor an A-rich stretch or no recognizable polyadenylation signal motif upstream of the inferred cleavage position ( Figure S3B ) , lending credence to the notion that the latter regions represent weak recognition sites for the 3\u2032-end processing machinery [48] .", "We sought to harness our data set of transcript ends to investigate regulatory elements governing translation and transcript half-life , and their relationship to alternative 3\u2032 transcript forms .", "For this purpose , we applied a motif-search strategy to identify putative microRNA binding sites , A/U rich elements ( AREs ) , G/U-rich elements , binding sites for the Pumilio family of proteins , and Alu transposable elements in 3\u2032 UTRs .", "We tabulated rates of sequence variation across human populations and observed marked conservation of most regulatory element motifs relative to the background level of 3\u2032 UTR polymorphism ( Figure 2A ) , reflecting a history of purifying selection on these putatively functional regulatory sequences [52]\u2013[54] .", "We expected that the regulatory logic of alternative polyadenylation would be intimately connected with sequence determinants of transcript half-life or translation in 3\u2032 UTRs .", "For a given gene subject to alternative polyadenylation , we referred to the region of the 3\u2032 UTR upstream of the proximal cleavage site as \u201cshared\u201d among the alternative polyadenylation length forms , and the span of the 3\u2032 UTR in between the proximal and distal cleavage sites as the \u201cdifferential\u201d region ( Figure 2B ) .", "We hypothesized that , if alternative polyadenylation often acted to tune the exposure of cis-regulatory motifs in 3\u2032 UTR sequences , these motifs would preferentially be positioned in differential regions .", "To test this , we tabulated the positions of each type of regulatory element across our set of alternatively polyadenylated genes in class II .", "Significance testing revealed a significant enrichment of genes with motifs in the differential regions of 3\u2032 UTRs relative to those with motifs in shared regions ( Figure 2C ) .", "Analyzing the annotations of genes in these sets , we observed a preponderance of genes with immune-related functions among those with cis-regulatory motifs in the differential regions of 3\u2032 UTRs , while motifs in shared regions of 3\u2032 UTRs were largely detected among genes with housekeeping roles ( Table S5 ) .", "Thus , for genes carrying out immune processes in B-lymphoblastoid cells , the choice between long and short transcript end forms often exposes or eliminates regulatory information in 3\u2032 UTRs , highlighting the importance of 3\u2032-end processing in the control of gene expression levels for specialized cell functions .", "To investigate the genetics of RNA 3\u2032-end processing , we first assessed the contribution of genetic differences , relative to experimental and environmental error , to variation of transcript 3\u2032-end positions across the six genotypes of lymphoblastoid cells in our study .", "For this purpose , we calculated the heritability of length form abundance for each gene , finding 194 coding genes at which the abundances of transcript length forms differed reproducibly ( heritability>0 . 6 ) across human samples ( Table S6 ) .", "To begin to dissect the molecular basis for natural genetic variation in 3\u2032-end usage at these loci , we considered the potential role for DNA sequence differences at polyadenylation signals , the primary determinants of transcript cleavage and polyadenylation .", "We reasoned that although such variants were rare in the human population ( Figure 2A ) , some could underlie differences between human individuals in 3\u2032-end length form usage .", "Consistent with this prediction , genes with highly heritable transcript end positions harbored a single nucleotide polymorphism in polyadenylation signal motif sequence much more often than did the average gene ( 2% of polyadenylation signals at genes with heritable transcript ends , compared to 0 . 3% genome-wide; Fisher's exact p\u200a=\u200a0 . 004; Table S6 ) .", "We hypothesized that naturally occurring genetic variation in RNA 3\u2032-end processing would prove to underlie changes across individuals in steady-state levels of gene expression .", "To test this , we analyzed the genomic relationship between biallelic single-nucleotide polymorphisms in polyadenylation signals and gene expression differences across our set of lymphoblastoid cell lines from distinct human genotypes .", "We used a standard regression test of genetic association to evaluate genotype at each such sequence variant as a predictor of expression of the gene in which it lay .", "The results revealed a significant enrichment of association with expression for variants in polyadenylation signals , relative to the background signal from 3\u2032 UTRs as a whole ( Figure 3A ) .", "We expected that for a given such variant , the allele conferring a closer match to the canonical polyadenylation signal motif would confer more robust transcription termination , and thus more abundant steady-state levels of transcription , than would the allele weakening the match to the canonical motif .", "To quantify this effect , we scored each allele in each variant polyadenylation signal with respect to agreement with the canonical motif , and at each variant position , we calculated the difference in scores between alleles .", "This score difference was a strong predictor of the effect of a given polyadenylation signal variant on steady-state expression levels ( Figure 3B ) , with a departure from the polyadenylation signal motif associated with a drop in expression as predicted .", "To pursue on a molecular basis the impact of variation across humans in polyadenylation signals , we used our 3\u2032-end RNA-seq data to infer the effects of single-nucleotide variants on usage of 3\u2032 transcript forms at individual genes , and we evaluated these predictions in single-gene 3\u2032 UTR reporter assays .", "For each gene , toggling natural variant alleles at one nucleotide position in the polyadenylation signal was sufficient to drive differential usage of short and long 3\u2032 transcript forms ( Figure 4 ) .", "These included variants attenuating usage of 3\u2032 forms of the translation initiation factor EIF2A and the putative DNA methylation enzyme DIP2B , as well as the expected effect of the polymorphic polyadenylation signal on usage of 3\u2032 forms of the inflammation regulator IRF5 [15] .", "In each of the latter genes , the causal variant conferred significant changes in luciferase protein levels as well as usage of transcript forms ( Figure 4A\u2013F ) .", "Our set of confirmed causal variants at polyadenylation signals also included that in the transcription factor NAB1 , which attenuated usage of a minor 3\u2032 transcript form with modest effect on luciferase levels ( Figure 4G , H ) .", "We conclude that sequence differences in polyadenylation signals represent a key mechanism underlying variation between humans in levels of gene expression , with genome-scale trends validated at the single-gene level .", "We next sought to dissect the mechanisms by which natural variation in 3\u2032-end usage impacted gene expression , using as case studies IRF5 and DIP2B , which lie in genomic regions associated with susceptibility to lupus [15] and colorectal cancer [55] , respectively , as well as NAB1 and EIF2A .", "In RNA expression measurements using the 3\u2032 UTR haplotype that produced both long and short transcript forms of a given gene , one form was detected at higher abundance in each case ( Figure 4B , D , F , H ) .", "We hypothesized that these abundance differences between length forms could be in part the result of sequence elements that dictate transcript cleavage , polyadenylation , and termination , and in part the result of regulatory elements that affect transcript half-life .", "To test this , for each gene we first developed expression reporters incorporating only the regions flanking the end positions of each transcript form in turn , which we expected would include the polyadenylation signal and auxiliary sequence motifs underlying 3\u2032-end processing of the respective form while excluding most other 3\u2032 regulatory information .", "Expression measurements confirmed differences in the strength of these 3\u2032-end processing motifs between length forms for EIF2A , IRF5 , and DIP2B , in that reporters incorporating each of the two 3\u2032-end sequences from a given gene exhibited up to 2 . 5-fold differences in expression ( Figure 5A , C , E ) .", "To assess the contribution of 3\u2032 regulatory elements that control transcript half-life , we next measured the decay rate of each transcript length form upon addition of actinomycin D in the context of complete 3\u2032 UTRs .", "Measurements of transcript stability by quantitative PCR and by Northern blot bore out this prediction , with the long transcript form showing reduced half-life relative to the short form for IRF5 [15] and DIP2B ( Figure 5D , F and Figure S4B , C ) , and increased half-life for NAB1 ( Figure 5H and Figure S4D ) .", "Analyzing these results together with the effects of natural variants in polyadenylation signals ( Figure 4 ) indicates that for a given gene , a variant can abrogate production of a transcript form with strong sequence determinants of 3\u2032-end processing , leaving only the less efficiently processed form and giving rise to lower total expression of the gene product , as in IRF5 and EIF2A .", "In addition , a variant abrogating production of a transcript form with longer half-life leaves only the less-stable form and reduces total steady-state levels of the gene product , as in IRF5 and DIP2B .", "As a further investigation of the determinants of abundance of long and short transcript forms for genes subject to natural genetic change in 3\u2032-end processing , we analyzed the role of 3\u2032 regulatory elements in such genes in relation to trans-acting regulatory factors .", "We identified a candidate ARE in the differential region of the 3\u2032 UTR of IRF5 , i . e . between the positions of alternative 3\u2032 ends observed in our 3\u2032-end RNA-seq; a candidate ARE in the differential region of NAB1; and a candidate binding site for the miRNA miR-101 in the differential region of DIP2B ( Figure 6 ) .", "To assess the functional relevance of these motifs , we applied a mutagenesis strategy using 3\u2032 UTR reporter constructs for each gene , as above distinguishing between the 3\u2032 UTR haplotype that produced both long and short transcript forms and the haplotype producing only the long form ( Figure 4D , F , H ) .", "For each inferred cis-regulatory element , we assayed the regulatory response of 3\u2032 UTR reporters to the trans-acting factor predicted to mediate its repressive effect: the ARE-binding proteins TTP and AUF1 for IRF5 and NAB1 , respectively , and a mimic of miR-101 for DIP2B .", "In each case , expression measurements from mutagenized reporter constructs established the respective sequence element as necessary for full repression of the long form of its host UTR ( Figure 6 ) , validating our motif inferences .", "Among experiments that used haplotypes producing both short and long 3\u2032 forms of the respective UTRs , motifs in the differential region were only necessary for repression by trans-acting factors in the case of NAB1 ( Figure 6C ) , for which the population of transcripts arising from this haplotype was dominated by the long form ( Figure 4H ) .", "Taken together , our results illustrate the complexity of regulatory information in 3\u2032 UTRs , as determinants of RNA 3\u2032-end processing and transcript fate each contribute to the final expression level of the host gene .", "We conclude that , for these case studies , integrating predicted regulatory motifs with knowledge of transcript end positions is essential in the effort to relate genotype to gene expression .", "We next aimed to shed light on the biological context in which differences in regulatory responsiveness could manifest between long and short transcript forms .", "For this purpose , we focused on natural variation in alternative polyadenylation at the immune regulator IRF5 .", "In response to the bacterial cell wall component lipopolysaccharide ( LPS ) , immune genes undergo an immediate spike in expression , followed by dampening to a more modest steady-state level mediated by the ARE-binding protein TTP [56]\u2013[58] .", "Motivated by our discovery of a repressive ARE in the differential region of IRF5 ( Figure 6A ) , we hypothesized that the genetically determined production of long and short 3\u2032 mRNA forms of this gene would be associated with different patterns of regulatory behavior after induction .", "To test this , we treated B-lymphoblastoid cell lines from genetically distinct individuals with LPS and , in each culture , measured the recovery of expression levels of IRF5 transcript forms over time .", "The results , shown in Figure 7 , revealed , after an initial overshoot in expression , a difference of up to 2-fold in the time to reach steady-state expression between long and short mRNA forms , with the long form downregulated to steady-state more quickly after induction as predicted , given the presence of the repressive ARE in the latter transcript .", "Variation in IRF5 expression recovery across B-lymphoblastoid lines was associated with genotype at the proximal polyadenylation signal in the IRF5 3\u2032 UTR: haplotypes encoding the long form of IRF5 conferred rapid repression after induction ( Figure 7B ) relative to haplotypes encoding the short form ( Figure 7A ) .", "These findings suggest that genetic variation in 3\u2032-end processing dictates differences across individuals in the regulatory dynamics of IRF5 , further underscoring the power of our approach to identify biologically relevant regulatory effects of 3\u2032-end processing .", "Our molecular confirmation of cis-regulatory elements in 3\u2032 UTRs inferred from sequence search methods ( Figure 6 ) suggested that such inference could provide a mechanistic understanding of gene expression on a genomic scale .", "In particular , we expected that sequence variants between individuals in 3\u2032 regulatory elements would be significant predictors of variation in steady-state expression of the genes in which they lay .", "To test this notion , we first tabulated all single-nucleotide polymorphisms across the cell lines of our data set which overlapped with 3\u2032 regulatory motifs and Alu elements in 3\u2032 UTRs .", "We next classified these motifs according to the impact of alternative polyadenylation on their positions in 3\u2032 UTRs , and we used association tests to assess the strength of each motif variant in each class as a predictor of steady-state expression of its respective gene .", "The results ( Figure 8 ) revealed association with expression across human individuals , for variants in AREs , G/U-rich elements , Pumilio sites , and Alu elements .", "The relationship with expression was striking and significant for variants in regions of 3\u2032 UTRs constitutively incorporated into mature messages ( Figure 8 ) .", "Polymorphic motifs incorporated into low-abundance 3\u2032 length forms showed no evidence of association with expression changes in their respective genes , consistent with the minor contribution of these forms; by the same token , polymorphic motifs in regions incorporated into the predominant 3\u2032 length forms of mRNAs were more strongly associated with expression of their respective genes , though not significantly so ( Figure 8 ) .", "As expected [6] , the relationship between sequence variants and gene expression did not manifest for miRNA sites ( data not shown ) .", "These findings highlight the relevance of 3\u2032 regulatory motifs as predictors of expression variation across human individuals , when integrated with knowledge of transcript length forms from our sequencing strategy ."], ["Alternative polyadenylation is prevalent in the human transcriptome , and in landmark cases , variation across individuals in the use of 3\u2032 length forms of RNAs has been shown to underlie human disease [15]\u2013[20] .", "However , for most human genes , the regulatory importance of changes in transcript ends between individuals is incompletely understood , owing to the challenges of measuring 3\u2032-end usage and identifying functional regulatory elements in 3\u2032 UTRs .", "We have developed a spatially precise , quantitative , high-throughput sequencing approach for 3\u2032 ends , complementing now-classic studies of expressed sequence tags [30] , [36] , [48] , [51] , [59]\u2013[61] .", "We have used the resulting transcript end positions and abundances to pioneer an analysis approach which integrates bioinformatic predictions of 3\u2032 regulatory motifs , genomic analysis , and molecular genetics .", "With this strategy , we have established a regulatory map of transcript ends and functional elements in the 3\u2032 UTRs of lymphoblastoid cells , and we have abstracted genomic principles of alternative polyadenylation and natural genetic variation in this cell type .", "Our mapping of 3\u2032-end length forms and sequence motifs in 3\u2032 UTRs revealed an intuitive logic in which the choice between short and long UTR forms governs the incorporation of regulatory elements into mature messages [36] , [61] .", "We note that the 3\u2032 length forms we report in B-lymphoblastoid cells represent a subset of the total complement of 3\u2032 UTR lengths used across tissues .", "As such , we hypothesize that surveys of tissue types will ultimately reveal transcript forms of many genes , used in particular contexts , that incorporate 3\u2032 regulatory information to different extents .", "The ability to tune the responsiveness to trans-acting input itself distinguishes alternative polyadenylation from other transcriptional and post-transcriptional regulatory mechanisms , providing a compelling model for the particular advantage of 3\u2032-end processing as a regulatory strategy and a rationale for its prevalence in mammalian genomes .", "In comparisons across cell lines from genetically distinct individuals , we analyzed the regulatory importance of genetic changes at 3\u2032 transcript ends .", "We uncovered a key role for polymorphisms in polyadenylation signals as a driver of changes in gene expression , and we detailed the molecular mechanisms at play .", "The polyadenylation variants we study here dictate the production of transcript forms with different determinants of 3\u2032-end processing , different half-lives , and different recognition sites for trans-acting regulators .", "These findings establish a connection between observational studies of transcript 3\u2032 length forms across human populations [21] , [22] and regulatory effects of this variation .", "In the case of IRF5 , we discovered that a naturally occurring genetic change in usage of 3\u2032 RNA forms can serve to tune the kinetics of recovery of expression after induction by lipopolysaccharide .", "Thus , against the backdrop of prior studies of this lupus susceptibility gene [15] , we have uncovered an additional dimension by which variation in RNA 3\u2032-end processing affects regulatory behavior .", "Given these case-study results as a validation of our genome-scale analyses , we speculate that many genetic variants with biologically relevant effects mediated by RNA 3\u2032-end processing remain to be discovered in the human population .", "We have also shown that polymorphisms in 3\u2032 motifs that govern transcript fate can serve as predictors of steady-state levels of the genes in which they lie .", "In light of the ultimate goal of predicting regulatory and phenotypic effects from human genome sequence , our results indicate that analysis strategies using sequence determinants of transcription initiation and splicing alone are likely to provide an incomplete model of expression variation .", "Importantly , however , our work makes clear that binding sites for regulators of mRNA localization , half-life , and translation at 3\u2032 ends are themselves only part of the regulatory landscape .", "Rather , a complete understanding of the genetics of gene expression will integrate the usage of RNA 3\u2032-end processing signals with the effects of 3\u2032 sequence elements that control transcript fate .", "We anticipate that abundances and positions of transcript ends observed in 3\u2032-end RNA-seq will prove to be a key component in the systems-level modeling of regulatory networks and their variation .", "In summary , while the genetic study of RNA 3\u2032-end processing is in its infancy , our work and that of others [15]\u2013[22] establishes that variation at 3\u2032 ends can be a critical determinant of regulatory behaviors .", "However , for the vast majority of human genes , the importance of 3\u2032 regulatory change remains unknown .", "Our single-gene experiments detail the expression effects of 3\u2032 UTR variation in the disease-associated genes IRF5 [15] and DIP2B [55]; the potential for regulatory variants as drivers of human disease will serve as continued motivation for genomic and genetic analyses of expression change ."], ["Two biological replicates of each of the human lymphoblastoid cell lines GM10860 , GM17106 , GM17189 , GM17207 , GM17220 , and GM17253 ( Coriell Institute ) were cultured in RPMI 1640 medium supplemented with 2 mM L-glutamate and 15% fetal bovine serum .", "Cells were incubated at 37\u00b0C under 5% carbon dioxide .", "Total RNA was extracted from \u223c107 cells using TRIzol reagent ( Invitrogen ) , and genomic DNA was removed from RNA using Turbo DNase ( Ambion ) .", "Polyadenylated RNA was selected from 10 \u00b5g of total RNA using the Dynabeads mRNA purification kit ( Invitrogen ) , and was fragmented for 3 minutes at 70\u00b0C using 10\u00d7 Fragmentation Reagent ( Ambion ) .", "After ethanol precipitation , polyadenylated RNA fragments were selected using the Dynabeads mRNA purification kit and reverse transcribed using SuperScript II ( Invitrogen ) and anchored oligo-dT ( Invitrogen ) .", "Double-stranded cDNA was generated using RNase H ( Invitrogen ) and DNA Pol I ( Invitrogen ) , end-repaired using T4 DNA Polymerase ( New England Biolabs ) , Klenow DNA Polymerase ( New England Biolabs ) , and T4 PNK ( New England Biolabs ) , and then adenylated using Klenow 3\u2032 to 5\u2032 exo minus ( New England Biolabs ) .", "Illumina paired-end adapters were ligated to the adenylated cDNA using T4 DNA Ligase ( Enzymatics ) .", "Ligated cDNA was purified on a 2% agarose gel and then amplified by performing 12 cycles of PCR using Phusion HF Polymerase ( New England Biolabs ) .", "Libraries were sequenced using 40 bp paired-end modules on an Illumina 2G Genome Analyzer .", "Consecutive T's from the beginning of all reads were trimmed and classified before mapping: for a given read , if there were more than 20 consecutive T's or if neither mate of a read pair had a stretch of T's , the read was not included in further analysis .", "For mapping , the set of single nucleotide polymorphisms ( SNPs ) segregating in the CEU population was downloaded from HapMap phase II+III , release 27 ( ftp://ftp . ncbi . nlm . nih . gov/hapmap/genotypes ) , and used to modify the human reference genome ( hg18; [62] ) by incorporating the appropriate ambiguous bases at each SNP position .", "All reads were then mapped to this modified genome and to the associated splicing junctions in the Known Genes database of the UCSC genome browser [63] using MOSAIK ( http://bioinformatics . bc . edu/marthlab/Software_Release ) .", "For a given length of trimmed T's , nT , a splicing junction reference was created by concatenating 37 - nT bp from each exon adjacent to the splicing junction to ensure that the reads mapped across the splicing junction .", "If the reads mapped to both the genome and a splicing junction , the mapping with smaller number of mismatches was used .", "Only uniquely mapped reads with two or fewer mismatches in each mate were retained .", "Trimmed T's were then compared to the genome sequence; reads with >2 mismatches to the genome in this poly-T tract were retained for analysis .", "We inferred that a given read was transcribed from the minus strand of the genome if , when it was mapped to the reference genome , the position of its poly-T tract had a lower coordinate position than the mapped position of the other end of the read; we inferred that a read was transcribed from the plus strand of the genome if the mapped position of its poly-T tract had a higher coordinate position than the position of the other end .", "Mapped reads yielded an average coverage of 22 . 6% of UCSC annotated 3\u2032 UTRs with a depth of 97 . 8 reads/bp for the covered bases for each sample .", "The last 100 bp of annotated 3\u2032 UTRs were even more highly represented in libraries , with an average coverage of 43 . 4% and an average depth of 211 . 1 reads/bp .", "Mapped reads from all samples were pooled , sorted according to the polyA positions , defined as the coordinate of the base adjacent to the polyA tail , and then grouped into tag clusters as follows .", "For each strand of each chromosome , the 5\u2032 boundary of a tag cluster was set as the polyA position of the first read , and then reads were sequentially added to this unit until the polyA position of the next read was more than 15 bp away .", "The latter position then became the 5\u2032 boundary of the next tag cluster .", "Most tag clusters spanned less than 24 bp , but if the polyA positions in a cluster spanned more than 40 bp , we applied a peak-finding algorithm as follows .", "For each genome coordinate in the region corresponding to the tag cluster , we defined the read count as the number of reads whose polyA position overlapped the coordinate .", "From these we first identified the genome coordinate ( posM ) with the greatest read count ( MaxHeight ) .", "We then delineated a window 40 bp upstream and 40 bp downstream of this coordinate .", "Within this window , we retained all coordinates with read counts greater than 10% of MaxHeight .", "Of these , we identified the most 5\u2032 and 3\u2032 polyA positions ( posL and posR ) .", "All reads in the tag cluster were then divided into three new candidate tag clusters: reads with positions 5\u2032 to posL , reads with positions including and between posL and posR , and reads with positions 3\u2032 to posR .", "If the distance between posL and posR was longer than 40 bp , the middle candidate tag cluster was eliminated from further analysis .", "If the read counts of all coordinates in a candidate tag cluster were below 10% of MaxHeight , the candidate unit was eliminated .", "If a candidate tag cluster contained coordinates with read counts larger than 10% of MaxHeight , we identified the coordinate with the largest read count within this candidate tag cluster and repeated the peak-finding algorithm .", "For each tag cluster retained for analysis , we defined the polyA position of the unit as the median of the polyA positions of all reads encompassed by the unit .", "After establishing that the stretch of A's in each read represented a mismatch to the genome sequence ( see above ) , we filtered out reads with a potential origin from internal priming from A-rich regions of the genome by removing any tag cluster whose defined polyA position was followed by 10 or more A's in the genome sequence within 20 bp .", "We also filtered out reads with a potential origin as PCR clones or false mapping as follows .", "We expected that for a given set of paired-end reads falling into a tag cluster , the characteristics of read ends originating from biological 3\u2032-end processing should be distinct from the characteristics of read ends originating from fragmentation , reverse transcription , and ligation during RNA-seq library preparation .", "In particular , we reasoned that the polyA positions of a set of reads in a tag cluster with origin as a biologically relevant transcript would be less heterogeneous than the positions of the other mates of the reads .", "If the opposite were true , we considered the tag cluster to be a likely product of false mapping or PCR duplication .", "As such , we retained a tag cluster for analysis only if the precision of polyA positions across the reads of the unit was greater than the precision of the positions of the other mates .", "The precision was calculated by where ni is the number of reads at the ith position and N is the total number of reads in the tag cluster .", "We also filtered out any tag cluster whose total read count across all samples amounted to fewer than 50 reads .", "For tag clusters with read counts between 50 and 100 , we calculated the Pearson correlation coefficient R between each pair of the two biological replicates across the six cell line samples , and eliminated the tag cluster from further analysis if the absolute value of R was less than 0 . 5 .", "For use in searches for regulatory motifs , we harnessed all 3\u2032-end RNA-seq reads in tag clusters from all samples to define a consensus base at each position in 3\u2032 UTRs as follows .", "At every genomic coordinate covered by five or more 3\u2032-end RNA-seq reads , the consensus nucleotide was chosen as that with highest frequency across the sample .", "If the second most abundant base was more than 20% in abundance , it was incorporated into the consensus using an ambiguous base notation ( M\u200a=\u200aA or C , R\u200a=\u200aA or G , W\u200a=\u200aA or T , S\u200a=\u200aC or G , Y\u200a=\u200aC or T , K\u200a=\u200aG or T ) .", "For every tag cluster , the consensus sequence of the region 40 bp upstream from the polyA position was searched for a polyadenylation signal using the known hexamer motifs sorted by their abundance in the human genome from [30] .", "Polyadenylation signals with higher abundance were given higher priority when there was more than one instance in the 40 bp upstream window .", "In the absence of a match to these motifs , the 40 bp upstream window was searched for an A-rich stretch as follows .", "We identified any 9 bp regions containing at least 6 A's and considered each such region a candidate polyadenylation signal; if no such candidate signal were present , we considered the tag cluster not to have an identifiable polyadenylation signal .", "If more than one candidate signal was present , we retained the one with the most A's .", "For each boundary of this region , if the boundary nucleotide was an A , the region was extended to include all consecutive A's .", "If the first base was not an A , it was trimmed until the first base was an A . To find upstream U-rich elements ( USE ) , for a given tag cluster , we identified a candidate USE as the 9-bp window with the highest number of T's in the consensus sequence , within 30 bp upstream of the polyadenylation signal .", "If there were fewer than six T's or if the candidate did not have three consecutive T's , we considered the tag cluster not to have an identifiable USE .", "For each boundary of a given candidate window , if the boundary nucleotide was a T , the window wasextended if there was a T in the adjacent 2 bp and the proportion of T's in the window was above 65%; if the boundary base was not a T , we trimmed the candidate window until a T was reached .", "To find downstream U/G-rich elements ( DSE ) , for a given tag cluster , we identified a candidate DSE as the 9-bp window with the highest number of T's in the consensus sequence , within 40 bp downstream of the poly-A position .", "If there were fewer than five T's or if the window did not contain at least one of the strings TTT , TGTG , GTGT , GTCT , CTGT , TCTG , or TGTC , we considered the tag cluster not to have an identifiable DSE .", "For each boundary of a given candidate window , if the boundary nucleotide was a T , the window was extended if there was a T in the adjacent 2 bp and the proportion of T's in the window was above 50%; if the boundary base was not a T , we trimmed the candidate window until a T was reached .", "Human gene annotations were downloaded from the Known Genes database of the UCSC Genome Browser [63] .", "Among the UCSC transcript annotations that overlapped the start and end positions of a tag cluster , the annotation with the minimum distance between the annotated 3\u2032-end position and the polyA position of the tag cluster was chosen .", "If there were multiple annotations with the same 3\u2032-end positions , we chose the annotation with greatest degree of overlap between the tag cluster consensus sequence and the annotated exons .", "The genomic coordinates of human expressed sequence tags ( ESTs ) with polyA tails were downloaded from the polyA_db2 database [64] .", "The genomic coordinates were converted from hg17 to hg18 using the liftOver tool from the UCSC Genome Browser [65] .", "If the coordinate of polyA_db2 EST was between the start and end position of a tag cluster , we considered the length form corresponding to the unit to be supported by the EST .", "All tag clusters with the same UCSC gene annotation were categorized as associated with the gene , and only the two tag clusters with the highest expression per gene were used for classification of alternative polyadenylation .", "We classified each gene as follows: class I if there was only one tag cluster overlapping with the annotated 3\u2032 UTR of the gene; class II if both tag clusters overlapped with the annotated 3\u2032 UTR of the gene and they were associated with the same UCSC transcript ID; class III if one of the tag clusters overlapped witha coding exon or intron , or if both tag clusters overlapped with 3\u2032 UTRs with different UCSC transcript IDs .", "We calculated the broad-sense heritability in polyA positions using biological replicates of 3\u2032-end RNA-seq across the six human cell lines as follows .", "For a given gene , we considered the polyA position of the most abundant tag cluster in each replicate of each sample as a quantitative trait , and calculated the heritability H2 of this trait from intraclass correlations [66] given by the following equations .", "Here , indices i and j refer to sample and replicate , respectively; is the polyA position for sample i , replicate j; is the average between two replicates for sample i; is the average of all samples and replicates; MSe is the error mean square ( within-individual ) and MSb is the between-individual mean square .", "Heritability of total expression levels for each gene was calculated analogously , using as a quantitative trait the sum of read counts across the gene normalized by the sum of all reads .", "To identify microRNA binding sites in 3\u2032 UTRs , the Perl script from TargetScan Release 5 . 2 [67] was used to predict miRNA binding sites in the 3\u2032 UTR sequences of all expressed genes .", "miRNA sequences and families were downloaded from the TargetScan database .", "Only predicted binding sites with context scores less than \u22120 . 4 were used for analysis .", "To identify AU-rich elements , the class II motif WWWT ( ATTTA ) TTTW was searched in the 3\u2032 UTR sequences of all expressed genes allowing up to one mismatch outside the central pentamer , ATTTA .", "Overlapping motifs were combined .", "To identify GU-rich destabilizing elements , the motif TGTTTGTTTGT was searched in 3\u2032 UTR sequences allowing up to one mismatch .", "To identify Pumilio binding elements , the motif TGTANATA was searched in 3\u2032 UTR sequences .", "Alu transposable element motifs were taken from RepeatMasker ( www . repeatmasker . org ) downloaded from the UCSC Genome Browser .", "We note that each search strategy used human sequence data alone rather than inter- or intra-species conservation to identify motifs .", "SNPs within the human population were downloaded from the 1000 Genomes Project database [68] .", "Genomic coordinates were converted from hg19 to hg18 using the liftOver tool from the UCSC Genome Browser [65] .", "For each regulatory element motif , the SNP rate was calculated as the total number of SNPs within all motif matches divided by the sum of the lengths of all matches .", "For the background model of sequence variation in 3\u2032 UTRs used in Table S4 , we first tabulated all instances of A , C , T , and G across all positions of 3\u2032 UTR sequences in the hg18 human reference genome , where the boundaries of 3\u2032-ends were taken from our compendium of 3\u2032-end RNA-seq data for genes expressed in our samples .", "We refer to these frequencies as P ( A ) , P ( C ) , P ( T ) , and P ( G ) , respectively .", "We then tabulated the SNP rate separately for each of these four sets of base positions from the 1000 Genomes data set , which we refer to as P ( SNP , A ) , P ( SNP , C ) , P ( SNP , T ) , and P ( SNP , G ) , respectively .", "We used these values to calculate the expected density of polymorphisms for the stretch of genome corresponding to a given 3\u2032 motif match as: where is the sequence of bases of length Ns corresponding to the motif match in the human reference genome and P ( SNP|si ) is the probability of a single-nucleotide polymorphism for the nucleotide si at position i , calculated as: For each regulatory motif , P ( SNP|s ) was calculated for every instance of a motif match across all 3\u2032 UTRs in the reference genomefor genes expressed in our samples , and the lower and upper bounds listed in Table S4 were taken as the minimum and maximum values of this distribution , respectively .", "For miRNA binding sites , only the 7-mer seed sequence was used .", "The DEFOG web-based tool ( http://www . mooneygroup . org/defog ) was used for Gene Ontology term enrichment analysis in Table S5 as follows .", "For each type of regulatory element analyzed in Figure 2C , we tabulated a list of class II genes with motifs in the shared region only , and combined these lists across elements .", "For each Gene Ontology term , we then evaluated the significance of the representation of genes annotated in the term in this list , relative to a background set of class II genes harboring at least one motif , using DEFOG with default parameters .", "Separately , we tabulated an analogous combined list of class II genes with motifs in the differential region only and repeated the DEFOG analysis .", "To find polymorphisms in 3\u2032 UTRs across the six individuals of our sample , we generated mRNA-seq libraries [69] from one biological replicate of each cell line sample , and sequenced using 36 bp paired-end modules on an Illumina 2G Genome Analyzer , resulting in 21 to 24 million reads per sample .", "The sequenced reads were mapped to the human genome ( hg18 ) using MOSAIK ( http://bioinformatics . bc . edu/marthlab/Software_Release ) .", "Mapped reads ( 10 to 14 million per sample ) yielded an average coverage of 48% of UCSC annotated exons with an average depth of 27 reads/base for the covered bases .", "Mapped reads were used to call SNPs using GigaBayes ( http://bioinformatics . bc . edu/marthlab/Software_Release ) with options \u2013ploidy diploid \u2013O 3 \u2013indel \u2013CAL 10 .", "Only SNPs with a quality score higher than 0 . 99 were retained for analysis .", "This set of SNPs was used in association tests with total gene expression levels as follows .", "Given tag cluster definitions for each gene from analysis of 3\u2032-end RNA-seq libraries ( see above ) , we calculated a normalized expression level for each tag cluster in each sample as the ratio between the number of 3\u2032-end RNA-seq reads mapping within the tag cluster boundaries in the sample and the total number of mapped 3\u2032-end RNA-seq reads in the sample .", "We then defined the expression level of a given gene in a given sample as the sum of all normalized expression levels across all tag clusters in that gene .", "To get a final estimate of gene expression level for use in association tests in Figure 3 and Figure 8 , we summed expression values across the two replicate samples from each cell line .", "For each SNP in the 3\u2032 UTR of a gene , we identified the major allele across all cell lines and scored each diploid genotype in terms of the number of major alleles ( values ranging from 0 to 2 ) .", "Given the complete matrix of gene expression levels and genotypes across all six cell lines , we calculated the Pearson correlation coefficient R between allele counts and the started logarithm of the gene expression level .", "For Figure 3A and Figure 8 , we used the absolute value of R as the association statistic , and for Figure 3B , we used the signed value of R . In cases of alternative polyadenylation , SNPs in polyadenylation signals upstream of a maximum of two major length forms were considered for association tests .", "To analyze the effect of genetic variation in polyadenylation signal strength on expression in Figure 3B , each allele of each polyadenylation signal was assigned a score: 1 if the signal was AATAAA or ATTAAA , 0 . 5 if the signal was a match to the \u201cvariant\u201d polyadenylation motifs in [30] , and 0 otherwise .", "The polyadenylation signal strength difference was calculated by subtracting the strength of the minor allele from the major allele .", "In Figure 3A , we analyzed SNPs in 3\u2032 UTRs for 4214 genes and SNPs in polyadenylation signals for 33 genes .", "In Figure 8 , we analyzed regulatory element SNPs in 62 , 16 , 7 , and 20 genes respectively in 3\u2032 UTRs of class I genes , shared regions of 3\u2032 UTRs of class II genes , differential regions of 3\u2032 UTRs of class II genes whose long forms were more abundant , and differential regions of 3\u2032 UTRs of class II genes whose short forms were more abundant .", "A psiCheck-2 vector ( Promega ) was modified to generate a 3\u2032 UTR reporter vector , pOKY001 ( Figure S5 and Table S8 ) , in which we removed the SV40 late polyA signal from the firefly luciferase gene and replaced it with a tag for ligation independent cloning ( LIC ) [70] of 3\u2032 UTR sequences of interest .", "Genomic DNA was isolated from lymphoblastoid cell lines using the MasterPure DNA Purification Kit ( Epicentre ) , and 3\u2032 UTR sequences were amplified from genomic DNA using Phusion HF Polymerase ( New England Biolabs ) with PCR primers with LIC tags .", "PCR products were cloned into pOKY001 using LIC , and plasmids were purified using Plasmid Midi Kit ( Qiagen ) .", "Site-directed mutagenesis of plasmids was performed using QuikChange XL Site-Directed Mutagenesis Kit ( Agilent ) according to the manufacturer's instructions .", "All primers used for PCR and mutagenesis are listed in Table S7 .", "Cloned sequences of all reporter vectors were checked by capillary sequencing .", "The list of reporter vectors is provided in Table S8 .", "HEK293T cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum and 1% non-essential amino acids in six-well culture plates .", "For each of two independent transfections for each construct , at 90% confluency , 1 \u00b5g of plasmid DNA was transfected using Lipofectamine 2000 ( Invitrogen ) according to the manufacturer's instructions .", "After incubating at 37\u00b0C under 5% carbon dioxide for 24 h , the cells were washed with Dulbecco's Phosphate-Buffered Saline ( DPBS ) , detached from plates by adding 300 \u00b5L of trypsin-EDTA and incubated at 37 degrees for 5 minutes .", "After adding 900 \u00b5L of media , the detached cells were split into three 2 mL tubes , and pelleted by spinning at 1000\u00d7 g for 3 minutes .", "The cell pellets were washed with DPBS and then flash-frozen in liquid nitrogen and stored at \u221280\u00b0C .", "Given one cell pellet from each of two reporter transfections ( see above ) , cells from each pellet were lysed and used for two technical replicates of a dual luciferase assay using the Dual Luciferase Reporter Assay System ( Promega ) .", "Luminescence from the activities of firefly and Renilla luciferases were measured sequentially in a Turner BioSystems Veritas Luminometer .", "The ratio of luminescence measurements between Firefly and Renilla luciferases was used for all analyses .", "To measure expression of short and long forms for a given gene with alternative polyadenylation , we considered quantitative PCR assays that would interrogate regions just upstream of the inferred cleavage sites of the short and long forms ( which we refer to below as SU and LU , respectively ) .", "We reasoned that expression measurements of SU would reflect abundance of both the short and long transcript forms , whereas LU would reflect abundance of the long form only .", "For a given transcript in a given experiment , the absolute mRNA level ( calculated from quantitative PCR reactions on a biological sample and standards , as described below ) from the primer set amplifying LU was used as the expression level for the long form; the expression level of the short form was calculated by subtracting the absolute mRNA level of LU from the absolute mRNA level of SU for all genes except IRF5 .", "Primer sequences for IRF5 were taken from [15] , where the primer set for SU hybridized to the polyA tail and only amplified the short form .", "Thus , for IRF5 , the mRNA count from SU was used as the expression level for the short form .", "All other primers were designed using Primer3 Plus [71] , checked for potential hairpins and primer dimers using BeaconDesigner Web Edition ( PREMIER Biosoft International ) .", "Primers were synthesized by Elim Biopharmaceuticals .", "For each transcript in each experiment , measurements were normalized by absolute mRNA counts of Renilla luciferase or GAPDH genes .", "All primer sequences are in Table S7 .", "Expression measurements on cells transfected with 3\u2032 UTR reporters were performed as follows .", "Given one cell pellet from each of two transfections ( see above ) , total RNA was isolated from each pellet separately using TRIzol ( Invitrogen ) .", "For each sample , genomic DNA was removed from 10 \u00b5g of total RNA using TurboDNase ( Ambion ) .", "Single-stranded cDNA was synthesized from 2 \u00b5g of DNased RNA using oligo ( dT ) ( Invitrogen ) and SuperScript III reverse transcriptase ( Invitrogen ) , and then RNA was removed using RNase H ( Invitrogen ) .", "For each of two technical replicates for each primer set and sample , the cDNA was amplified using the DyNamo HS SYBR Green QPCR Kit ( Thermo Scientific ) for 40 cycles on a Strategene MX3000P qPCR instrument .", "We calculated absolute numbers of mRNA molecules amplified from each primer set in each experiment by comparing the number of amplification cycles taken to reach a given threshold against a standard curve constructed using samples of a synthetic template ( gBlocks Gene Fragments , Integrated DNA Technologies ) of known absolute numbers of molecules , in serial dilutions extending from 107 to 101 molecules .", "Reporters incorporating 3\u2032 processing signals were constructed as follows .", "For each length form of each gene , we aimed to clone a region centered on the cleavage site as inferred from the transcript end position observed in 3\u2032-end RNA-seq , bounded by the 40 bp upstream and 40 bp downstream in the genomic sequences and flanked by LIC tags ( region sequences for EIF2A , IRF5 , DIP2B , and NAB1 were taken from the haplotype giving rise to production of both long and short forms for cell lines GM17220 , GM10860 , GM10860 , and GM17220 respectively ) .", "This 115-bp construct was produced by PCR stitching two opposite-strand DNA oligos of 60 bp and 78 bp ( Integrated DNA Technologies ) with 23 bp overlap using Phusion HF Polymerase ( New England Biolabs ) for 3 cycles .", "PCR products were cloned into pOKY001 and purified as described above .", "Transfection and dual luciferase assay were performed as above .", "For each transcript half-life measurement , cells transfected with a luciferase reporter harboring the complete 3\u2032 UTR from the haplotype giving rise to production of both long and short forms of a given gene were incubated at 37\u00b0C under 5% carbon dioxide for \u223c24 h .", "A stock solution of actinomycin D dissolved in DMSO was added to achieve a final actinomycin D concentration in tissue culture media of 10 \u00b5g/mL .", "After incubation times as indicated in Figure 5 and Figure S4 , cells were harvested for quantitative PCR measurements as above or Northern blotting as described below .", "To generate expression vectors for ARE-binding proteins , the tristetraprolin ( gene name ZFP36 ) coding sequence was amplified from the vector pGFP-TTP and the AUF1 p37 coding sequence from pCDEF-His-AUF1-p37 ( both kind gifts from B . Glaunsinger ) .", "Each gene was cloned into the pcDNA3 mammalian expression vector ( Invitrogen ) .", "Syn-has-miR-101 , a miRNA mimic of has-miR-101 , was purchased from Qiagen ( MSY0000099 ) .", "For dose-response assays , expression vectors or miRNA mimic were mixed with the corresponding luciferase reporter vectors ( Figure 6 ) and then transfected as above .", "Lipopolysaccharide from E . coli K12 ( Invivogen ) was added to each of the human B-lymphoblastoid cell lines GM10860 , GM17106 , and , GM17207 to a final concentration of 5 \u00b5g/mL in 6-well tissue culture plates , and incubated at 37\u00b0C under 5% carbon dioxide .", "The cells were harvested after 0 , 1 , 2 , 4 , 6 , 8 , 12 , and 16 hours by centrifuging at 1000\u00d7 g for 3 minutes , washing with DPBS , and then flash-freezing in liquid nitrogen .", "RNA was isolated using Trizol ( Invitrogen ) .", "The DIG Northern Starter Kit ( Roche ) was used for Northern blotting .", "A 400 bp region of firefly luciferase gene was amplified from luciferase reporter vector pOKY001 , and cloned into pcDNA3 vector ( Invitrogen ) .", "A digoxigenin ( DIG ) labeled RNA probe for firefly luciferase was created by in vitro transcription with SP6 RNA polymerase after linearizing the plasmid with BamHI .", "Total RNA isolated using Trizol ( Invitrogen ) was cleaned using RNeasy columns ( Qiagen ) with on-column DNase-digestion .", "Between 1 and 10 \u00b5g of total RNA was loaded and run on 1% denaturing agarose gels .", "The gels were stained with SYBR Gold ( Invitrogen ) and then the separated RNA was blotted onto nylon membranes ( Roche ) and UV cross-linked .", "Both the gels and the membranes were imaged on Blue Light Transilluminator ( Invitrogen ) to check the transfer of SYBR-stained RNA .", "28S ribosomal RNA bands on the membranes were used as the loading control in Figure S4 .", "Each membrane was subjected to prehybridization , probe hybridization , low and high stringency washing , and detection procedures recommended by the manufacturer ( Roche ) .", "Anti-digoxigenin-AP ( Roche ) and CDP-Star ( Roche ) were used for chemiluminescent detection of the DIG-labeled RNA probe .", "To maximize length resolution for EIF2A , total RNA was incubated at 37\u00b0C for 30 min with RNaseH ( Invitrogen ) and an oligo antisense to a 20 bp region upstream of the binding site for the Northern probe in the firefly gene .", "For DIP2B , the denaturing agarose gel was treated with 0 . 05% NaOH and washed with water before blotting onto the nylon membrane .", "The expression data reported in this paper have been deposited in the Gene Expression Omnibus ( GEO ) ( http://www . ncbi . nlm . nih . gov/geo ) database ( series accession number GSE33154 ) ."]], "headings": ["Introduction", "Results", "Discussion", "Materials and Methods"], "abstract": ["Gene expression varies widely between individuals of a population , and regulatory change can underlie phenotypes of evolutionary and biomedical relevance .", "A key question in the field is how DNA sequence variants impact gene expression , with most mechanistic studies to date focused on the effects of genetic change on regulatory regions upstream of protein-coding sequence .", "By contrast , the role of RNA 3\u2032-end processing in regulatory variation remains largely unknown , owing in part to the challenge of identifying functional elements in 3\u2032 untranslated regions .", "In this work , we conducted a genomic survey of transcript ends in lymphoblastoid cells from genetically distinct human individuals .", "Our analysis mapped the cis-regulatory architecture of 3\u2032 gene ends , finding that transcript end positions did not fall randomly in untranslated regions , but rather preferentially flanked the locations of 3\u2032 regulatory elements , including miRNA sites .", "The usage of these transcript length forms and motifs varied across human individuals , and polymorphisms in polyadenylation signals and other 3\u2032 motifs were significant predictors of expression levels of the genes in which they lay .", "Independent single-gene experiments confirmed the effects of polyadenylation variants on steady-state expression of their respective genes , and validated the regulatory function of 3\u2032 cis-regulatory sequence elements that mediated expression of these distinct RNA length forms .", "Focusing on the immune regulator IRF5 , we established the effect of natural variation in RNA 3\u2032-end processing on regulatory response to antigen stimulation .", "Our results underscore the importance of two mechanisms at play in the genetics of 3\u2032-end variation: the usage of distinct 3\u2032-end processing signals and the effects of 3\u2032 sequence elements that determine transcript fate .", "Our findings suggest that the strategy of integrating observed 3\u2032-end positions with inferred 3\u2032 regulatory motifs will prove to be a critical tool in continued efforts to interpret human genome variation ."], "summary": ["Messenger RNAs carry the instructions necessary to synthesize proteins that do work for the cell .", "Extending beyond the protein-coding sequence of a given mRNA is an additional stretch of sequence , harboring signals that govern how much protein is made and how long the mRNA remains in the cell before it is broken down .", "The incorporation of this end region into mature mRNA is itself subject to change; for the vast majority of human genes , how and why cells use different mRNA ends remains largely unknown .", "In this work , we surveyed mRNA ends from \u223c10 , 000 genes in immune cells from genetically distinct human individuals .", "We found that mRNA end positions were not randomly distributed , but rather preferentially flanked the locations of regulatory signals that govern mRNA fate .", "The usage of these mRNA length forms and regulatory elements varied across individuals and could be dissected molecularly .", "Our results uncover key mechanisms and regulatory effects of transcript end processing , particularly as these are perturbed by genetic differences between humans ."], "keywords": ["genetics", "biology", "genomics", "genetics and genomics"]}

scientific_lay_summarization.py

@@ -0,0 +1,137 @@
+# coding=utf-8
+# Copyright 2020 The TensorFlow Datasets Authors and the HuggingFace Datasets Authors.
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#     http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# Lint as: python3
+"""Scientific Lay Summarization Datasets."""
+
+
+import json
+import os
+
+import datasets
+
+
+_CITATION = """
+@misc{Goldsack_2022,
+  doi = {10.48550/ARXIV.2210.09932},
+  url = {https://arxiv.org/abs/2210.09932},
+  author = {Goldsack, Tomas and Zhang, Zhihao and Lin, Chenghua and Scarton, Carolina},
+  title = {Making Science Simple: Corpora for the Lay Summarisation of Scientific Literature},
+  publisher = {arXiv},
+  year = {2022},
+  copyright = {arXiv.org perpetual, non-exclusive license}
+}
+"""
+
+_DESCRIPTION = """
+This repository contains the PLOS and eLife datasets, introduced in the EMNLP 2022 paper "[Making Science Simple: Corpora for the Lay Summarisation of Scientific Literature
+](https://arxiv.org/abs/2210.09932)". 
+Each dataset contains full biomedical research articles paired with expert-written lay summaries (i.e., non-technical summaries). PLOS articles are derived from various journals published by [the Public Library of Science (PLOS)](https://plos.org/), whereas eLife articles are derived from the [eLife](https://elifesciences.org/) journal. More details/anlaysis on the content of each dataset are provided in the paper.
+"""
+
+_DOCUMENT = "article"
+_SUMMARY = "summary"
+
+_URLS = {
+    "plos": "https://drive.google.com/u/1/uc?id=1lZ6PCAtXvmGjRZyp3vQQCEgO_yerH62Q&export=download&confirm=t&uuid=03eb0ca9-2333-4681-ac85-68f0a0e6b5c8",
+    "elife": "https://drive.google.com/u/1/uc?id=1WKW8BAqluOlXrpy1B9mV3j3CtAK3JdnE&export=download&confirm=t&uuid=bbaafa1a-a0be-434f-935f-723033623119",
+}
+
+
+class ScientificLaySummarisationConfig(datasets.BuilderConfig):
+    """BuilderConfig for Scientific Papers."""
+
+    def __init__(self, filename=None, **kwargs):
+        """BuilderConfig for ScientificPapers
+        Args:
+          filename: filename of different configs for the dataset.
+          **kwargs: keyword arguments forwarded to super.
+        """
+        super(ScientificLaySummarisationConfig, self).__init__(version=datasets.Version("1.0"), **kwargs)
+        self.filename = filename
+
+
+class ScientificLaySummarisation(datasets.GeneratorBasedBuilder):
+    """Scientific Papers."""
+
+    BUILDER_CONFIGS = [
+        ScientificLaySummarisationConfig(name="plos", description="Documents and lay summaries from PLOS journals."),
+        ScientificLaySummarisationConfig(name="elife", description="Documents and lay summaries from the eLife journal."),
+    ]
+
+    def _info(self):
+        return datasets.DatasetInfo(
+            description=_DESCRIPTION,
+            features=datasets.Features(
+                {
+                    _DOCUMENT: datasets.Value("string"),
+                    _SUMMARY: datasets.Value("string"),
+                    "section_names": datasets.Value("string"),
+                    "keywords": datasets.Value("string"),
+                    "year": datasets.Value("string"),
+                    "title": datasets.Value("string"),
+                }
+            ),
+            supervised_keys=None,
+            homepage="https://github.com/TGoldsack1/Corpora_for_Lay_Summarisation",
+            citation=_CITATION,
+        )
+
+    def _split_generators(self, dl_manager):
+        """Returns SplitGenerators."""
+        dl_paths = dl_manager.download_and_extract(_URLS)
+        path = os.path.join(dl_paths[self.config.name], self.config.name + "-dataset")
+        return [
+            datasets.SplitGenerator(
+                name=datasets.Split.TRAIN,
+                gen_kwargs={"path": os.path.join(path, "train.json")},
+            ),
+            datasets.SplitGenerator(
+                name=datasets.Split.VALIDATION,
+                gen_kwargs={"path": os.path.join(path, "val.json")},
+            ),
+            datasets.SplitGenerator(
+                name=datasets.Split.TEST,
+                gen_kwargs={"path": os.path.join(path, "test.json")},
+            ),
+        ]
+
+    def _generate_examples(self, path=None):
+        """Yields examples."""
+        with open(path, encoding="utf-8") as f:
+            f = json.loads(f)
+            for line in f:
+                # Possible keys are:
+                # "id": str,                      # unique identifier
+                # "year": int,                    # year of publication
+                # "title": str,                   # title
+                # "sections": List[List[str]],    # main text, divided in to sections
+                # "headings" List[str],           # headings of each section
+                # "abstract": List[str],          # abstract
+                # "summary": List[str],           # lay summary
+                # "keywords": List[str]           # keywords/topic of article
+
+                d = json.loads(line)
+                summary = "\n".join(d["abstract_text"])
+
+                yield d["id"], {
+                    _DOCUMENT: "\n".join([d["abstract"]] + d["sections"]),
+                    _SUMMARY: summary,
+                    "section_headings": "\n".join(d["headings"]),
+                    "keywords": "\n".join(d["keywords"]),
+                    "year": d["year"],
+                    "title": d["title"]
+                }
+