Upload 3 files

test.json

@@ -0,0 +1 @@
+{"id": "elife-37443-v3", "year": "2018", "title": "Cerebellar implementation of movement sequences through feedback", "sections": [["Most movements are comprised of sequences .", "From the complex routines that gymnasts perform to intricate dance numbers to simply reaching for an object , our movements are comprised of sequences of movements that are learned through practice .", "The cerebellum has been long implicated in learning and execution of accurate movements ( Doyon et al . , 1997; Shin and Ivry , 2003; Leh\u00e9ricy et al . , 2005; Krupa et al . , 1993; Lisberger , 1994; Diener and Dichgans , 1992 ) .", "Movement sequences as well as multi-joint movements are particularly sensitive to cerebellar dysfunction ( Shin and Ivry , 2003; Diener and Dichgans , 1992; Doyon et al . , 2002 ) .", "For example , one of the hallmark deficits of cerebellar pathology is dysdiadochokinesia ( Diener and Dichgans , 1992 ) \u2013 an inability to perform a rapid alternating sequence of movements .", "Patients with cerebellar lesions display severe deficits ( Doyon et al . , 1997 ) in sequence learning or are unable to learn sequences at all ( Shin and Ivry , 2003 ) , even with modest impairments in learning of single-component , directly cued movements ( Spencer and Ivry , 2009 ) .", "Studies of sequence learning in nonhuman primates ( Desmurget and Turner , 2010; R\u00fcnger et al . , 2013 ) demonstrated that with repeated training components of movement in the sequence start to be initiated predictively , before the arrival of sensory cue .", "Since one of the fundamental properties of cerebellar learning is the ability to learn a predictive response ( Marr , 1969; Bastian , 2006; Shadmehr et al . , 2010; Therrien and Bastian , 2015 ) , these results also indirectly imply a strong cerebellar contribution to sequence learning .", "Although results of these studies suggest cerebellar involvement in the learning and execution of movement sequences , most of what we know about cerebellar mechanisms of learning comes from studies utilizing single-component movements .", "These include adaptation of the vestibule-ocular reflex , adaptation of saccadic and smooth pursuit eye movements and conditioning of eyelid responses .", "In principle , the cerebellar mechanisms underlying movement sequences could be different from , or at least somewhat different from those mediating single-component movements .", "If so , these mechanisms are largely unknown .", "In contrast , we tested the hypothesis that a simple elaboration of cerebellar mechanisms that mediate learning single-component movements is sufficient to explain cerebellar learning and implementation of movement sequences .", "Three possible ( but not mutually exclusive ) ways of implementing cerebellar learning of movement sequences are illustrated in Figure 1 .", "With the first possibility a specific external cue is associated with a specific movement component in the sequence ( Figure 1A ) .", "The second option is a variant of the first one .", "Here only single external cue is present , but it persists in time through the whole sequence , so that different movement components are elicited by signals associated with different times during the cue ( Figure 1B ) .", "Finally , Figure 1C illustrates a possibility where feedback signals from one movement component are used to learn the next component .", "The design of most experiments does not permit distinguishing between these possibilities .", "For example , a number of studies ( Choi and Moore , 2003; Moore and Choi , 1997; Freeman et al . , 2003; Halverson et al . , 2015; Jirenhed et al . , 2017 ) used eyelid conditioning to train subjects to respond with a sequence of two eyelid responses .", "In these experiments , however , the external cue either explicitly extended through the whole sequence , or involved an auditory signal that can elicit persistent activity in working-memory areas such as mPFC ( Siegel et al . , 2012 ) , precluding the possibility of determining which type of sequence learning applies ( Figure 1B and Figure 1C are both possible ) .", "We utilized the practical and conceptual advantages of eyelid conditioning to test explicitly the sufficiency of feedback signal ( s ) ( FS ) for sequence learning ( Figure 1C ) .", "We demonstrate directly that the cerebellum can learn to chain together a sequence of inter-connected movement components by using FS from one component to serve as a cue for the next component in the sequence ( Figure 1C ) .", "In a standard eyelid conditioning experiment , activation of mossy fiber inputs by a sensory stimulus is the cue the cerebellum uses to learn a predictive conditioned eyelid response ( CR ) ( Figure 1C , first movement ) .", "A sensory stimulus can be replaced by direct electrical stimulation of mossy fibers , which is an equally effective cue to support learning ( Steinmetz et al . , 1985 ) , but has the advantage of restricting inputs only to the cerebellum .", "We employed electrical stimulation of mossy fibers as a cue to learn a single-component response .", "We then arranged the timing of stimuli in subsequent training so that the second component in the sequence could not be supported by the mossy fiber stimulation eliciting the first component and thus , only option shown in Figure 1C would be possible .", "We demonstrate robust learning of later components , including sequences of movements produced by the same muscle and sequences with different muscle groups used for the different components .", "A variety of control experiments showed how the presence and timing of the later components of responses were coupled to the first component and not to the mossy fiber stimulation cue that initiated the first component .", "In vivo recordings from cerebellar cortex showed that Purkinje cell activity relates as strongly to the latter components of sequences as it has been shown to relate to single-component eyelid responses .", "Together , these results show how the well-characterized cerebellar mechanisms of learning single movement components can be extended to learning of movement sequences and provide a general framework for how the cerebellum can use feedback signals to learn to chain together appropriately timed responses to produce a movement sequence ."], ["To test the hypothesis that the cerebellum can use feedback signals from a movement as the cue for the next movement in a sequence , we started by training rabbits using electrical stimulation of mossy fibers as a cue ( to which we refer as the conditioned stimulus or CS ) .", "All subjects ( New Zealand albino rabbits ) were initially trained by pairing a mossy fiber stimulation CS with a reinforcing unconditioned stimulus ( US , electrical stimulation of the skin near the eye ) .", "The inter-stimulus interval ( ISI ) between CS onset and US onset was 500 ms . As has been previously demonstrated , this training yields robust and well-timed conditioned eyelid responses in response to the mossy fiber CS ( Steinmetz et al . , 1985; Kalmbach et al . , 2011 ) .", "Example conditioned eyelid responses are shown in Figure 2A .", "Use of mossy fiber stimulation as the CS ensured that the CS was restricted to the cerebellum and did not propagate to areas that could provide a delayed secondary input to the cerebellum ( Siegel and Mauk , 2013; Halverson et al . , 2010 ) , which can be the case for auditory stimuli commonly used in eyelid conditioning .", "Moreover , the control over CS duration allowed control over the time gap between CS offset and the US .", "Once subjects reached robust responding to the mossy fiber CS training was switched to protocols teaching a sequence of CRs .", "The design of an ipsilateral sequence training protocol is illustrated in Figure 2B .", "Training trials involved presentation of the same mossy fiber stimulation CS ( 500 ms long ) used during initial training , but now , depending on the amplitude of the CR , the US was presented at one of two different times .", "If the CR amplitude was below the target amplitude ( 3 mm , half of full closure ) the US was presented as normal at CS offset ( designated US1 ) .", "When the CR amplitude was at or above the target value at the scheduled US1 time , the US was instead presented 600 ms after CS offset ( designated as US2 ) .", "The purpose of the US1 trials was to ensure continued robust responding to the mossy fiber CS , whereas the purpose of the US2 trials was to train a second component of the movement .", "With this procedure we could then test whether the expression of the first CR could serve as a signal for the cerebellum to learn the second CR .", "A 600 ms gap between the offset of the mossy fiber stimulation CS and the presentation of US2 was used based on previous findings that a temporal gap larger than 400 ms between the offset of a mossy fiber stimulation CS and the onset of a US does not support cerebellar learning of eyelid CRs ( Kalmbach et al . , 2010a ) .", "Given these factors , the ability to learn a second CR elicited near the time of US2 would suggest that the feedback information about the first CR is sufficient for the cerebellum to use as a new \u2018CS\u2019 to learn the subsequent CR .", "All subjects ( N\u00a0=\u00a08 ) successfully acquired a sequence of ipsilateral CRs ( Figure 2C\u2013F ) with the timing of the second peak appropriate for the time at which US2 was presented ( Figure 2\u2014figure supplement 1A ) .", "The probability of the second CR , defined as the fraction of trials with first CR where second CR was present too , and second CR amplitude grew monotonically over several sessions of training ( Figure 2C and D respectively , blue lines , one-way ANOVA , F ( 9 , 63 ) = 6 . 44 , p<10\u22126; F ( 9 , 63 ) = 7 . 16 , p<10\u22127 for second CR probability and amplitude respectively ) , and eventually reached asymptotic value , paralleling typical acquisition curves in eyelid conditioning .", "Cerebellar learning is associative .", "As a consequence , presentation of trials with omitted US diminishes CRs in a process called extinction .", "As a test of whether the second CRs are associatively learned , we tested whether they can be selectively extinguished like normal CRs .", "Over three extinction sessions ( Figure 2C , D , G , H ) , the US1 was still presented according to the rule described above , but US2 was omitted .", "If second CRs are learned associatively , the absence of reinforcing US2 should lead to their gradual extinction .", "As expected , the probability and amplitude of the second CRs ( blue lines ) monotonically decreased ( One-way ANOVA , F ( 23 , 120 ) = 4 . 96 , p<10\u22129; F ( 23 , 120 ) = 4 . 92 , p<10\u22129 for second CR probability and amplitude respectively ) during extinction sessions , without any effect on the probability and amplitude of the first CRs ( black lines ) ( One-way ANOVA , F ( 23 , 120 ) = 1 . 45 , p=0 . 10 , F ( 23 , 120 ) = 1 . 35 , p=0 . 15 for first CR probability and amplitude ) .", "Similar to extinction in conventional eyelid conditioning protocols , spontaneous recovery ( Weidemann and Kehoe , 2004; Thanellou and Green , 2011; Ohyama et al . , 2010 ) of the second CRs was present at the beginning of the second and third extinction sessions ( paired Wilcoxon signed rank test , p=0 . 023 for second CR probability , p=0 . 032 for second CR amplitude ) .", "Since the number of trials with first CR amplitude larger than the 3 mm target was variable between sessions and animals , the same data plotted as a function of total trial number is shown in Figure 2\u2014figure supplement 1C , D .", "Plotted this way , the acquisition and extinction rates appear similar to what was observed in conventional eyelid conditioning training protocols .", "These observations are consistent with the notion that the second components in the sequence are acquired through standard cerebellar-dependent associative learning .", "The primary hypothesis we sought to test was that the cerebellum uses a feedback signal ( FS ) of some sort about the first CR as a separate \u2018CS\u2019 to learn the second CR ( Figure 2I ) .", "Such a FS should occur anytime there is a CR , whether the CR is elicited by the mossy fiber stimulation CS or not .", "This suggests the prediction for ipsilateral sequence of CRs , illustrated in Figure 2I .", "When a well-trained subject is presented with CS-alone trials , the mossy fiber stimulation CS will elicit the first CR , then a FSL from the first CR will elicit the second CR .", "Because the second CR is produced by the same muscles of left eyelid and is driven by likely the same neurons in cerebellar nuclei , then if the second CR is large enough , its FS should be similar to the FSL from the first CR .", "Since the cerebellum already learned to associate FSL with upcoming US2 , it should produce a predictive CR with appropriate timing .", "Thus , we would expect to see a third ( and perhaps fourth and fifth , etc . ) CRs on CS-alone trials , though subjects were never explicitly trained to produce them .", "This is indeed what we observed ( Figure 2G , J ) .", "Third and following CRs appeared in late acquisition sessions once robust second CR performance was established and disappeared with the extinction of the second CRs ( Figure 2J , H ) .", "On 36% of CS-alone trials where there was a second CR , there was also a third CR .", "The relative time between peaks of second and third CRs was similar to the time between peaks of first and second CRs ( Figure 2\u2014figure supplement 1B ) .", "Though third CRs were never explicitly reinforced , they remained through late acquisition sessions and subsequent control experiments , as long as second CRs also remained .", "This observation is consistent with the idea that both second and third CR share the same \u2018CS\u2019 as FSL and reinforcement of second CRs on a portion of trials was sufficient to maintain both second and third CRs .", "Because we recorded eyelid position for 2500 ms on each trial , we were only able to observe up to four CRs with ipsilateral sequence training .", "The existence of third CRs is inconsistent with the idea that the original mossy fiber stimulation CS is driving the expression of the second ( and later ) CRs .", "Complex movements typically involve more than one muscle group and often bilateral coordination ( Castiello et al . , 1993; Kelso et al . , 1979 ) .", "We therefore asked whether this training protocol can support a sequence where a left eyelid CR would be followed by a right eyelid CR ( Figure 3A ) .", "As before , subjects were initially trained with mossy fiber stimulation CS to produce left eyelid CRs at ISI 500 ms . After successful acquisition , subjects were switched to a contralateral CRs sequence protocol .", "Here again , if the left eyelid CR amplitude was lower than the target ( 3 mm , half-sized CR ) , USL was presented to the left eye to maintain robust responding of the left eyelid CRs .", "If however , the amplitude of the left CR was higher than the target , USL was omitted and USR was presented to the right eye .", "During initial acquisition , the interval between CS offset and USR was typically 400 ms ( N\u00a0=\u00a04 ) , but for some subjects was 300 ms ( N\u00a0=\u00a01 ) or 500 ms ( N\u00a0=\u00a01 ) .", "We chose to use a shorter duration of the gap interval compared to ipsilateral sequence training , because the pilot data showed that most subjects were unable to learn a contralateral sequence with 600 ms gap interval from na\u00efve right eyelid state .", "In this situation , however , there is less concern about the ability of the mossy fiber stimulation CS to drive the right eyelid CR , since the mossy fiber stimulation CS was delivered through electrodes implanted in the left middle cerebellar peduncle .", "The only way that CS could propagate to the right cerebellar hemisphere was by antidromic activation of neurons in pontine nucleus that have bilateral axons projections .", "Since the number of such neurons is extremely low ( Serapide et al . , 2002; Tan and Gerrits , 1992; Kratochwil et al . , 2017 ) , it is unlikely that mossy fiber stimulation CS could support acquisition of right eyelid CRs .", "Several control experiments described later confirm this notion .", "All subjects ( N\u00a0=\u00a06 ) successfully acquired a contralateral sequence of CRs where a left eyelid response was followed by a right eyelid response ( Figure 3 B\u2013E , F ( 9 , 46 ) = 14 . 28 , p<10\u22129; F ( 9 , 46 ) = 9 . 05 , p<10\u22126 for right CR probability and amplitude respectively ) .", "Right eyelid CRs were adaptively timed , peaking near the time of USR delivery and thus corresponding to the gap interval used during training ( Figure 3\u2014figure supplement 1A , B ) .", "Unlike the ipsilateral training protocol , here there were no third CRs produced by either left or right eyelid .", "Assuming that all but the first ( left ) CRs are driven by FS , and assuming that FSL from left eyelid CRs and FSR from the right eyelid CRs are different signals , this is the expected result .", "In this protocol the FSL are paired with a right eyelid USR and the FSR are never paired with a US .", "Thus there should only be a left eyelid CR driven by the mossy fiber stimulation CS and a right eyelid CR driven by FSL from left eyelid CR .", "Through 86 sessions with contralateral sequence protocol from 6 subjects , responses following right eyelid CR were not observed for either the left or right eyelid ( Data not shown ) .", "As with the ipsilateral sequence protocol , we verified the associative nature of right eyelid CRs by performing three extinction sessions of right eyelid CRs ( red lines in Figure 3B , C , F , Figure 3\u2014figure supplement 1C , D , One-way ANOVA , F ( 23 , 96 ) = 4 . 04 , p<10\u22127; F ( 23 , 96 ) = 6 . 89 , p<10\u221212 for right CR probability and amplitude respectively ) .", "Extinction of right eyelid CRs did not influence the performance of preceding left eyelid CRs ( One-way ANOVA , F ( 23 , 96 ) = 0 . 96 , p=0 . 52; F ( 23 , 96 ) = 0 . 82 , p=0 . 70 for left eyelid CR probability and amplitude respectively ) .", "Spontaneous recovery of right eyelid CRs at the beginning of second and third extinction sessions was present here as well ( paired Wilcoxon signed rank test , p=0 . 055 for right CR probability , p=0 . 020 for right CR amplitude ) .", "Following extinction sessions , subjects were switched to contralateral training protocol with a longer interval between CS offset and USR ( 500 ms , transition not shown ) .", "In the analysis of contralateral sequence data , data produced on sessions with different gap intervals are indicated with different colors and corresponding legend , if applicable .", "The hypothesis that the cerebellum generates the later CRs using FS from the first CR gives rise to several testable predictions .", "We designed two control experiments and performed additional analyses on training session data as a formulation of these predictions to test relatively directly whether the second CR in a sequence ( second left eyelid CR in ipsilateral protocol and right eyelid CR in contralateral protocol ) is driven by FS from the first CR and not by the mossy fiber stimulation CS itself .", "The design of the first control experiment is based on a straightforward prediction \u2013 the absence or a decline in the first CRs should also lead to an absent or diminished second CRs .", "We applied an extinction protocol designed to promote extinction of the first CRs and tested the effects on the second CRs .", "The setup of this experiment is shown in Figure 4A , D .", "Regardless of first CR amplitude , on these sessions the second CR was always reinforced with US2 ( or USR in the contralateral sequence ) , while US1 ( USL ) was never delivered .", "A decline of the second CRs despite the presence of reinforcing US2 ( or USR ) , would indicate that expression of the second CRs requires the expression of the first CR in the sequence .", "Figure 4B , E shows CRs amplitudes is a sequence as a function of block number .", "Since extinction typically took longer for subjects trained with the ipsilateral sequence , most required two extinction sessions .", "The same type of plot for CRs probability is shown in Figure 4\u2014figure supplement 1A , B .", "For subjects trained in\u00a0either the ipsilateral or contralateral sequences , as the amplitude and probability of left eyelid CR decreased , so did the amplitude of the second left eyelid CR in ipsilateral sequence ( r\u00a0=\u00a00 . 86 , p<10\u221213 ) ; or right eyelid CRs in contralateral sequence ( r\u00a0=\u00a00 . 80 , p<10\u221212 ) .", "To quantify this effect further we evaluated the probability of the second CRs conditioned on first CR amplitude .", "For that , we first plotted second CR amplitude versus first CR amplitude ( Figure 4\u2014figure supplement 1C , D , each dot represents a single trial from this control experiment ) .", "We then used that data to calculate the probability of the second CR conditioned on first CR amplitude ( Figure 4C , F ) .", "For both ipsilateral and contralateral sequence , the probability of observing second CRs decayed with decrease in first CR amplitude ( Chi-square analysis , \u03c72 ( 6 , 836 ) =60 . 90 , p<10\u221211 , \u03c72 ( 6 , 572 ) =92 . 7 , p<10\u221218 , for ipsilateral and contralateral sequence protocols respectively ) .", "On trials without the first left eyelid CR , the probability of second CRs was negligible ( probability of second left eyelid CR\u00a0=\u00a00 . 026\u00a0\u00b1\u00a00 . 009 for ipsilateral sequence protocol , probability of right eyelid CR\u00a0=\u00a00 . 023\u00a0\u00b1\u00a00 . 01 for contralateral sequence protocol ) .", "These data show that the presence of a first CR is required for the expression of a second CR .", "If a FS is the cue that drives the second CR , then it should not be necessary for the first CR to be elicited by the original training CS .", "Any CR produced by that eyelid , however it was elicited , should serve as an effective source of a FS to produce a second CR .", "The schematic of the second control experiment that we used to test this prediction is shown in Figure 5A , E .", "We started by training subjects to produce left eyelid CRs ( ISI 500 ms ) with two different types of CS: CS1 and CS2 .", "Electrical stimulation of mossy fibers was always used as CS1 , CS2 was either a 500 ms mossy fibers stimulation delivered through a separate electrode ( N\u00a0=\u00a05 , 2\u00a0subjects for ipsilateral sequence and 3 subjects for contralateral sequence ) or a 500 ms 1 kHz tone ( N\u00a0=\u00a05 , 3 subjects for ipsilateral sequence and 2 subjects for contralateral sequence ) .", "At the end of this pre-training each subject elicited robust CRs to the presentation of either CS1 or on separate trials to CS2 .", "Then , during sequence training as described above , only CS1 was used , CS2 was never used for sequence training , neither for training left eyelid CRs at ISIs other than 500 ms nor for right eyelid CR training .", "After successful acquisition of ipsi- or contralateral sequence of CRs , subjects were then presented with occasional CS2-alone probe trials .", "This input should elicit left eyelid CRs , since this is how subjects were trained .", "However , the essential test is whether the second CRs in the sequence are also present on CS2-alone trials .", "Because the US2 ( USR ) was never presented during the CS2 trials , the presence of second CRs would indicate that the cerebellum did not use CS1 to learn the second CR in the sequence , but rather used FS from the first CR .", "Again , this is indeed what we observed .", "Example eyelid responses on CS2-alone trials are shown in Figure 5B , F for subjects trained in ipsilateral or contralateral sequence respectively .", "On most CS2-alone trials with the first left eyelid CR present we also observed the rest of CRs in the sequence the subject was trained to with CS1 .", "The summary across all sessions with CS2 test trials is shown in Figure 5C , G .", "Here each dot shows the probability within a session of the second CR in a sequence , the color indicates a group of trials during which the second CR probability was calculated , based either on CS type ( CS1 or CS2 ) or amplitude of the first left eyelid CR .", "On trials where the amplitude of first left eyelid CR was larger than 3 mm , the probability of observing other responses in a sequence was the same on trials with either CS1 or CS2 ( Tukey\u2019s post hoc test , p=0 . 73 , blue versus brown bars for ipsilateral sequence; p=0 . 51; red versus brown bars for contralateral sequence ) .", "Importantly , on CS2 trials without the first response ( violet bars ) , there were no other CRs in the sequence ( ipsilateral sequence: one-way ANOVA comparing brown versus violet bars: F ( 3 , 61 ) = 187 , p<10\u221228; Tukey\u2019s post hoc test p<10\u22129; contralateral sequence: one-way ANOVA comparing brown versus violet bars: F ( 3 , 62 ) = 159 , p<10\u221229; Tukey\u2019s post hoc test , p<10\u22129 ) .", "In addition , we repeated CS2-alone test sessions with subjects either not trained with ( N\u00a0=\u00a01 and N\u00a0=\u00a03 for ipsi- and contralateral sequence respectively ) or extinguished from ( N\u00a0=\u00a04 and N\u00a0=\u00a02 for ipsi- and contralateral sequence respectively ) producing a sequence of CRs .", "In this case , while first left eyelid CRs amplitudes were larger than 3 mm , CS2 alone trials did not elicit other CRs in the sequence ( ipsilateral sequence: dark blue bars , second CR probability\u00a0=\u00a00 . 006\u00a0\u00b1\u00a00 . 008 , comparing violet versus dark blue bars with Tukey\u2019s post hoc test results in p=0 . 99; contralateral sequence: dark blue bars , right CR probability\u00a0=\u00a00 . 041\u00a0\u00b1\u00a00 . 028 , comparing violet versus dark blue bars with Tukey\u2019s post hoc test results in p=0 . 84 ) .", "In addition , for subjects trained to produce a sequence of CRs , we observed a significant correlation across sessions between probabilities of second CRs in the sequence on CS1 and CS2 trials ( Figure 5D , H , r\u00a0=\u00a00 . 48 , p=0 . 026 for ipsilateral sequence , r\u00a0=\u00a00 . 6 , p=0 . 007 for contralateral sequence ) .", "Thus , on sessions with a more robust sequence of CRs performed on CS1 trials , subjects also showed larger probability of producing a sequence of CRs on CS2-alone trials .", "Together , these experiments demonstrate that while the first CR in the sequence is driven by the mossy fiber stimulation CS , CRs that follow are associated with FS from the previous CR .", "Two additional predictions can be tested through additional analyses of the normal sequence-training sessions .", "Parallel to the logic of the first control experiment described above , we should expect that on trials without a first CR there should be no second CR .", "To test this prediction we used eyelid responses on CS-alone trials from sessions where the overall probability of second CRs was greater than 40% .", "Panels A and B in Figure 6 show two example trials from subjects trained respectively in ipsilateral and contralateral sequence of CRs .", "Data from all subjects on all CS-alone trials are shown in Figure 6C , D .", "The amplitude of the second CR plotted versus amplitude of the first CR for subjects trained in ipsilateral sequence of CRs is shown in Figure 6C .", "Each dot represents data from a single CS-alone trial .", "Similarly , Figure 6D shows right eyelid CR amplitudes versus left eyelid CR amplitudes for subjects trained to produce contralateral sequence of CRs .", "Data corresponding to the example trials are indicated by grey dots .", "In both plots , horizontal and vertical solid black lines represent nonCR cutoffs ( CR amplitudes\u00a0<0 . 3 mm ) , diagonal is shown by a dotted black line .", "While there were trials with first CR , but no second CR ( dots below horizontal line on the bottom ) , there were no trials without a first CR , but with the second CR ( to the left of vertical line ) .", "Figure 6E and F show the same data plotted as a probability of the second CR ( or right eyelid CR ) , conditioned on the first CR amplitude .", "For both protocols , the probability of the second CR started to decrease on trials with the first CR amplitude smaller than 3 mm , which was used during sequence training ( Chi-square analysis , \u03c72 ( 6 , 571 ) =70 . 13 , p<10\u221213 , \u03c72 ( 6 , 578 ) =92 . 4 , p<10\u221220 , for ipsilateral and contralateral sequence protocols respectively ) .", "Most importantly , on trials without a first CR , the probability of second CRs was negligible ( probability of second left eyelid CR\u00a0=\u00a00 . 037\u00a0\u00b1\u00a00 . 047 for ipsilateral sequence protocol , probability of right eyelid CR\u00a0=\u00a00 for contralateral sequence protocol ) .", "There is a natural trial to trial variability in the timing of the CRs .", "If a FS from the first CR is a signal for the second CR , then it follows that the timing of the first and second CRs should co-vary on a trial by trial basis .", "For example , on trials with relatively early first CRs the following CRs should also happen earlier than average; on trials with late first CRs the following CRs should also happen later .", "Example trials with earlier ( on top ) and later ( on bottom ) first CR onset times are shown in Figure 7A and B from ipsilateral and contralateral sequence respectively .", "One can notice even from example trials that the whole sequence of CRs is shifted with the timing of the first CR .", "We investigated the degree of co-variation between timing of CRs in sequence using a variety of CR timing measures , spanning from CR onset time to CR peak time .", "These timing measures are indicated by orange dots on eyelid position profile in Figure 7A .", "The timing measures were defined for every trial when the amplitude of both responses in a sequence was larger than 2 mm ( except for analysis of third and later CRs in ipsilateral sequence , only CS-alone trials were used there ) .", "Data from two of pairs of timing measures are shown for each protocol in Figure 7C\u2013F .", "Here each dot represents a single trial , with color indicating the pair of CRs for ipsilateral sequence or the gap interval for contralateral sequence .", "We applied two types of analyses to investigate the temporal dependence of CRs in the sequence .", "First , for every pairwise combination of CR timing measures we calculated a Pearson correlation coefficient .", "We found that the majority of combinations of measures showed a significant trial-to-trial co-variation ( Figure 7\u2014figure supplement 1 ) , for both ipsilateral and contralateral sequence of CRs .", "Second , for every trial of each CR timing measures we calculated an inter-CR time interval; correspondingly color-coded distributions of inter-CR time intervals are shown on the right of each panel in Figure 7C\u2013F .", "We than randomly permuted the timing of the first CR and calculated a new shuffled distributions of inter-CR intervals shown in grey .", "If the timing of the second CR is independent of the timing of the first CR , the shuffled distributions should be identical to the true distributions .", "We found however a significant difference in distributions for timing measure pairs shown in Figure 7 ( Kolmogorov-Smirnov test , see Figure 7\u2014source data 1 ) .", "These results show that the timing of the second CR in sequence is influenced by the timing of the first CR and support the hypothesis that a FS from the first response drives the learning and expression of the second response .", "The cerebellar cortex has been shown previously to be necessary for acquisition and expression of well-timed eyelid CRs ( Garcia and Mauk , 1998; Kalmbach et al . , 2010b ) .", "Purkinje cells ( PCs ) , the principal neurons and sole output of the cerebellar cortex , have been a target of several studies .", "Because PCs are inhibitory neurons , decreases in their activity result in increased cerebellar output that drives eyelid CR ( Heiney et al . , 2014 ) .", "For single-component eyelid CRs , the timing and magnitude of the decrease in PCs activity have been shown to encode the kinematic features of CRs ( Halverson et al . , 2015; ten Brinke et al . , 2015 ) .", "Two studies have also shown that under training conditions that produce two CRs , eyelid PCs also showed two correspondingly timed decreases in activity ( Halverson et al . , 2015; Jirenhed et al . , 2017 ) .", "Unlike the present study , in these previous studies both CRs were elicited by the external CS .", "Thus , to begin to understand the cerebellar mechanisms of movement sequences involving feedback signals , we investigated PC activity during the ipsilateral sequence protocol .", "If the second CRs are mediated by the usual cerebellar mechanisms , simply driven by a FS rather than CS , then: ( 1 ) the same PCs should control kinematics of both first and second CRs , since both responses are produced by the same muscle , and ( 2 ) the relationship between PC activity and both responses timing and kinematics should be similar .", "We tested these predictions with in vivo recordings and analysis described below .", "Tetrode microdrives were chronically implanted in three subjects targeting the region of cerebellar cortex previously shown to be necessary for acquisition and expression of well-timed eyelid CRs ( Halverson et al . , 2015; Garcia and Mauk , 1998; Kalmbach et al . , 2010b ) .", "These subjects were trained to produce the ipsilateral CRs sequence , as before employing electrical stimulation of mossy fibers as the CS .", "We recorded 156 well-isolated single units during ipsilateral CRs sequence training sessions .", "Out of those , 42 were classified as PCs based on the presence of both simple and complex spikes and out of those 16 were classified as eyelid PCs ( Halverson et al . , 2015 ) based on the US-evoked complex spikes .", "All subsequent analyses involved only these eyelid PCs .", "Data from an example recording session are shown in Figure 8A and B , with eyelid CRs at the bottom and the raster plot showing eyelid PC simple spikes with corresponding PSTH at the top .", "Panel A shows trials with first CR amplitude smaller than 3 mm , resulting in delivery of US1 .", "Simple spike activity of eyelid PCs developed a decrease during first CR expression , consistent with previous studies .", "Panel B shows eyelid PC activity and behavioral responses on trials with first CR amplitude larger than 3 mm , resulting in omission of US1 and delivery of US2 .", "Even in this single example it is readily apparent that the same PC develops a decrease in activity corresponding in time to each of CRs in ipsilateral sequence .", "Previous work has shown that for a single-component CR , the timing of behavioral CRs and the timing of decreases in eyelid PCs activity co-vary ( Halverson et al . , 2015 ) .", "We therefore investigated if the same relationship holds for both first and second CRs in ipsilateral sequence protocol .", "First , as a replication of previous findings , we studied the timing of eyelid PCs responses as a function of first CRs timing .", "For that , we separated trials into three groups based on first CRs onset times ( non-CRs , early CRs and late CRs ) and calculated corresponding average firing rates of eyelid PCs .", "Results related to the first CR timing are shown in Figure 8C .", "The timing of decrease in eyelid PCs firing rate corresponded to the timing of first CRs , similar and consistent with published results ( Halverson et al . , 2015; ten Brinke et al . , 2015 ) .", "Namely , on non-CR trials ( black lines ) eyelid PCs firing rate barely deviated from baseline activity .", "On trials with early first CRs ( red lines ) decreases in eyelid PCs firing rate happened robustly earlier than on late first CR trials ( blue lines ) .", "For results shown here and below , the absence of overlap in 95% confidence intervals between eyelid PCs activity corresponding to different groups was used as evidence of reliable separation .", "Next , we investigated whether the same relationship holds for the timing of second CRs in the sequence and eyelid PC activity .", "Results demonstrating that the timing of the second decrease in eyelid PCs activity also matches the timing of second CRs are shown in Figure 8D .", "Here we similarly separated trials into three groups , now based on the presence and timing of the second CRs .", "Now on trials without the second CRs ( black lines ) , PCs firing rate returned to the baseline level after the decrease corresponding to the first CR .", "On trials with second CRs present ( red and blue lines ) PCs activity demonstrated double decrease corresponding to the first CR and second CRs in the sequence .", "Moreover , the timing of the second decrease in PCs activity followed the timing of second CRs ( Figure 8D , early versus late second CRs shown by red and blue lines correspondingly ) .", "Previous work ( Halverson et al . , 2015 ) demonstrated that for single-component CRs , the decrease in eyelid PCs activity precedes the onset of CR , consistent with the causal relationship between eyelid PCs responses and CRs expression .", "To examine whether changes in eyelid PCs activity precede the expression of first and second CRs in the ipsilateral sequence , we aligned eyelid PCs activity to the onset of first and second CRs ( Figure 8E and F ) .", "Figure 8E shows first CR time profile ( top ) and corresponding PCs activity ( bottom ) aligned to the first CR onset time ( black vertical dotted line ) .", "Purkinje cells activity was calculated on first CR trials ( blue line ) and non-CR trials ( black line ) .", "Non-CR trials were aligned by CR onset by randomly sampling from the distribution of first CR onset times .", "Similar to published results during conventional eyelid conditioning sessions ( Halverson et al . , 2015 ) , PCs activity on CR trials demonstrated a robust decrease in activity prior to CR onset .", "We next performed a similar analysis for the second CRs , with results shown in Figure 8F .", "Eyelid PCs activity reliably separated prior to the second CR onset on trials with second CRs ( blue line ) comparing to non-second-CRs trials ( black line ) .", "The amount of decrease in PCs activity from baseline at the moment of CR onset was similar for first and second CRs ( 0 . 766\u00a0\u00b1\u00a00 . 015 at the time of first CR onset; 0 . 796\u00a0\u00b1\u00a00 . 034 at the time of second CR onset; p=0 . 45 , Wilcoxon rank sum test ) .", "The above results demonstrate that individual eyelid PCs show decreases in activity that precede the onset and match the presence and timing of both first and second eyelid CRs in an ipsilateral sequence .", "We next examined whether this similarity holds for the relationship between eyelid CRs amplitude and the amount of PCs decrease , as has been demonstrated for the single-component CRs ( Halverson et al . , 2015; ten Brinke et al . , 2015 ) .", "First , as additional replication of previous findings , we separated trials into three groups based on the first CR amplitude and calculated average eyelid PCs responses ( Figure 8F ) .", "As expected , the amount of decrease in eyelid PCs activity scaled with first CR amplitude .", "We next investigated if this relationship holds for the second CRs .", "For that we performed a similar analysis by separating trials based on the second CR amplitude ( Figure 8G ) .", "Eyelid PCs activity showed no change on trials without the second CR ( black line ) and correspondingly scaled amount of decrease on trials with smaller and larger second CRs ( red and blue lines respectively ) .", "Overall , recordings from eyelid PCs demonstrate that individual PCs learn both first and second components in a sequence and the way PC responses relate to these components is not distinguishable .", "This suggests that the same cerebellar mechanisms are involved in generation of both CRs in the sequence .", "These data are consistent with the general notion that FS can be used by the cerebellum to learn following responses in the sequence through processes similar to learning the first response using the CS ."], ["While we have demonstrated the sufficiency of FS from an eyelid CR to be used by the cerebellum as a new \u2018CS\u2019 , the nature and source of this FS remains an open question .", "Several sources of feedback are possible .", "The most direct candidate feedback route would originate from the deep cerebellar nucleus neurons ( DCN ) , which provide the output of the cerebellum .", "Increases in DCN neuron activity are known to drive the expression of eyelid CRs ( Halverson et al . , 2010; McCormick and Thompson , 1984 ) .", "DCN neurons are also known to have axon collaterals that return to the cerebellar cortex ( Houck and Person , 2015; Ankri et al . , 2015; Gao et al . , 2016 ) and form mossy-fiber like synaptic connections .", "Thus the information about the ongoing expression of a CR can be passed back to granule cells in the cerebellar cortex via a monosynaptic excitation by axon collaterals of glutamatergic DCN neurons ( Houck and Person , 2015; Gao et al . , 2016 ) or via a reduction of inhibition from Golgi cells that receive inhibitory projections ( Ankri et al . , 2015 ) from GABA/glycinergic DCN neurons .", "More indirect routes to convey DCN activity back to cerebellar cortex also exist , for example via thalamic ( Halverson et al . , 2010 ) or red nucleus feedback ( Cartford et al . , 1997 ) to pontine nuclei neurons .", "It is also possible that the FS may not originate directly from cerebellar output activity , but rather from proprioceptive information driven by the movement itself .", "All of these possible routes can contribute to a FS , none are mutually exclusive , and their relative contributions will likely depend on temporal constrains and/or laterality of movement sequence .", "For example , nucleo-cortical feedback routes have been shown ( Houck and Person , 2015 ) to have more dominant ipsilateral projections to areas of cerebellar cortex .", "This can be a possible explanation for the need to use shorter time-intervals for subjects trained in contralateral sequence comparing to ipsilateral .", "While we know that the feedback information is supplied to the cerebellar cortex ( Giovannucci et al . , 2017 ) , further studies are needed to investigate relative contributions of possible feedback pathways .", "Apart from the cerebellum , the basal ganglia is another prominent brain system implicated in learning and execution of movement sequences ( Doyon et al . , 1997; Leh\u00e9ricy et al . , 2005; Seidler et al . , 2005 ) .", "However the relative involvement of the cerebellum and basal ganglia in learning and production of motor sequences might differ .", "While several imaging ( Leh\u00e9ricy et al . , 2005; Doyon et al . , 2002; Seidler et al . , 2005 ) and recording ( Jog et al . , 1999 ) studies have reported changes in basal ganglia activity during sequence learning , studies involving lesions or neurodegenerative diseases were generally less conclusive .", "Studies in Parkinson\u2019s patients showed only a partial ( Doyon et al . , 1997; Shin and Ivry , 2003; Jackson et al . , 1995 ) impairment of sequence learning compared to control groups and patients with focal basal ganglia lesions did not display deficits ( Shin et al . , 2005 ) .", "Moreover , pharmacological lesion of globus pallidus internus , the primary basal ganglia output region , resulted in decrease of movement velocity and acceleration , but did not impair the production of learned sequences of movements ( Desmurget and Turner , 2010 ) .", "While we addressed in our work the cerebellar involvement in learning a movement sequence , the results do not preclude significant basal ganglia contributions to learning and expression of movement sequences .", "In our experiments we trained subjects to produce a sequence of discrete responses .", "The results of our study however should not rely on this aspect of the responses , which we utilized for the clarity of analysis .", "Natural complex multi-joint movements , such as locomotion or reaching movements , can be broken down into a sequence of several movement components .", "In these cases our results imply that the feedback about the each portion of the movement can be used by the cerebellum to learn a correct continuation of the movement .", "This general framework can also be used to describe how the cerebellum can learn to guide cortical activity to produce a desired sequence of states .", "The cerebellum and cerebral cortex areas , such as premotor and primary motor cortices , are known to form a closed loop system via cortico-ponto-cerebellar projections ( Kelly and Strick , 2003; Glickstein et al . , 1985; Evarts and Thach , 1969 ) , where the cerebellum sends information back to the cerebral cortex via the thalamus .", "Electrical ( Penfield and Boldrey , 1937; Graziano et al . , 2002 ) or optogenetic ( Harrison et al . , 2012 ) stimulation of motor cortex area is known to produce complex multi-joint movements .", "A common interpretation of these results is a notion of motor program ( Mink , 1996; Summers and Anson , 2009 ) , stored either entirely within a motor cortex or at least partially within downstream areas .", "Our study provides new evidence towards an interpretation that motor programs could be stored in part within the cerebellum .", "This way , the initial command from motor cortex serves as a trigger to initiate the movement , while the later feedback signals from cerebellar output and movement itself are used by the cerebellum to learn a proper output that guides motor cortex activity along the correct trajectory in state space , which in turn results in a correct movement trajectory .", "While speculative at this point , such a framework is fully compatible with results of the present study ."], ["In all experiments subjects were 14 male New Zealand albino rabbits weighing 2 . 5\u20133 . 5 kg at experiment onset .", "Treatment of rabbits and surgical procedures were in accordance with National Institutes of Health guidelines and an institutionally approved animal welfare protocol .", "All subjects were maintained on a 12 hr light/dark cycle .", "One week before the start of experiment , subjects were removed from the home cage and anesthetized with a cocktail of acepromazine ( 1 . 5 mg/kg ) and ketamine ( 45 mg/kg ) .", "After onset of anesthesia , the subjects were placed in a stereotaxic frame , intubated , and maintained on isoflurane ( 1~2% mixed in oxygen ) for the remainder of the surgery .", "Under sterile conditions the skull was exposed with a midline incision ( ~5 cm ) , and four holes were drilled for anchor screws .", "Some anchor screws also functioned as ground screws for subjects with mossy fiber stimulation implants or a microdrive ground for subjects with microdrive implant .", "The rabbit\u2019s head was then positioned with lambda 1 . 5 mm ventral to bregma .", "For subjects prepared only for behavioral experiments involving electrical stimulation of mossy fibers , a craniotomy was drilled out at 5 . 5 mm lateral and 3 mm anterior from lambda , ipsilateral to the trained eye .", "Skull fragments were carefully removed from the craniotomies , the dura matter was carefully opened under visual guidance .", "One or two laterally spaced ( by 1 mm ) tungsten stimulating electrodes ( A-M Systems , Carlsborg , WA; tip exposed to obtain impedance of 100\u2013200 k\u03a9 ) were implanted in the middle cerebellar peduncle ( 16 mm ventral to lambda ) .", "For subjects prepared for microdrive implantation in the cerebellar cortex , a craniotomy was also drilled out at 5 . 9 mm posterior and 6 . 0 mm lateral to lambda .", "Skull fragments were carefully removed from the craniotomies , the dura matter was carefully opened under visual guidance .", "A custom-made microdrive ( 16 tetrodes and 2 references ) fitted with an electronic interface board ( EIB-36-16TT , Neuralynx ) was implanted in the left anterior lobe of the cerebellar cortex at a 40\u00b0 angle posterior to vertical and 17 . 8 mm ventral to lambda .", "This region of the anterior lobe has been shown to be involved in acquisition and expression of well-timed conditioned eyelid responses ( Halverson et al . , 2015; Kalmbach et al . , 2010a; Garcia et al . , 1999 ) .", "The primary target of tetrode recordings were PCs with evoked complex spikes from US , referred throughout the manuscript as eyelid PCs .", "The bundle cannula of the microdrive was lowered to the surface of the brain .", "The craniotomies were sealed with low viscosity silicon ( Kwik-Sil; World Precision Instruments ) .", "The head bolt to mount eyelid detector , anchor/ground screws , stimulation electrodes and microdrive were secured with dental acrylic ( Bosworth Fastray , Pink; The Harry J . Bosworth Company ) , and the skin was sutured where the skull and muscle were exposed .", "Finally , two stainless steel loops terminating in gold pins were inserted into the anterior and posterior periorbital region of the left eye ( and optionally right eye for subjects trained in contralateral sequence of CRs ) for delivery of the stimulation US .", "Subjects were given postoperative analgesics and antibiotics for 2 days after surgery and were allowed to recover for a week before experiments began .", "The subjects were trained in custom-designed , well-ventilated , and sound attenuating chambers measuring 90\u00a0\u00d7\u00a060\u00a0\u00d7\u00a060 cm ( length , width , height ) .", "Each rabbit was placed in a plastic restrainer with their ears stretched over a foam pad and taped down to limit head movement .", "To measure eyelid position , an infrared emitter/detector system was attached directly to the head stage of each rabbit to record movements of the left external eyelid .", "These detectors provide a linear readout of eyelid position ( \u00b10 . 1 mm ) at 1 kHz sampling rate by measuring the amount of infrared light reflected back to the detector , which increases as the eye closes ( Ryan et al . , 2006 ) .", "At the start of each daily session , the gain of the eyelid position detector was calibrated by delivering a test US to elicit full eyelid closure ( defined as 6 . 0 mm , typical for an adult rabbit ) .", "A trial would not start until the rabbit\u2019s eyelid was sufficiently open .", "Stimulus presentation was controlled by custom-designed software for all experiments .", "Each conditioning chamber was equipped with a speaker that was connected to a stereo equalizer and receiver which were connected to a computer that generated the tone .", "For subjects trained using tone as the CS , the CS was set as a 1 kHz , 500 ms , 75 dB sinusoidal tone with a rise and fall time of 5 ms to avoid audible clicks from the speaker .", "For subjects trained with electrical stimulation of mossy fibers , the CS was a constant frequency pulse train of cathodal current pulses ( 100 Hz , 500 ms , 0 . 1 ms pulse width , 100\u2013150 \u03bcA ) , generated by a stimulus isolator ( model 2300 , A-M Systems , Carlsborg , WA ) and passed through the electrode ( s ) implanted in the middle cerebellar peduncle .", "The current pulses were controlled by custom written software ( available from authors upon request ) and delivered through an isolated Pulse Stimulator ( model 2100 , A-M Systems , Carlsborg , WA ) .", "Electrical leads from a separate stimulator ( model 2100 ) were attached to the periorbital electrodes to deliver pulses of electrical stimulation to the left eyelid as the US .", "The US was a 50 ms train of constant current pulses ( 50 Hz , 0 . 7\u20131 ms pulse width , 1\u20133 mA ) delivered through the periorbital electrodes .", "US intensity was adjusted for each rabbit to produce a full eyelid closure without any pain reactions .", "All types of trials in all sessions were separated by a mean inter-trial interval of 30\u00a0\u00b1\u00a010 s .", "For initial training , subjects were given daily eyelid conditioning sessions comprised of 12 blocks of 9 trials each .", "All subjects were initially trained at an inter-stimulus interval ( ISI ) of 500 ms to produce left eye CRs .", "Each block consisted of 1 CS-alone trial and 8 paired trials .", "After reaching a robust CR performance , subjects were switched to the sequence training protocols ."]], "headings": ["Introduction", "Results", "Discussion", "Materials\u00a0and\u00a0methods"], "abstract": ["Most movements are not unitary , but are comprised of sequences .", "Although patients with cerebellar pathology display severe deficits in the execution and learning of sequences ( Doyon et al . , 1997; Shin and Ivry , 2003 ) , most of our understanding of cerebellar mechanisms has come from analyses of single component movements .", "Eyelid conditioning is a cerebellar-mediated behavior that provides the ability to control and restrict inputs to the cerebellum through stimulation of mossy fibers .", "We utilized this advantage to test directly how the cerebellum can learn a sequence of inter-connected movement components in rabbits .", "We show that the feedback signals from one component are sufficient to serve as a cue for the next component in the sequence .", "In vivo recordings from Purkinje cells demonstrated that all components of the sequence were encoded similarly by cerebellar cortex .", "These results provide a simple yet general framework for how the cerebellum can use simple associate learning processes to chain together a sequence of appropriately timed responses ."], "summary": ["Imagine a gymnastics competition in which participants take turns to cartwheel and somersault across the floor .", "The routines on display comprise sequences of precisely timed movements learned through practice .", "This is also true for many of the actions we perform every day , such as reaching for a cup of coffee .", "A region of the brain called the cerebellum helps us learn sequences of movements .", "But how does it do this ?", "To find out , Khilkevich et al . came up with a new version of an old experiment .", "Rabbits were first trained to blink their eye in response to a specific external cue .", "This type of learning , called associative learning , has been shown before in the cerebellum .", "But Khilkevich et al . wondered whether the cerebellum could also use internal feedback signals from the eyeblink as a cue to learn the next movement ?", "If so , this might explain how the cerebellum can chain movements together in a sequence .", "As predicted , Khilkevich et al . found that rabbits could learn to blink their eye in response to an initial signal , and then blink again in response to the first blink .", "Control experiments confirmed that the second eyeblink was coupled to the first , and not to the original cue .", "Moreover , on many trials the rabbits showed a third and even fourth eyeblink .", "This is because feedback signals from the first , second or third blink were the same .", "Thus , the feedback signals from the first blink triggered the second blink , feedback from the second triggered the third , and so forth .", "Rabbits could also learn to use a blink of the left eye as a cue for a blink of the right eye .", "Similar patterns of neuronal activity accompanied each blink , suggesting that the same mechanism generated them all .", "The cerebellum can thus use feedback from one movement as a cue to learn the proper timing of the next movement in a sequence .", "A key question is whether this mechanism of sequence learning extends beyond movement .", "The cerebellum has extensive connections to the brain\u2019s outer layer , the cortex , including many areas involved in cognition .", "Future experiments should test whether the cerebellum might help guide sequences of cortical activity during cognitive tasks ."], "keywords": ["neuroscience"]}

train.json

@@ -0,0 +1 @@
+{"id": "elife-35500-v1", "year": "2018", "title": "National and regional seasonal dynamics of all-cause and cause-specific mortality in the USA from 1980 to 2016", "sections": [["It is well-established that death rates vary throughout the year , and in temperate climates there tend to be more deaths in winter than in summer ( Campbell , 2017; Fowler et al . , 2015; Healy , 2003; McKee , 1989 ) .", "It has therefore been hypothesized that a warmer world may lower winter mortality in temperate climates ( Langford and Bentham , 1995; Martens , 1998 ) .", "In a large country like the USA , which possesses distinct climate regions , the seasonality of mortality may vary geographically , due to geographical variations in mortality , localized weather patterns , and regional differences in adaptation measures such as heating , air conditioning and healthcare ( Davis et al . , 2004; Braga et al . , 2001; Kalkstein , 2013; Medina-Ram\u00f3n and Schwartz , 2007 ) .", "The presence and extent of seasonal variation in mortality may also itself change over time ( Bobb et al . , 2014; Carson et al . , 2006; Seretakis et al . , 1997; Sheridan et al . , 2009 ) .", "A thorough understanding of the long-term dynamics of seasonality of mortality , and its geographical and demographic patterns , is needed to identify at-risk groups , plan responses at the present time as well as under changing climate conditions .", "Although mortality seasonality is well-established , there is limited information on how seasonality , including the timing of minimum and maximum mortality , varies by local climate and how these features have changed over time , especially in relation to age group , sex and medical cause of death ( Rau , 2004; Rau et al . , 2018 ) .", "In this paper , we comprehensively characterize the spatial and temporal patterns of all-cause and cause-specific mortality seasonality in the USA by sex and age group , through the application of wavelet analytical techniques , to over three decades of national mortality data .", "Wavelets have been used to study the dynamics of weather phenomena ( Moy et al . , 2002 ) and infectious diseases ( Grenfell et al . , 2001 ) .", "We also used centre of gravity analysis and circular statistics methods to understand the timing of maximum and minimum mortality .", "In addition , we identify how the percentage difference between death rates in maximum and minimum mortality months has changed over time ."], ["The strengths of our study are its innovative methods of characterizing seasonality of mortality dynamically over space and time , by age group and cause of death; using wavelet and centre of gravity analyses; using ERA-Interim data output to compare the association between seasonality of death rates and regional temperature .", "A limitation of our study is that we did not investigate seasonality of mortality by socioeconomic characteristics which may help with understanding its determinants and planning responses ."], ["We used wavelet and centre of gravity analyses , which allowed systematically identifying and characterizing seasonality of total and cause-specific mortality in the USA , and examining how seasonality has changed over time .", "We identified distinct seasonal patterns in relation to age and sex , including higher all-cause summer mortality in young men ( Feinstein , 2002; Rau et al . , 2018 ) .", "Importantly , we also showed that all-cause and cause-specific mortality seasonality is largely similar in terms of both timing and magnitude across diverse climatic regions with substantially different summer and winter temperatures .", "Insights of this kind would not have been possible analysing data averaged over time or nationally , or fixed to pre-specified frequencies .", "Prior studies have noted seasonality of mortality for all-cause mortality and for specific causes of death in the USA ( Feinstein , 2002; Kalkstein , 2013; Rau , 2004; Rau et al . , 2018; Rosenwaike , 1966; Seretakis et al . , 1997 ) .", "Few of these studies have done consistent national and subnational analyses , and none has done so over time , for a comprehensive set of age groups and causes of death , and in relation to regional temperature differences .", "Our results on strong seasonality of cardiorespiratory diseases deaths and weak seasonality of cancer deaths , restricted to older ages , are broadly consistent with these studies ( Feinstein , 2002; Rau et al . , 2018; Rosenwaike , 1966; Seretakis et al . , 1997 ) , which had limited analysis on how seasonality changes over time and geography ( Feinstein , 2002; Rau et al . , 2018; Rosenwaike , 1966 ) .", "Similarly , our results on seasonality of injury deaths are supported by a few prior studies ( Feinstein , 2002; Rau et al . , 2018; Rosenwaike , 1966 ) , but our subnational analysis over three decades revealed variations in when injury deaths peaked and in how seasonal differences in these deaths have changed over time in relation to age group which had not been reported before .", "A study of 36 cities in the USA , aggregated across age groups and over time , also found that excess mortality was not associated with seasonal temperature range ( Kinney et al . , 2015 ) .", "In contrast , a European study found that the difference between winter and summer mortality was lower in colder Nordic countries than in warmer southern European nations ( Healy , 2003; McKee , 1989 ) ( the study\u2019s measure of temperature was mean annual temperature which differed from the temperature difference between maximum and minimum mortality used in our analysis although the two measures are correlated ) .", "The absence of variation in the magnitude of mortality seasonality indicates that different regions in the USA are similarly adapted to temperature seasonality , whereas Nordic countries may have better environmental ( e . g . housing insulation and heating ) and health system measures to counter the effects of cold winters than those in southern Europe .", "If the observed absence of association between the magnitude of mortality seasonality and seasonal temperature difference across the climate regions also persists over time , the changes in temperature as a result of global climate change are unlikely to affect the winter-summer mortality difference .", "The cause-specific analysis showed that the substantial decline in seasonal mortality differences in adolescents and young adults was related to the diminishing seasonality of ( unintentional ) injuries , especially from road traffic crashes , which are more likely to occur in the summer months ( Liu et al . , 2005 ) and are more common in men .", "The weakening of seasonality in boys under five years of age was related to two phenomena: first , the seasonality of death from cardiorespiratory diseases declined , and second , the proportion of deaths from perinatal conditions , which exhibit limited seasonality ( Figure 9\u2014figure supplement 2 and Figure 10\u2014figure supplement 3 ) , increased ( MacDorman and Gregory , 2015 ) .", "In contrast to young and middle ages , mortality in older ages , where death rates are highest , maintained persistent seasonality over a period of three decades ( we note that although the percent seasonal difference in mortality has remained largely unchanged in these ages , the absolute difference in death rates between the peak and minimum months has declined because total mortality has a declining long-term trend ) .", "This finding demonstrates the need for environmental and health service interventions targeted towards this group irrespective of geography and local climate .", "Examples of such interventions include enhancing the availability of both environmental and medical protective factors , such as better insulation of homes , winter heating provision and flu vaccinations , for the vulnerable older population ( Katiyo et al . , 2017 ) .", "Social interventions , including regular visits to the isolated elderly during peak mortality periods to ensure that they are optimally prepared for adverse conditions , and responsive and high-quality emergency care , are also important to protect this vulnerable group ( Healy , 2003; Lerchl , 1998; Katiyo et al . , 2017 ) .", "Emergent new technologies , such as always-connected hands-free communications devices with the outside world , in-house cameras , and personal sensors also provide an opportunity to enhance care for the older , more vulnerable groups in the population , especially in winter when the elderly have fewer social interactions ( Morris , 2013 ) .", "Such interventions are important today , and will remain so as the population ages and climate change increases the within- and between-season weather variability ."], ["We used data on all 85 , 854 , 176 deaths in the USA from 1980 to 2016 from the National Center for Health Statistics ( NCHS ) .", "Age , sex , state of residence , month of death , and underlying cause of death were available for each record .", "The underlying cause of death was coded according to the international classification of diseases ( ICD ) system ( 9th revision of ICD from 1980 to 1998 and 10th revision of ICD thereafter ) .", "Yearly population counts were available from NCHS for 1990 to 2016 and from the US Census Bureau prior to 1990 ( Ingram et al . , 2003 ) .", "We calculated monthly population counts through linear interpolation , assigning each yearly count to July .", "We also subdivided the national data geographically into nine climate regions used by the National Oceanic and Atmospheric Administration ( Figure 18 and Table 2 ) ( Karl and Koss , 1984 ) .", "On average , the Southeast and South are the hottest climate regions with average annual temperatures of 18 . 4\u00b0C and 18\u00b0C respectively; the South also possesses the highest average maximum monthly temperature ( 27 . 9\u00b0C in July ) .", "The lowest variation in temperature throughout the year is that of the Southeast ( an average range of 17 . 5\u00b0C ) .", "The three coldest climate regions are West North Central , East North Central and the Northwest ( 7 . 6\u00b0C , 8 . 0\u00b0C , 8 . 2\u00b0C respectively ) .", "Mirroring the characteristics of the hottest climate regions , the largest variation in temperature throughout the year is that of the coldest region , West North Central ( an average range of 30 . 5\u00b0C ) , which also has the lowest average minimum monthly temperature ( \u22126 . 5\u00b0C in January ) .", "The other climate regions , Northeast , Southwest , and Central , possess similar average temperatures ( 10\u00b0C to 14\u00b0C ) and variation within the year of ( 23\u00b0C to 26\u00b0C ) , with the Northeast being the most populous region in the United States ( with 19 . 8% total population in 2016 ) .", "Data were divided by sex and age in the following 10 age groups: 0\u20134 , 5\u201314 , 15-24 , 25\u201334 , 35\u201344 , 45\u201354 , 55\u201364 , 65\u201374 , 75\u201384 , 85+\u00a0years .", "We calculated monthly death rates for each age and sex group , both nationally and for sub-national climate regions .", "Death rate calculations accounted for varying length of months , by multiplying each month\u2019s death count by a factor that would make it equivalent to a 31 day month .", "For analysis of seasonality by cause of death , we mapped each ICD-9 and ICD-10 codes to four main disease categories ( Table 1 ) and to a number of subcategories which are presented in the Supplementary Note .", "Cardiorespiratory diseases and cancers accounted for 56 . 4% and 21 . 2% of all deaths in the USA , respectively , in 1980 , and 40 . 3% and 22 . 4% , respectively , in 2016 .", "Deaths from cardiorespiratory diseases have been associated with cold and warm temperatures ( Basu , 2009; Basu and Samet , 2002; Bennett et al . , 2014; Braga et al . , 2002; Gasparrini et al . , 2015 ) .", "Injuries , which accounted for 8% of all deaths in the USA in 1980 and 7 . 3% in 2016 , may have seasonality that is distinct from so-called natural causes .", "We did not further divide other causes because the number of deaths could become too small to allow stable estimates when divided by age group , sex and climate region .", "We obtained data on temperature from ERA-Interim , which combines predictions from a physical model with ground-based and satellite measurements ( Dee et al . , 2011 ) .", "We used gridded four-times-daily estimates at a resolution of 80 km to generate monthly population-weighted temperature by climate region throughout the analysis period .", "We used wavelet analysis to investigate seasonality for each age-sex group .", "Wavelet analysis uncovers the presence , and frequency , of repeated maxima and minima in each age-sex-specific death rate time series ( Hubbard , 1998; Torrence and Compo , 1998 ) .", "In brief , a Morlet wavelet , described in detail elsewhere ( Cazelles et al . , 2008 ) , is equivalent to using a moving window on the death rate time series and analysing periodicity in each window using a short-form Fourier transform , hence generating a dynamic spectral analysis , which allows measuring dynamic seasonal patterns , in which the periodicity of death rates may disappear , emerge , or change over time .", "In addition to coefficients that measure the frequency of periodicity , wavelet analysis estimates the probability of whether the data are different from the null situation of random fluctuations that can be represented with white ( an independent random process ) or red ( autoregressive of order one process ) noise .", "For each age-sex group , we calculated the p-values of the presence of 12 month seasonality for the comparison of wavelet power spectra of the entire study period ( 1980\u20132016 ) with 100 simulations against a white noise spectrum , which represents random fluctuations .", "We used the R package WaveletComp ( version 1 . 0 ) for the wavelet analysis .", "Before analysis , we de-trended death rates using a polynomial regression , and rescaled each death rate time series so as to range between 1 and \u22121 .", "To identify the months of maximum and minimum death rates , we calculated the centre of gravity and the negative centre of gravity of monthly death rates .", "Centre of gravity was calculated as a weighted average of months of deaths , with each month weighted by its death rate; negative centre of gravity was also calculated as a weighted average of months of deaths , but with each month was weighted by the difference between its death rate and the year\u2019s maximum death rate .", "In taking the weighted average , we allowed December ( month 12 ) to neighbour January ( month 1 ) , representing each month by an angle subtended from 12 equally-spaced points around a unit circle .", "Using a technique called circular statistics , a mean ( \u03b8- ) of the angles ( \u03b81 , \u03b82 , \u03b83\u2026 , \u03b8n , ) representing the deaths ( with n the total number of deaths in an age-sex group for a particular cause of death ) is found using the relation below:\u03b8-=arg\u2211j=1nexp\u2061 ( i\u03b8j ) , where arg denotes the complex number argument and \u03b8j denotes the month of death in angular form for a particular death j .", "The outcome of this calculation is then converted back into a month value ( Fisher , 1995 ) .", "Along with each circular mean , a 95% confidence interval ( CI ) was calculated by using 1000 bootstrap samples .", "The R package CircStats ( version 0 . 2 . 4 ) was used for this analysis .", "For each age-sex group and cause of death , and for each year , we calculated the percent difference in death rates between the maximum and minimum mortality months .", "We fitted a linear regression to the time series of seasonal differences from 1980 to 2016 , and used the fitted trend line to estimate how much the percentage difference in death rates between the maximum and minimum mortality months had changed from 1980 to 2016 .", "We weighted seasonal difference by the inverse of the square of its standard error , which was calculated using a Poisson model to take population size of each age-sex group through time into account .", "This method gives us a p-value for the change in seasonal difference per year , which we used to calculate the seasonal difference at the start ( 1980 ) and end ( 2016 ) of the period of study .", "Our method of analysing seasonal differences avoids assuming that any specific month or group of months represent highest and lowest number of deaths for a particular cause of death , which is the approach taken by the traditional measure of Excess Winter Deaths .", "It also allows the maximum and minimum mortality months to vary by age group , sex and cause of death ."]], "headings": ["Introduction", "Results", "Discussion", "Materials and methods"], "abstract": ["In temperate climates , winter deaths exceed summer ones .", "However , there is limited information on the timing and the relative magnitudes of maximum and minimum mortality , by local climate , age group , sex and medical cause of death .", "We used geo-coded mortality data and wavelets to analyse the seasonality of mortality by age group and sex from 1980 to 2016 in the USA and its subnational climatic regions .", "Death rates in men and women \u2265 45 years peaked in December to February and were lowest in June to August , driven by cardiorespiratory diseases and injuries .", "In these ages , percent difference in death rates between peak and minimum months did not vary across climate regions , nor changed from 1980 to 2016 .", "Under five years , seasonality of all-cause mortality largely disappeared after the 1990s .", "In adolescents and young adults , especially in males , death rates peaked in June/July and were lowest in December/January , driven by injury deaths ."], "summary": ["In the USA , more deaths happen in the winter than the summer .", "But when deaths occur varies greatly by sex , age , cause of death , and possibly region .", "Seasonal differences in death rates can change over time due to changes in factors that cause disease or affect treatment .", "Analyzing the seasonality of deaths can help scientists determine whether interventions to minimize deaths during a certain time of year are needed , or whether existing ones are effective .", "Scrutinizing seasonal patterns in death over time can also help scientists determine whether large-scale weather or climate changes are affecting the seasonality of death .", "Now , Parks et al . show that there are age and sex differences in which times of year most deaths occur .", "Parks et al . analyzed data on US deaths between 1980 and 2016 .", "While overall deaths in a year were highest in winter and lowest in summer , a greater number of young men died during summer \u2013 mainly due to injuries \u2013 than during winter .", "Seasonal differences in deaths among young children have largely disappeared and seasonal differences in the deaths of older children and young adults have become smaller .", "Deaths among women and men aged 45 or older peaked between December and February \u2013 largely caused by respiratory and heart diseases , or injuries .", "Deaths in this older age group were lowest during the summer months .", "Death patterns in older people changed little over time .", "No regional differences were found in seasonal death patterns , despite large climate variation across the USA .", "The analysis by Parks et al . suggests public health and medical interventions have been successful in reducing seasonal deaths among many groups .", "But more needs to be done to address seasonal differences in deaths among older adults .", "For example , by boosting flu vaccination rates , providing warnings about severe weather and better insulation for homes .", "Using technology like hands-free communication devices or home visits to help keep vulnerable elderly people connected during the winter months may also help ."], "keywords": ["epidemiology and global health"]}

val.json

@@ -0,0 +1 @@
+{"id": "elife-15477-v3", "year": "2016", "title": "Increasing Notch signaling antagonizes PRC2-mediated silencing to promote reprograming of germ cells into neurons", "sections": [["Cell-fate decisions are controlled , on the one hand , by intercellular signaling and , on the other hand , by intrinsic mechanisms such as epigenetic chromatin modifications .", "The Notch signaling pathway is a highly conserved and widespread signaling mechanism ( Artavanis-Tsakonas et al . , 1999; Greenwald and Kovall , 2013 ) , which has been implicated in key cell-fate decisions such as the decision between proliferation and differentiation ( Liu et al . , 2010 ) .", "Notch signaling has also been implicated in cellular reprograming .", "Upon inhibition of Notch signaling , the oncogenic genes KLF4 and cMyc become dispensable for the generation of induced pluripotent stem cells ( iPSCs ) from mouse and human keratinocytes ( Ichida et al . , 2014 ) .", "In this setting , Notch inhibits reprograming .", "Conversely , Notch signaling promotes transdifferentiation of pancreatic acinar cells to ductal cells ( Sawey et al . , 2007 ) , or the conversion of hepatocytes into biliary cells in liver primary malignancy intrahepatic cholangiocarcinoma ( ICC ) ( Sekiya and Suzuki , 2012 ) .", "Notch signaling can also affect reprograming in normal development .", "In C . elegans , signaling through the GLP-1 and LIN-12 Notch receptors impedes reprograming during embryogenesis and , during larval development , signaling through LIN-12 is required for the conversion of a rectal epithelial cell into a motorneuron ( Jarriault et al . , 2008; Djabrayan et al . , 2012 ) .", "The role of epigenetic regulators in cell-fate decisions has been studied mostly in pluripotent cells cultured outside of their normal tissue environment ( Meshorer and Misteli , 2006; Spivakov and Fisher , 2007; Lessard and Crabtree , 2010; Orkin and Hochedlinger , 2011 ) .", "Therefore , the\u00a0epigenetic regulation of stem cell identity in intact tissues remains poorly understood .", "Additionally , the impact of external cues , for example signaling from a stem cell niche to the recipient cell\u2019s chromatin remains equally unresolved .", "By contrast , C . elegans has been used as a model to study reprograming in an intact organism ( Horner et al . , 1998; Fukushige et al . , 1998; Zhu et al . , 1998; Fukushige and Krause , 2005; Ciosk et al . , 2006; Jarriault et al . , 2008; Yuzyuk et al . , 2009; Riddle et al . , 2013 ) .", "In this model , germ cells can be directly reprogrammed into neurons by depleting specific chromatin modifiers such as LIN-53 ( Rbbp4/7 ) or components of PRC2 , and by concomitant overexpression of the transcription factor CHE-1 , which induces glutamatergic neuronal fate in a process which we refer to as Germ cell Conversion ( GeCo ) ( Tursun et al . , 2011; Patel et al . , 2012 ) .", "Here , we identify the Notch signaling pathway as a critical player in this reprograming model .", "This was unanticipated , since signaling through the Notch receptor GLP-1 ( henceforth GLP-1Notch ) from the somatic gonadal niche is known to maintain germline stem cell/progenitor fate ( Kimble and Crittenden , 2007 ) .", "To understand this novel , reprograming-promoting role of GLP-1Notch , we combined genetics with tissue-specific expression profiling .", "We identified genes regulated by GLP-1Notch , including genes recently shown to maintain the germline stem/progenitor cells ( Kershner et al . , 2014 ) .", "Additionally , and unexpectedly , we found that many genes activated by GLP-1Notch signaling were also repressed by the cell fate-stabilizing chromatin regulator PRC2 .", "We show that GLP-1Notch and PRC2 have an antagonistic effect on germ cell-fate decisions and demonstrate co-regulation of their common target , utx-1 .", "Importantly , UTX-1 is a histone demethylase known to erase the gene-silencing methylation of histone H3 dependent on PRC2 ( Maures et al . , 2011; Jin et al . , 2011; Vandamme et al . , 2012 ) .", "Thus , we propose that the GLP-1Notch\u2013dependent induction of UTX-1 facilitates reprograming by alleviating PRC2-mediated repression of alternative cell fates ."], ["Germ cells can be converted into neuronal cells in intact C . elegans upon overexpression of the neuronal transcription factor CHE-1 , simply by depleting the chromatin modifier LIN-53 ( Tursun et al . , 2011; Patel et al . , 2012 ) .", "This GeCo phenotype can be followed in living animals by monitoring a reporter GFP expressed from the gcy-5 promoter , which otherwise is induced in glutamatergic ASE neurons ( Altun-Gultekin et al . , 2001 ) .", "In contrast to the spontaneous teratomatous differentiation of meiotic germ cells , observed in the absence of specific RNA-binding proteins ( Ciosk et al . , 2006; Biedermann et al . , 2009; Tocchini et al . , 2014 ) , GeCo is preferentially observed in the pre-meiotic , proliferating germ cells ( Tursun et al . , 2011; Patel et al . , 2012 ) .", "Consistently , removing the proliferating germ cells , by inhibiting GLP-1Notch signaling , prevents GeCo ( Tursun et al . , 2011 ) .", "However , because the proliferating germ cells were eliminated , these experiments did not address a possible direct effect of GLP-1Notch signaling on GeCo .", "We began addressing this issue by examining the gonads of animals carrying the gain-of-function glp-1 allele ( ar202 ) ( Pepper et al . , 2003 ) .", "These gonads are filled with proliferating germ cells and , upon depleting LIN-53 and overexpressing CHE-1 , we observed that significantly more germ cells converted to ASE neurons ( Figure 1A , Figure 1\u2014source data 1 ) .", "We refer to this enhanced GeCo as 'GeCo+' .", "Detailed quantification revealed that the GeCo+ gonads contained more than twice the number of converted cells ( Figure 1\u2014figure supplement 1A , Figure 1\u2014source data 1 ) .", "The nuclei of these converted cells were reminiscent of neuronal nuclei and the cells displayed axo-dendritic projection ( Figure 1\u2014figure supplement 1B ) , as previously described ( Tursun et al . , 2011; Patel et al . , 2012 ) .", "To confirm that the GeCo enhancement depends on the canonical Notch signaling pathway , rather than an independent function of the GLP-1Notch\u00a0receptor , we RNAi-depleted the transcriptional effector of GLP-1Notch signaling , LAG-1 ( Christensen et al . , 1996 ) .", "We exposed animals only after hatching to lag-1 RNAi in order to avoid sterility , which is caused when animals are subjected to lag-1 RNAi earlier ( Supplemental file 1 ) .", "RNAi-mediated knock-down of lag-1 strongly inhibited GeCo ( Figure 1B , Figure 1\u2014source data 1 ) .", "Importantly , under these experimental conditions , we did not observe any obvious reduction of germ cell numbers ( Figure 1C , Figure 1\u2014source data 1 ) , suggesting a proliferation-independent effect of GLP-1Notch signaling on cell-fate conversion .", "To investigate this further , we tested GeCo efficiency on germ cells proliferating independently of GLP-1Notch signaling .", "We took advantage of mutants in which , in the absence of two meiosis/differentiation-promoting factors GLD-1 and GLD-2 , germ cells proliferate independently of GLP-1Notch ( Kadyk and Kimble , 1998 ) .", "Specifically , we examined GeCo in the loss-of-function gld-1 ( q497 ) gld-2 ( q485 ) mutants , which carried either wild-type glp-1 or the loss-of-function glp-1 ( q175 ) allele ( Austin and Kimble , 1987 ) .", "Both mutant combinations have previously been described to have tumorous germlines and impaired meiotic entry ( Kadyk and Kimble , 1998; Hansen et al . , 2004 ) .", "In contrast to efficient GeCo observed in the gld-1 ( q497 ) gld-2 ( q485 ) gonads , GeCo was strongly diminished in the gld-1 ( q497 ) gld-2 ( q485 ) ; glp-1 ( q175 ) gonads , despite the ongoing germ cell proliferation ( Figure 1D , Figure 1\u2014source data 1 ) .", "Counting the number of germ cells in these gonads revealed only a slight difference ( a 15% increase in the numbers in the double vs . triple mutant gonads ) , suggesting that the strong enhancement of GeCo by GLP-1Notch signaling cannot be explained by the\u00a0increased number of germ cells ( Figure 1\u2014figure supplement 2 , Figure 1\u2014source data 1 ) .", "Since it has been proposed that dividing cells have a higher propensity for cellular reprograming ( Egli et al . , 2008; Hanna et al . , 2009 ) , we also tested whether blocking the cell cycle would affect the observed GeCo enhancement in glp-1 ( gf ) gonads .", "As previously described ( Fox et al . , 2011; Patel et al . , 2012 ) , we used hydroxyurea ( HU ) treatment to block the cell cycle in the S phase .", "Blocking the cell cycle by HU did not diminish the GeCo+ phenotype ( Figure 1\u2014figure supplement 3 , Figure 1\u2014source data 1 ) .", "Combined , these results suggest that GLP-1Notch enhances GeCo independently from its role in promoting germ cell proliferation . 10 . 7554/eLife . 15477 . 003Figure 1 . GLP-1Notch signaling promotes reprograming of germ cells .", "( A ) GLP-1Notch enhances germ cell conversion ( GeCo ) into neuronal-like cells .", "Left: Fluorescent ( top ) and combined fluorescent/differential interference contrast ( DIC ) micrographs ( bottom ) of adult animals .", "All animals ectopically expressed the pro-neuronal transcription factor CHE-1 from a heat-shock promoter .", "glp-1 ( ar202 ) is a temperature-sensitive gain-of-function allele of the Notch receptor .", "Animals were subjected to either mock ( control ) or lin-53 RNAi .", "Reprogrammed cells expressed a GFP reporter driven from the neuronal gcy-5 promoter ( here an in other figures nGFP ) and are outlined here and elsewhere in yellow .", "Any signal outside the outlined region comes from somatic tissues .", "GeCo+ indicates animals that displayed a strongly enhanced GeCo phenotype .", "Scale bars = 10 \u03bcm .", "The cartoons depicting the GeCo and GeCo+ phenotypes are on the top right .", "The gonads are shaded in grey and GFP-positive converted germ cells are green .", "Fractions of animals displaying GeCo and GeCo+ are indicated below .", "At least 250 animals were quantified per condition .", "P-values were calculated using Student's t-test: p1<0 , 0001; p2=0 , 0006 .", "Error bars represent SEM .", "( B ) The transcriptional effector of the GLP-1Notch signaling pathway , LAG-1 , is required for the GLP-1Notch\u2013mediated enhancement of GeCo .", "Left: Fluorescent micrographs of adults expressing CHE-1\u2013induced nGFP as explained above .", "GeCo is diminished upon the depletion of LAG-1 .", "White dashed lines outline the animal body .", "Scale bars = 10 \u03bcm .", "Right: The corresponding quantifications .", "At least 400 animals were quantified per condition .", "P-values were calculated using Student's t-test: p1<0 , 0001; p2=0 , 0018 .", "Error bars represent SEM .", "( C ) GLP-1Notch signaling enhances GeCo independently from germ cell proliferation .", "Shown are DAPI-stained gonads of glp-1 ( ar202 ) animals , expressing CHE-1\u2013induced nGFP , treated with either mock or lin-53 RNAi .", "Germ cells were counted from the DTC ( yellow asterisk ) to the turn of the gonad arm ( dashed yellow line ) .", "15 gonad arms per condition were counted .", "Scale bars = 10 \u03bcm .", "Quantifications are on the right .", "While greatly inhibiting GeCo , lag-1 RNAi did not change the number of germ cells .", "P-values were calculated using Student's t-test: p1=0 , 89 .", "Error bars represent SEM .", "( D ) GLP-1Notch enhances GeCo independently from proliferation .", "Left: Fluorescent micrographs of adults ( with indicated genotypes ) , expressing CHE-1\u2013induced nGFP .", "The first panel on the left shows a control , heterozygous ( wild-type ) gld-1 gld-2/++; glp-1/+ animal .", "The other panels show the homozygous gld-1 ( q497 ) gld-2 ( q485 ) mutants , carrying either a loss-of-function ( q175 , center ) or a wild-type ( right ) allele of glp-1 .", "Despite proliferating , germ cells in the gld-1 gld-2; glp-1 gonads have lost the ability to undergo GeCo .", "Scale bars = 10 \u03bcm .", "Right: the corresponding quantifications .", "At least 250 animals were quantified per condition .", "P-values were calculated using Student's t-test: p1=0 , 0478; p2=0 , 0201 .", "Error bars represent SEM . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 00310 . 7554/eLife . 15477 . 004Figure 1\u2014source data 1 . Quantification of GeCo in glp-1 ( gf ) and lag-1 RNAi\u00a0animals .", "( A ) Quantification of GeCo+ phenotype upon RNAi against lin-53 in glp-1 ( ar202 ) mutants .", "( B ) Quantification of GeCo dependency on LAG-1 .", "( C ) Quantification of germ cells in glp-1 ( ar202 ) gonads with our without lag-1 RNAi treatment .", "( D ) Quantification of GeCo in different genetic backgrounds with highly proliferative germlines upon RNAi against lin-53 .", "Figure 1\u2014figure supplement 1A source data: Quantification of gfp-positive germ cells .", "Figure 1\u2014figure supplement 2 source data: Quantification of germ cells in different genetic backgrounds with highly proliferative germlines .", "Figure 1\u2014figure supplement 3A source data: Quantification of GeCo after cell cycle block with HU treatment .", "More details can be found in the corresponding figure legends . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 00410 . 7554/eLife . 15477 . 005Figure 1\u2014figure supplement 1 . glp-1 ( gf ) gonads contain more than twice the number of converted cells which display neuronal characteristics .", "( A ) For the quantification of gcy-5::gfp-positive cells per gonadal arm only the GeCo category of wt vs . glp-1 ( gf ) was used because GeCo+ animals already show an extensive area of the gonad filled with gcy-5::gfp-positive cells with usually >100 cells/gonad making reliable counting impossible .", "Notably , animals with a seemingly similar extend of GeCo in wt vs . glp-1 ( gf ) show a clear increase of gcy-5::gfp-positive cells per gonadal arm from approx .", "10 in wt to > 30 in glp-1 ( gf ) .", "n ( wt ) = 75 gonaldal arms , n ( glp-1 ( ar202 ) ) = 221 gonadal arms .", "The background of the loss of function allele glp-1 ( q175 ) leads to a significant decrease in GeCo as shown previously ( Tursun et al . , 2011 ) .", "( B ) A magnified view of gcy-5::gfp-positive ( nGFP ) cells , in a GeCo+ gonad from a glp-1 ( gf ) animal .", "The converted cells show axo-dendritic projections ( white arrow heads ) .", "The inset in the corresponding DIC image , magnified in the right-bottom corner , shows the nuclear morphology of a converted germ cell , which has lost the germ cell-specific \u2018fried-egg\u2019-like shape and instead shows nuclear speckles characteristic of a neuronal cell .", "Scale bar = 1 \u03bcm . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 00510 . 7554/eLife . 15477 . 006Figure 1\u2014figure supplement 2 . Germ cell numbers are similar between gld-1 gld-2 double and gld-1 gld-2; glp-1 triple mutants . DAPI-stained gonads of gld-1 ( q497 ) gld-2 ( q485 ) or gld-1 ( q497 ) gld-2 ( q485 ) ; glp-1 ( q175 ) mutants , carrying the hsp::che-1 and gcy-5::gfp transgenes .", "The gonads were imaged by fluorescent microscopy using Z-stack acquisitions .", "Germ cells from the DTCs ( yellow asterisks ) to the turn of the gonad arm ( dashed lines ) were counted .", "Below:15 gonad arms per condition of L4 animals were counted .", "The numbers of germ cells differ only slightly ( 15% ) in the double mutant vs . triple mutants background .", "Scale bars = 10 \u03bcm .", "Error bars represent SEM . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 00610 . 7554/eLife . 15477 . 007Figure 1\u2014figure supplement 3 . Blocking the cell cycle with hydroxyurea does not inhibit GeCo+ .", "( A ) We used hydroxyurea ( HU ) treatment for 5 hr to chemically block the cell cycle , which makes germ cells arrest in the S phase of the cell cycle .", "This arrest does not diminish the GeCo+ phenotype in glp-1 ( gf ) gonads upon lin-53 RNAi and che-1 ( oe ) .", "At least 150 animals were quantified per condition .", "P-values were calculated using Student's t-test: p1=0 , 1409; p2=0 , 4583 .", "Error bars represent SEM .", "The right panel shows examples of GeCo+ displaying animals based on gcy-5::gfp ( nGFP ) for HU-untreated ( -HU ) and HU-treated ( +HU ) animals .", "( B ) The gonads were stained for EdU incorporation .", "Dashed lines outline gonads .", "Asterisks indicate distal tips of gonads .", "Scale bars = 10 \u03bcm .", "( C ) The gonads of glp-1 ( ar202 ) gf animals , which were treated with HU for 12 hr and stained with DAPI and H3Ser10ph ( pH3 ) antibody .", "The pH3-positive cells indicate condensed chromosomes of dividing cells .", "After 12 hr of HU treatment , the gonads contained , as expected , enlargement nuclei ( arrowheads ) ( Gartner et al . , 2004; Fox et al . , 2011 ) .", "The loss of pH3-positive cells indicates a cell cycle arrest .", "Asterisks indicate distal tips of gonads , dashed lines outline gonad .", "Scale bars = 10 \u03bcm . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 007 To understand the effects of GLP-1Notch on GeCo , we set out to identify genes regulated by GLP-1Notch signaling in germ cells .", "To conduct the\u00a0analysis in morphologically similar tissue , we again took advantage of the gld-1 gld-2 double mutants that , combined with either loss-of-function or gain-of-function glp-1 alleles , have morphologically similar gonads , filled with proliferating , undifferentiated germ cells ( Figure 2\u2014figure supplement 1 ) ( Kadyk and Kimble , 1998; Hansen et al . , 2004 ) .", "We combined gld-1 ( q497 ) gld-2 ( q485 ) mutations with either the temperature-sensitive loss-of-function ( lf ) glp-1 allele ( e2144 ) , or the temperature-sensitive gain-of-function ( gf ) glp-1 allele ( ar202 ) ( Priess et al . , 1987; Pepper et al . , 2003 ) .", "Because GLD-1 and GLD-2 regulate gene expression at the posttranscriptional level only , we expected that transcriptionally regulated GLP-1Notch targets could be identified in this background .", "To analyze gene expression , gonads were dissected from animals grown at the restrictive temperature in two independent experiments , and transcripts were analyzed with tiling arrays ( GEO accession number GSE49395 ) .", "We identified around 100 transcripts that were differentially expressed between the gld-1 gld-2; glp-1 ( lf ) ( Notch OFF ) and gld-1 gld-2; glp-1 ( gf ) ( Notch ON ) gonads ( Figure 2A and Figure 2\u2014figure supplement 2 , Figure 2\u2014source data 1 ) .", "These changes were confirmed by quantitative RT-PCR ( RT-qPCR ) on selected transcripts ( Figure 2\u2014figure supplement2A , Figure 2\u2014source data 1 ) .", "Most differentially expressed transcripts were upregulated in the \u2018Notch ON\u2019 gonads , indicating a predominantly activating role of GLP-1Notch in germ cells .", "For simplicity , we will refer to the transcripts upregulated at least two fold in the Notch ON gonads as \u2018Notch\u2013activated\u2019 .", "Some Notch-activated genes , such as sel-8/Mastermind , lst-1 , and epn-1/Epsin , have been implicated in Notch signaling in other cell types ( Doyle et al . , 2000; Yoo , 2004; Tian et al . , 2004; Singh et al . , 2011; Kershner et al . , 2014 ) .", "However , it remains possible that , rather than being direct GLP-1Notch targets , some of the Notch-activated genes were upregulated as an indirect consequence of increased GLP-1Notch signaling . 10 . 7554/eLife . 15477 . 008Figure 2 . GLP-1Notch and PRC2 regulate common targets and are functionally connected .", "( A ) Notch-activated genes are biased for the sex chromosome linkage .", "Left: Changes in transcript abundance in the \u2018Notch ON\u2019 versus \u2018OFF\u2019 dissected gonads ( genotypes explained in Figure 2\u2014figure supplement 1A\u2013B ) were analyzed by microarrays .", "Transcripts upregulated at least 2-fold in the \u2018Notch ON\u2019 gonads are marked in red , those downregulated at least 2-fold in blue .", "Selected transcripts verified by RT-qPCR in Figure 2\u2014figure supplement 2A are additionally circled in black .", "Right: 5426 genes can be considered expressed in the gonad , based on the bimodal distribution of expression values .", "Only 3% of those expressed genes are X-linked .", "In contrast , nearly half ( 46% ) of the expressed and Notch-activated transcripts are X-linked ( see Figure 2\u2014figure supplement 2B for numbers ) .", "( B ) GLP-1Notch and PRC2 interact genetically .", "Left: DAPI-stained gonads from animals of the indicated genotypes .", "The mes-2 ( bn11 ) M+Z- single mutant gonads have wild-type appearance at 20\u00b0C .", "The glp-1 ( ar202 ) gain-of-function mutants have an almost wild-type appearance at this temperature , except for an extended proliferative zone in the gonad , referred to as 'distal tumor' .", "At the same temperature , mes-2 ( bn11 ) M+Z-; glp-1 ( ar202 ) double mutants developed germline tumors in 32/32 of the examined gonads .", "The insets show close-ups from the indicated gonadal regions: the distal-most regions contain undifferentiated , proliferative germ cells in all mutants ( a , c , e ) .", "However , while the single mutants contain oocytes with characteristically condensed chromosomes in the proximal gonads ( b ,", "d ) , the proximal gonads of the double mutants harbor proliferative germ cells ( f ) .", "Scale bar = 30 \u03bcm .", "Right: quantification of the phenotypes .", "'Distal tumor' indicates the presence of an elongated distal proliferative zone ( approximately \u00bd of the distal gonad arm ) .", "'Extended' tumor indicates an extended distal tumor , few oocytes , and frequently also a proximal tumor .", "'Fully tumorous' indicates the absence of all differentiated cell types except for sperm produced during larval development .", "( C ) GLP-1Notch and PRC2 target the same genes on the X chromosomes .", "The plots correlate changes in gene expression in M+Z- mes-2 mutants with changes in gene expression changes in M+Z- mes-6 mutants .", "Results are shown separately for X-linked ( left ) and autosomal ( right ) transcripts .", "Notch-activated genes ( red in Figure 2A ) are marked in red .", "Lightly shaded areas indicate transcripts that are at least 2-fold upregulated .", "The overlap between transcripts upregulated by GLP-1Notch and transcripts upregulated by the loss of CePRC2 is highly significant , particularly for the X-linked genes .", "The significance of the correlation was measured by hypergeometric distribution; X-linked Notch-activated vs . mes-2 derepressed: p=1 . 31e-31; X-linked Notch-activated vs . mes-6 de-repressed: p=7 . 41e-25; autosomal Notch-activated vs . mes-2 derepressed: p=1 . 47e-22; autosomal Notch-activated vs . mes-6 de-repressed: p=1 . 8e-12 . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 00810 . 7554/eLife . 15477 . 009Figure 2\u2014source data 1 . Microarray results .", "( A ) Microarray results of differentially expressed genes in Notch ON/OFF gonads .", "Figure 2\u2014figure supplement 3 source data: Quantification of germlines with wild-type morphology versus germlines with tumors upon germline-autonomous RNAi against genetic interactors of PRC2 .", "More details can be found in the corresponding figure legends . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 00910 . 7554/eLife . 15477 . 010Figure 2\u2014figure supplement 1 . Examining transcriptional effects of GLP-1Notch signaling .", "( A ) GLP-1Notch signaling counteracts the meiosis-promoting activity of several RNA binding proteins , of which GLD-1 and -2 are indicated .", "( B ) Mutants that were used in this study: while the loss-of-function ( lf ) alleles of glp-1 cause the loss of germ cells , gain-of-function ( gf ) alleles result in a constitutive proliferation of germ cells .", "However , in the absence of the meiosis-promoting GLD-1 and GLD-2 proteins , germ cells continue to proliferate in the absence of GLP-1Notch activity .", "( C ) Three representative gonads of Notch ON: gld-2 ( q497 ) gld-1 ( q485 ) ; glp-1 ( ar202 ) and Notch OFF: gld-2 ( a497 ) gld-1 ( q485 ) ; glp-1 ( e2144 ) animals are shown after dissection and DAPI staining .", "The central planes of the gonads were imaged .", "Nuclei were counted from those images using the CellCounter plugin with ImageJ .", "For each genetic background , germ cells in the entire gonad of 10 dissected gonads were counted .", "The quantification below revealed that the numbers of germ cells in both backgrounds are not changed .", "Error bars represent SD .", "Scale bar = 10 \u03bcm . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 01010 . 7554/eLife . 15477 . 011Figure 2\u2014figure supplement 2 . Analysis of Notch-activated genes .", "( A ) Changes in the abundance of several transcripts ( marked black in Figure 2A ) were verified independently from the genomic quantification by RT-qPCR .", "Colors correspond to fold-changes detected by microarrays ( green ) , by RT-qPCR on genetically identical gonads ( black ) , or by RT-qPCR on gonads with a different loss-of-function glp-1 allele , q175 ( white ) .", "*This experiment was performed only once .", "The error bars represent SEM .", "( B ) Although the number of genes on the arrays is almost equally distributed between the different chromosomes , the expression of X-linked genes is largely silenced in the germline .", "The table displays the numbers and fractions of genes on the different chromosomes , and the distributions of the Notch-activated genes .", "The cutoff between 'not expressed' and 'expressed' genes was set according to the bimodal distribution of expression values in the Notch ON and OFF arrays . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 01110 . 7554/eLife . 15477 . 012Figure 2\u2014figure supplement 3 . The PRC2 component MES-6 and most enhancers/suppressors of glp-1 ( ar202 ) induced tumors appear to interact genetically with GLP-1Notch signaling in a germline-autonomous manner . Each bar indicates the relative proportion of germlines with wild-type morphology ( grey ) , germlines that contain eggs but also a proximal or distal tumor ( red ) , and germlines that are fully tumorous ( black ) .", "'n' indicates the number of DAPI-stained gonads scored for each column .", "Empty vector 1\u20133 represent three independent replicates of the empty vector control and demonstrate the robustness of the experiment .", "We observed that , for an unknown reason , the rrf-1 ( pk1417 ) ; glp-1 ( ar202 ) double mutants were less likely to produce tumors at the semi-permissive temperature of 20\u00b0C .", "Nonetheless , the double mutant strain reacts to enhancers , suppressors , and depletion of PRC2 components in a similar manner as the glp-1 ( ar202 ) single mutant strain , with the exception of mbk-1 and B0416 . 5 RNAi .", "Depletion of mes-2 and mes-3 by RNAi was ineffective , since it did not enhance the tumourous phenotype in either of the two strains . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 01210 . 7554/eLife . 15477 . 013Figure 2\u2014figure supplement 4 . Global levels of H3K27me3 are unaffected by neither loss-of-function nor gain-of-function mutations in glp-1 . Stainings of wild-type , gain-of-function glp-1 ( ar202 ) , Notch ON ( gld-2 ( q497 ) gld-1 ( q485 ) ; glp-1 ( ar202 ) ) and Notch OFF ( gld-2 ( a497 ) gld-1 ( q485 ) ; glp-1 ( q175 ) ) gonads with antibodies against H3K27me3 performed on whole worms ( left panel , scale bars = 10 \u03bcm ) or dissected gonads ( right panel , scale bars = 1 \u03bcm ) .", "The H3K27me3 levels do not differ globally between the different mutant backgrounds .", "Asterisks indicate distal tips of gonads , dashed lines outline gonad . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 013 To demonstrate that Notch-activated genes are functionally relevant for germ cell proliferation , we performed RNAi knockdown of Notch-activated genes ( n\u00a0=\u00a064 ) on animals carrying the gain-of-function glp-1 ( ar202 ) allele , and screened for enhancement or suppression of the tumorous gonad phenotype ( Supplementary file 1; for detailed experimental procedure see Materials and Methods ) .", "Knocking down some of the Notch-activated genes suppressed the tumorous phenotype , which agrees with predominantly proliferation-promoting role of GLP-1Notch .", "Interestingly , knocking down a smaller\u00a0subset of the Notch-activated genes enhanced the tumor ( Supplementary file 1 ) , suggesting that some of the Notch-activated genes may counteract proliferation .", "While some of these genes may function autonomously in the germline , others could affect the germline indirectly from the soma .", "To test this , we RNAi-depleted selected candidates in the rrf-1 ( pk1417 ) mutant background , which is permissive for RNAi in the germline but deficient in RNAi in many ( but not all ) somatic tissues ( Kumsta and Hansen , 2012 ) .", "While depleting most candidates in the rrf-1 background had similar effects on the germline as in the wild type ( suggesting germline-autonomous function ) , in some cases the effects were abolished , suggesting that these genes function in the soma ( Figure 2\u2014figure supplement 3 , Figure 2\u2014source data 1 ) .", "Strikingly , we noticed that Notch-activated genes were enriched on the X-chromosome , the C . elegans sex chromosome .", "45% of the Notch-activated genes were X-linked , which is four-fold more than expected by chance ( p=2 . 99e-14; Figure 2A and Figure 2\u2014figure supplement 2B , Figure 2\u2014source data 1 ) .", "When analyzing only genes with higher than baseline germline expression values , the disproportional X-linkage of Notch-activated genes was even more striking ( fifteen times more than expected by chance ( p=2 , 19e-38; Figure 2A and Figure 2\u2014figure supplement 2B , Figure 2\u2014source data 1 ) .", "In the C . elegans germline , X-linked genes are largely silenced by the C . elegans PRC2 ( Fong et al . , 2002 ) .", "Thus , the X chromosome bias among Notch-activated genes suggested a possible antagonistic relationship between GLP-1Notch and PRC2 .", "The C . elegans PRC2 consists of MES-2 , -3 , and -6 ( Bender et al . , 2004 ) and levels of the corresponding transcripts were essentially not altered by GLP-1Notch signaling ( mes-2: absolute fold change ( fc ) -1 . 3747; mes-3: fc 1 . 003; mes-6: fc 1 . 037 ) .", "To test for a functional relationship between GLP-1Notch and PRC2 , we examined genetic interactions between GLP-1 and PRC2 mutants .", "At 20\u00b0C , both the temperature-sensitive gain-of-function glp-1 ( ar202 ) and the homozygous loss-of-function mes-2 ( bn11 ) mutants , derived from heterozygous mothers providing maternal MES-2 ( mes-2\u2009M+Z- mutants ) , were viable and produced gonads with nearly wild-type appearance .", "The double mes-2\u2009M+Z-; glp-1 ( ar202 ) mutants , however , displayed distal and proximal tumors at the same temperature ( Figure 2B; 32/32 examined gonads ) .", "PRC2 and GLP-1Notch thus interact functionally , and they appear to do so in a germ cell autonomous manner ( Figure 2\u2014figure supplement 3 , Figure 2\u2014source data 1 ) .", "Given the striking enrichment of Notch-activated genes on the X chromosome , and the genetic interaction between PRC2 and GLP-1Notch , we speculated that GLP-1Notch and PRC2 act on similar genes .", "To determine whether Notch-activated genes are also PRC2-repressed , we first determined putative PRC2 targets by expression analyses on isolated wild-type , M+Z- mes-2 or mes-6 mutant gonads ( GEO accession number GSE49395 ) .", "Consistent with the joint function of MES-2 and MES-6 in the PRC2 complex , a very similar set of genes was upregulated upon the loss of either protein ( Figure 2C; Figure 2\u2014source data 1; henceforth \u2018PRC2 repressed\u2019 genes; also see ( Gaydos et al . , 2012 ) .", "Indeed , those PRC2-repressed genes overlapped strongly with Notch-activated genes , particularly those linked to the X chromosome .", "Nearly all of the X-linked Notch-activated genes were also derepressed upon the loss of PRC2 ( Figure 2C ) .", "This is consistent with the observed genetic interaction and suggests that increased GLP-1Notch signaling can induce expression of specific PRC2-repressed genes .", "This activation of the PRC2-repressed genes is not due to a global loss of the repressive tri-methylation of Histone H3 at lysine residue 27 ( H3K27me3 ) , since , upon examining gonads of different GLP-1Notch mutants , we observed no global loss of H3K27me3 in the germline ( Figure 2\u2014figure supplement 4 ) .", "Germ cell conversion to neurons can be triggered not only by LIN-53 depletion but also by the depletion of PRC2 ( Patel et al . , 2012 ) .", "Potentially , the depletion of LIN-53 could facilitate reprograming by inhibiting PRC2 , since the depletion of LIN-53 results in a global loss of H3K27me3 in the germline ( Patel et al . , 2012 ) .", "Considering the antagonistic relation between GLP-1Notch and PRC2 on cell proliferation and gene regulation , we wondered whether GeCo triggered by the depletion of PRC2 would be sensitive to Notch signaling .", "Indeed , GeCo was strongly enhanced in PRC2-depleted ( mes-2 , mes-3 or mes-6 RNAi ) animals , when they also carried the gain-of-function glp-1 ( ar202 ) allele ( Figure 3A , Figure 3\u2014source data 1 ) .", "Moreover , similar to the LIN-53\u2013depleted gld-1 ( q497 ) gld-2 ( q485 ) ; glp-1 ( q175 ) gonads ( Figure 1D ) , the loss of GLP-1 effectively prevented GeCo in PRC2\u2013depleted gld-1 ( q497 ) gld-2 ( q485 ) ; glp-1 ( q175 ) gonads ( Figure 3B , Figure 3\u2014source data 1 ) .", "Together , these results suggest that GLP-1Notch stimulates GeCo in PRC2-compromised gonads . 10 . 7554/eLife . 15477 . 014Figure 3 . GLP-1Notch enhances reprograming upon the depletion of PRC2 . ( A ) Notch and PRC2 genetically interact in GeCo .", "Left: Fluorescent micrographs of glp-1 ( ar202 ) gain-of-function mutants expressing CHE-1\u2013induced neuronal GFP .", "The animals were subjected to control RNAi or RNAi against PRC2 components ( MES-2 , 3 , and 6 ) , as indicated .", "Increased GLP-1Notch signaling enhanced the GeCo+ phenotype upon PRC2 depletion .", "Control RNAi ( mock ) for each genetic background did not result in any GeCo ( images not shown \u2013 see quantification ) .", "Right: The corresponding quantifications .", "P-values were calculated using Student's t-test: p1=0 , 0006; p2<0 , 0001; p3=0 , 0536; p4=0 , 0001; p5=0 , 4035; p6=0 , 0003 .", "At least 200 animals were scored per condition .", "Error bars represent SEM .", "( B ) GLP-1Notch is required for GeCo in PRC2-depleted animals independently from proliferation .", "Left: Fluorescent micrographs of adults expressing CHE-1\u2013induced nGFP , with the genotypes indicated above the panels .", "The animals were subjected to RNAi as indicated on the left .", "The first column shows heterozygous , the other two homozygous animals carrying the loss of function alleles gld-1 ( q497 ) , gld-2 ( q485 ) and , in the central panels , glp-1 ( q175 ) .", "The animals were subjected to control RNAi or RNAi against PRC2 components ( MES-2 , 3 , and 6 ) .", "In the absence of GLP-1Notch , depletion of PRC2 components did not induce GeCo .", "Scale bars = 10 \u03bcm .", "Right: The corresponding quantifications .", "P-values were calculated using Student's t-test: p1<0 , 0456; p2=0 , 0337; p3=0 , 0070; p4=0 , 0637; p5=0 , 0080; p6=0 , 1259 .", "At least 70 animals were scored per condition .", "Error bars represent SEM . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 01410 . 7554/eLife . 15477 . 015Figure 3\u2014source data 1 . Quantification of GeCo upon PRC2 depletion .", "( A ) Quantification of GeCo+ phenotype upon RNAi against PRC2 subunits in glp-1 ( ar202 ) mutants .", "( B ) Quantification of GeCo in different genetic backgrounds with highly proliferative germlines upon RNAi against PRC2 subunits .", "More details can be found in the corresponding figure legends . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 015 To determine how GLP-1Notch might counteract PRC2 , we depleted candidate Notch-activated genes ( Supplementary file 1 ) , and examined GeCo efficiency ( Figure 4A , Figure 4\u2014source data 1 ) .", "The strongest suppression of the GeCo+ and GeCo phenotype was observed upon the depletion of utx-1 , which also suppressed mes-3 RNAi-mediated GeCo+ in glp-1 ( ar202 ) gonads ( Figure 4\u2014figure supplement 1 ) .", "Depletion of two other candidates , the uncharacterized C07G1 . 6 and the aldolase ortholog aldo-1 , also suppressed GeCo+ , albeit less efficiently ( Figure 4A ) .", "Because UTX-1 was suggested to effect gonadal development by functioning in the somatic gonad ( Vandamme et al . , 2012 ) , we re-examined GeCo efficiency upon utx-1 RNAi in the rrf-1 ( pk1417 ) background .", "Importantly , in rrf-1 mutants , RNAi is impaired in the somatic gonad , including the distal tip cell ( DTC ) , which constitutes the germline stem cell niche ( Kumsta and Hansen , 2012 ) .", "Because the suppression of GeCo+ upon utx-1 RNAi was observed also in the rrf-1 background , UTX-1 does not seem to enhance GeCo by functioning in the somatic gonad ( Figure 4\u2014figure supplement 1A ) .", "Furthermore , different genetic backgrounds and RNAi agains utx-1\u00a0do not affect the expression levels of\u00a0CHE-1 in the germline ( Figure 4\u2014figure supplement 1B ) . 10 . 7554/eLife . 15477 . 016Figure 4 . The H3K27 demethylase UTX-1 is required for GeCo enhancement .", "( A ) UTX-1 is critical for GeCo enhancement .", "Candidate Notch-activated genes , selected from Supplementary file 2 with available RNAi clones , were assayed for a role in GeCo in glp-1 ( ar202 ) animals , expressing CHE-1\u2013induced nGFP and treated with lin-53 RNAi .", "While the additional depletion of utx-1 had the strongest impact on GeCo+ and GeCo , the depletion of C07G1 . 6 and aldo-1 had a weaker effect .", "Representative fluorescence micrographs are below the quantification chart .", "White dashed line outline the animal body , yellow lines outline gonadal areas with GeCo .", "P-values for GeCo+ were calculated using Student's t-test: p1=0 , 000013; p2=0 , 026; p3=0 , 021; p4>0 , 1 .", "At least 250 animals were scored per condition .", "Error bars represent SEM .", "nGFP = gcy-5::gfp .", "Scale bars = 10 \u03bcm .", "( B ) As in A , but RNAi was performed against jmjd-1 . 2 ( H3K9/27me2 demethylase ) ; jmjd-3 . 1 , jmjd-3 . 2 , and jmjd-3 . 3 , ( H3K27me2/3 demethylases ) ; and jmjd-2 ( H3K9/36 demethylase ) .", "Only RNAi against jmjd-1 . 2 suppresses GeCo+ , though to a lesser degree compared to utx-1 RNAi .", "Representative fluorescence micrographs are below the quantification chart .", "P-values for GeCo+ were calculated using Student's t-test: p1=0 , 0042; p2=0 , 035; p3>0 , 2 .", "At least 190 animals were scored per condition .", "Error bars represent SEM .", "Scale bars = 10\u00a0\u03bcm . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 01610 . 7554/eLife . 15477 . 017Figure 4\u2014source data 1 . Quantification of GeCo upon double RNAi against lin-53 and Notch-activated genes .", "( A ) Quantification of GeCo+ upon RNAi against lin-53 and Notch-activated genes .", "( B ) Quantification of GeCo+ upon RNAi against lin-53 and Histone demethylases .", "Figure 4\u2014figure supplement 1A source data: Quantification of GeCo+ upon RNAi against lin-53 and utx-1 with and without rrf-1 ( pk1417 ) background .", "More details can be found in the corresponding figure legends . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 01710 . 7554/eLife . 15477 . 018Figure 4\u2014figure supplement 1 . UTX-1 is required for the GeCo+ enhancement upon the depletion of PRC2 . ( A ) Adult glp-1 ( ar202 ) animals treated with lin-53 or mes-3 RNAi were additionally subjected to either control or utx-1 RNAi .", "Depletion of utx-1 strongly suppressed the GeCo+ phenotype .", "Suppression upon utx-1 co-depletion with lin-53 is also detectable in the rrf-1 ( pk1417 ) background which is permissive for RNAi in the germline but not in the somatic gonad and the DTC .", "Right: quantification: n = 715 were scored for lin-53; utx-1 RNAi; n = 500 for mes-3; utx-1 RNAi and n = 270 were scored for lin-53; utx-1 RNAi in rrf-1 ( pk1417 ) .", "P-values were calculated using Student's t-test: p1=0 , 0588; p2=0 , 0042; p3=0 , 2454; p4=0 , 01713; p5=0 , 40479; p6=0 , 00271 .", "Error bars represent SEM .", "( B ) anti-HA antibody staining for the 3xHA-tagged CHE-1 protein , which is being induced after heat-shock treatment in the different genetic backgrounds: glp-1 ( ar202 ) ; otIs305 ( hspprom::che-1::3xHA ) ntIs1 ( gcy-5prom::gfp ) treated with our without RNAi against lin-53 and utx-1 .", "As additional controls the strain otIs305 ( hspprom::che-1::3xHA ) ntIs1 ( gcy-5prom::gfp ) with or without lin-53 RNAi and heat shock treatment was used .", "No obvious changes in the induction of CHE-1::3xHA in the germlines of the different genetic backgrounds can be detected .", "Scale bars = 1 \u03bcm . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 018 Importantly , utx-1 encodes a conserved H3K27me3 demethylase , an enzyme erasing the repressive mark deposited by PRC2 ( Agger et al . , 2007; Jin et al . , 2011; Maures et al . , 2011 ) , potentially explaining how its depletion impairs GeCo efficiency .", "However , a number of other H3K27me3 demethylases exist in C . elegans , which prompted us to test whether depletion of these demethylases might have an effect on GeCo in the glp-1 ( ar202 ) gonads .", "We RNAi-depleted jmjd-1 . 2 , encoding a H3K9/27me2 demethylase ( Kleine-Kohlbrecher et al . , 2010 ) , jmjd-3 . 1 , jmjd-3 . 2 , and jmjd-3 . 3 , which were reported to demethylate H3K27me2/3 ( Agger et al . , 2007; Kleine-Kohlbrecher et al . , 2010; Zuryn et al . , 2014 ) , and , as a control , jmjd-2 , encoding a H3K9/36 demethylase ( Whetstine et al . , 2006; Greer et al . , 2014 ) ( Figure 4B , Figure 4\u2014source data 1 ) .", "Only the depletion of JMJD-1 . 2 suppressed GeCo+ significantly , though to a lesser degree than the depletion of UTX-1 ( Figure 4B , Figure 4\u2014source data 1 ) .", "The suppression of GeCo by the depletion of UTX-1 or JMJD-1 . 2 stresses the importance of counteracting PRC2 in reprograming .", "However , only the expression of utx-1 is activated by the GLP-1Notch signaling , suggesting that it is the activity of UTX-1 which is key for the reprograming dependent on GLP-1Notch signaling .", "The inhibition of GeCo enhancement upon utx-1 RNAi in the rrf-1 background suggested that UTX-1 functions in the germline .", "To test the potential expression of utx-1 in the germline , we constructed a strain expressing single copy-integrated , FLAG and GFP-tagged , functional UTX-1 ( expressed from the endogenous utx-1 promoter under the control of endogenous utx-1 3'UTR ) .", "We found that this protein was indeed expressed in the germline ( Figure 5\u2014figure supplement 1 ) .", "To examine the potential transcriptional regulation of utx-1 expression by GLP-1Notch and PRC2 , we also created a strain expressing GFP-tagged histone H2B from the utx-1 promoter ( putx-1 reporter ) , under the control of an unregulated ( tbb-2 ) 3\u2019UTR .", "This construct was also single-copy integrated into a defined genomic location .", "With both the UTX-1 fusion protein and the putx-1 reporter , we expected expression patterns similar to that of other reported GLP-1Notch target genes ( Lamont et al . , 2004; Lee et al . , 2006; Kershner et al . , 2014 ) .", "Among these , lst-1 and sygl-1 account for the role of GLP-1Notch in stem cell maintenance , and both genes are expressed in the distal-most stem cells/progenitors ( Kershner et al . , 2014 ) .", "By contrast , both the UTX-1 fusion protein and the putx-1 reporter were little or not expressed in the distal-most , proliferative part of the germline ( Figure 5A\u2013C; Figure 5\u2014figure supplement 1 ) .", "Concomitantly with progression through meiosis , their expression increased toward the proximal end of the gonad ( Figure 5A\u2013C ) .", "When examining the existing mRNA hybridization patterns of Notch-activated and PRC2-repressed genes ( 33 genes ) , we noticed that half of these ( 18 , all X-linked ) are similarly expressed in the medial and/or proximal , but not the distal-most , gonads ( Supplementary file 2 ) , arguing against direct transcriptional activation of these genes by GLP-1Notch in the wild type .", "Nevertheless , in agreement with the expression analyses , we observed increased expression of the putx-1 reporter in PRC2-depleted gonads; this increase occurred throughout the gonad , including the distal-most region ( Figure 5A ) .", "In situ hybridization for the endogenous utx-1 transcript also showed increased expression throughout the gonad in the absence of PRC2 ( Figure 5\u2014figure supplement 2 ) .", "Moreover , expression of the putx-1 reporter was higher upon increased GLP-1Notch activity in glp-1 ( ar202 ) mutants , including the distal-most region where , in the wild\u00a0type , utx-1 is little or not expressed ( Figure 5B ) .", "Importantly , we found that the activation of the utx-1 promoter by Notch signaling was depended on the putative LAG-1/CSL binding sites within the promoter ( Yoo et al . , 2004 ) , as deleting those sites reduced reporter expression by approximately one-fourth ( Figure 5C ) .", "The interaction between LAG-1 and utx-1 was also tested by chromatin immunoprecipitation ( ChIP ) , performed on a strain expressing FLAG-tagged LAG-1 in either wild-type or glp-1 ( ar202 ) background ( Figure 5D and Figure 5\u2014figure supplement 3 ) ; the previously identified GLP-1Notch targets , lst-1 and sygl-1 ( Kershner et al . , 2014 ) , served as positive controls for the ChIP .", "Expectedly , we observed the enhanced binding of LAG-1 to the utx-1 promoter , indicating that utx-1 is a transcriptional target of GLP-1Notch signaling .", "Summarizing , based on the observations in mutant backgrounds , PRC2 and GLP-1Notch signaling have antagonistic effects on utx-1 transcription .", "However , in wild type , the endogenous levels of GLP-1Notch signaling are apparently insufficient to overcome PRC2-mediated repression of utx-1 in the distal-most part of the gonad . 10 . 7554/eLife . 15477 . 019Figure 5 . UTX-1 is regulated by GLP-1Notch and PRC2 . ( A\u2013C ) Expression of utx-1 is regulated by PRC2 and GLP-1Notch .", "Top: dissected gonads expressing a GFP reporter , driven from the utx-1 promoter ( putx-1::GFP , fused to histone 2B for nuclear localization to facilitate quantification ) , subjected to the indicated RNAi ( A ) , crossed into the indicated genetic background ( B ) or carrying the indicated mutations in the reporter gene ( C ) .", "a , b , and c indicate gonadal regions containing germ cells in mitosis", "( a ) , and leptotene/zygotene", "( b ) or pachytene", "( c ) stages of meiosis .", "Below: the corresponding GFP quantifications .", "The diagrams show GFP intensities relative to the control ( indicated by green arrows ) in regions a-c .", "Results are represented as average changes in the GFP intensity ( relative to mock RNAi-ed or untreated animals ) .", "The error bars represent SEM .", "The numbers of analyzed gonads were as follows: n = 44 for wild-type reporter; n = 36 for glp-1 ( ar202 ) ; n = 55 for wild-type reporter on control RNAi; n = 48 for mes-2 ( RNAi ) ; n = 15 for mes-3 ( RNAi ) ; n = 29 for mes-6 ( RNAi ) , and n = 20 for the LAG-1 binding sites deleted reporter .", "( A ) The putx-1::GFP reporter is repressed by PRC2 .", "In all mes-depleted gonads , the reporter was de-repressed in proliferating cells", "( a ) as well as in more proximal gonadal regions ( b-c ) .", "( B ) The putx-1::GFP reporter is upregulated by GLP-1Notch .", "In the gain-of-function glp-1 ( ar202 ) mutant , the reporter was strongly derepressed in the proliferating cells in the distal-most gonad", "( a ) .", "Its expression was also increased in the more proximal regions ( b-c ) , which , in this mutant background , contain proliferating cells instead of meiotic cells .", "( C ) putx-1::GFP expression depends on the predicted LAG-1/CSL binding sites in the promoter .", "Upon deletion of putative LAG-1/CSL binding sites , the reporter expression was abolished .", "The changes in GFP intensities were highly significant ( p-values were measured by independent t-tests ) p1=4 . 85\u201313 , p2=1 . 38\u201320 , p3=1 . 18\u20137 .", "( D ) LAG-1 binds the utx-1 promoter .", "Lysates of animals expressing FLAG-tagged LAG-1 ( strain wgIs591; lag-1::TY1::EGFP::3xFLAG ) , either in wild-type or glp-1 ( ar202 ) background , were subjected to ChIP-qPCR analysis of the indicated genes .", "Negative controls and additional tested genes are shown in Figure 5\u2014figure supplement 3 .", "The qPCR amplicons were tested in at least three independent experiments .", "The results are shown as fold enrichment in anti-FLAG IP compared to IP with unspecific antibody .", "The 3\u2019UTR of lst-1 serves as a negative control .", "Interestingly , LAG-1 binding in the glp-1 ( ar202 ) gain-of-function background is stronger to the utx-1 promoter than to the reported GLP-1Notch targets lst-1 and sygl-1 .", "The asterisk indicates\u00a0a p-value < 0 . 05 ( Students t-test ) .", "Error bars represent SEM . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 01910 . 7554/eLife . 15477 . 020Figure 5\u2014figure supplement 1 . The functional utx-1 transgene is expressed in the same pattern as a GFP reporter coupled to the utx-1 promoter . Shown is an adult with an outlined gonad .", "The full-length GFP-tagged functional UTX-1 ( rrrSi189 ) is repressed in the distal , proliferative part .", "Nuclei entering meiosis and developing oocytes express the fusion protein progressively stronger .", "This expression pattern is identical with the pattern seen in the utx-1 promoter reporter strains ( rrrSi185 , rrrSi281 ) .", "DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 02010 . 7554/eLife . 15477 . 021Figure 5\u2014figure supplement 2 . The endogenous utx-1 mRNA is upregulated in the absence of the PRC2-component MES-6 . Shown are representative in-situ hybridisations against endogenous utx-1 mRNA in dissected gonads .", "In M+Z- mes-6 ( bn66 ) mutants , utx-1 is upregulated throughout the gonads compared to the control wild-type gonads .", "'AS' and 'S' indicate antisense and sense probes . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 02110 . 7554/eLife . 15477 . 022Figure 5\u2014figure supplement 3 . Testing LAG-1 binding to additional genes by ChIP . Worm lysates ( corresponding to 4 mg protein ) of animals , with or without lag-1::TY1::EGFP::3xFLAG ( wgIs591 ) transgene , were used for ChIP .", "Samples were incubated with 50 \u00b5l of FLAG ( \u2018specific\u2019 FLAG antibody ) or HA antibodies ( \u2018unspecific\u2019 HA antibody ) coupled to \u00b5MACS microbeads ( Milteny ) .", "As negative control , lysate N2 or glp-1 ( ar202 ) worm lysates , which do not express the recombinant target protein , were used .", "Both negative control lysates did not show any differences during the ChIP experiment when tested with either specific antibody ( anti-FLAG coupled to \u00b5MACS beads ) or unspecific antibody ( anti-HA coupled to \u00b5MACS beads ) .", "Lysates of worms expressing the recombinant target protein in N2 or glp-1 ( ar202 ) background were incubated with specific ( anti-FLAG ) and unspecific ( anti-HA ) antibodies coupled to \u00b5MACS beads .", "The qPCR amplicons were tested in a minimum of three independent ChIP-qPCR experiments .", "Quantification results are shown as fold enrichment of anti-FLAG \u00b5MACS\u2122 beads using wgIs591 lysate over anti-FLAG \u00b5MACS beads using lysate without wgIs591 ( no lag-1::TY1::EGFP::3xFLAG ) .", "Primer for qPCRs ( sequence details above ) were designed using Primer3Plus ( Untergasser et al . , 2007 ) .", "The FLAG-beads using lysates with lag-1::TY1::EGFP::3xFLAG show specific enrichment for tested target genes thereby validating the specificity of the ChIP .", "The asterisks indicates p-values < 0 . 05 ( Students t-test ) .", "Error bars represent SEM . DOI: http://dx . doi . org/10 . 7554/eLife . 15477 . 022"], ["In the C . elegans germline , GLP-1Notch signaling is essential for maintaining a pool of undifferentiated stem cells/progenitors .", "Here , we report an unexpected role of GLP-1Notch signaling in promoting cell fate reprograming .", "To understand this phenomenon , we identified genes activated upon increased GLP-1Notch signaling .", "While the identified genes include the physiological GLP-1Notch targets , sygl-1 and lst-1 , many other genes , including utx-1 , appear to be only weakly or not expressed in the distal-most region of the wild-type gonad , where both sygl-1 and lst-1 are induced by GLP-1Notch ( Kershner et al . , 2014 ) .", "Thus , the wild-type levels of GLP-1Notch signaling are either insufficient to induce expression of many potential target genes ( see below ) , or their expression is controlled by additional mechanisms , perhaps similarly to lip-1 mRNA , which , while induced by GLP-1Notch , is post-transcriptionally degraded in the distal-most gonad ( Hajnal and Berset , 2002;\u00a0Lee et al . , 2006 ) .", "In addition to its major proliferation-promoting function , GLP-1Notch has been suggested to have a lesser role in promoting germ cell differentiation ( Hansen et al . , 2004 ) .", "Some of the identified Notch-activated genes appear to promote germ cell differentiation , potentially explaining the proposed differentiation-promoting function of GLP-1Notch .", "However , whether these genes are activated by GLP-1Notch and promote differentiation under physiological conditions remains to be determined .", "Many of the Notch-activated genes are repressed by PRC2 , suggesting that the expression of these genes is determined by the crosstalk between the extrinsic intercellular signaling pathway , Notch , and the intrinsic chromatin modifier PRC2 .", "Indeed , at least in the case of utx-1 , PRC2 appears to prevent its inappropriate expression in the distal-most gonad , which , nevertheless , can be overcome upon increased GLP-1Notch signaling .", "Our findings suggest that GLP-1Notch antagonizes PRC2 , at least in part , by stimulating expression of the H3K27 demethylase UTX-1 , which is essential for the enhancement of cellular reprograming .", "Previously , it was suggested that UTX-1 influences the germline by functioning in the somatic gonad ( Vandamme et al . , 2012 ) .", "However , by using the rrf-1 background , which displays defective RNAi in the somatic gonad , including the\u00a0DTC ( Kumsta and Hansen , 2012 ) , we found that the reprograming-promoting role of UTX-1 is unlikely to depend on its function in the somatic gonad .", "Although we cannot fully exclude the possibility that the reprograming-facilitating role of UTX-1 depends on its expression in another somatic tissue ( such as the intestine , in which RNAi remains functional in the rrf-1 mutant; Kumsta and Hansen , 2012 ) , the germline expression of UTX-1 reported here suggests a germline-autonomous function .", "Consistent with this hypothesis , manipulating either PRC2 or GLP-1Notch affected the germline expression of utx-1 .", "Although additional factors , such as the uncharacterized C07G1 . 6 and the ortholog of the human aldolase A ( Kuwabara and O'Neil , 2001; Shaye and Greenwald , 2011 ) might contribute to reprograming , they appear to be less critical .", "In addition to UTX-1 , another H3K27/H3K9-demethylating enzyme , JMJD-1 . 2 ( Kleine-Kohlbrecher et al . , 2010 ) , is required for enhanced reprograming .", "Similar to UTX-1 , JMJD-1 . 2 is likely to be directly involved in regulating chromatin accessibility , since its depletion results in increased levels of the repressive H3K9me2 and H3K27me2 modifications ( Kleine-Kohlbrecher et al . , 2010 ) .", "The reprograming-promoting role of JMJD-1 . 2 might indicate that , besides further demethylation of H3K27me2 , perhaps also the removal of H3K9me2 facilitates GeCo .", "Future studies will shed light on this interesting question .", "UTX-1 orthologs in other species contribute to tissue-specific chromatin signatures , for example during myogenesis or in cardiac development ( Seenundun et al . , 2010; Lee et al . , 2012 ) , and have been implicated in germ-cell and somatic reprograming ( Mansour et al . , 2012 ) .", "Together with our data , these findings underscore the importance of UTX-1 in cellular reprograming .", "Here , we suggest that one way the activity of UTX-1 may be stimulated to promote reprograming is through its Notch signaling-dependent transcriptional activation .", "Interestingly , an antagonistic relationship between Notch and PRC2 has also\u00a0been observed in T-cell leukemia ( Ntziachristos et al . , 2012 ) .", "A fascinating possibility is that a regulatory principle described here could help explain the etiology of this and perhaps other human diseases linked to a pathological increase in Notch signaling ."], ["Standard procedures were used to maintain animals .", "Worms ( RRID:WB_DL226 ) were grown at 25\u00b0C unless stated otherwise .", "All heat-shock and temperature-sensitive strains were kept at 15\u00b0C .", "The C . elegans lines used in this study are listed and described in detail in the Supplementary file 3A .", "The enhancer-suppressor screen on Notch targets was performed by feeding the animals with bacteria containing RNAi clones from the Ahringer and Vidal RNAi libraries .", "The clones not present in either of these libraries were cloned using primers as described in detail in the Supplementary file 3B .", "Experiments were performed at 15\u00b0C , 20\u00b0C or 25\u00b0C using bleached embryos or overnight-synchronized L1 animals as stated in Supplementary file 1 .", "The percentage of adult animals with the germline tumor phenotype was scored .", "To test germ-cell autonomy , RNAi clones that induced significant suppression or enhancement in either setting were re-tested in a strain carrying the glp-1 ( ar202 ) ( RRID:WB_GC833 ) allele and , additionally the rrf-1 ( pk1417 ) ( RRID:WB_NL2098 ) mutation , which impairs RNAi primarily in the soma ( Sijen et al . , 2001 ) .", "For this test , gravid adults were picked to RNAi plates and allowed to lay eggs overnight at the semi-permissive temperature of 20\u00b0C .", "Progeny was scored for enhancement or suppression of the germline tumorous phenotype at the young adult stage by DAPI staining of dissected gonads and scoring gonads as either wild-type , as containing a proximal or distal tumor but still some eggs , or as completely tumorous .", "Reprograming experiments were carried out as F1-RNAi .", "Worms were put on RNAi plates and the following F1 generation was screened for phenotypes .", "Used RNAi clones are described in the Supplementary file 3B .", "The genotype of the worms used for germ cell reprograming assays is BAT28 ( otIs305 ntIs1 , RRID:WB_OH9846 , details in Supplemental Materials and methods ) .", "Animals were synchronized by bleaching and eggs were put on NGM-agar containing E . coli OP50 ( RRID:WB_OP50 ) as a\u00a0food source to grow at 15\u00b0C until worms reached the L4-stage .", "At this stage 15\u201320 worms were put per well of a 6-well plate , containing bacteria expressing dsRNA or carrying an empty RNAi vector , and grown at 15\u00b0C until most of the F1 progeny reached the L3/L4 stage .", "The plates were heat-shocked at 37\u00b0C for 30\u2009min followed by an overnight incubation at 25\u00b0C .", "Next day ( ~16\u2009hrs post heat-shock ) the plates were screened for progeny showing ectopic GFP induction in the germline .", "To induce the Glp\u00a0phenotype in glp-1 ( ar202 ) , the animals were shifted to room temperature 9\u2009hrs before the heat-shock .", "For double RNAi , bacteria were grown as saturated culture .", "The OD600 was measured to ensure that the bacteria were mixed in an appropriate 1:1 ratio and subsequently seeded on RNAi 6-well plates .", "The RNAi screen was performed as described above .", "The p-values were calculated using Student's t-test .", "Hydroxyurea ( HU ) treatment was carried out as previously described ( Fox et al . , 2011; Patel et al . , 2012 ) .", "HU was added to seeded RNAi-plates at a final concentration of 250 \u00b5M .", "L4 worms ( strain BAT32 , details in Supplementary file 3A ) grown on RNAi-plates were transferred to HU plates and incubated at room temperature for 5\u2009hrs prior to heat-shock in order to induce CHE-1 expression .", "To test HU efficiency , control animals were treated with HU for 12\u2009hrs with subsequent staining for DAPI and H3Ser10ph ( pH3 ) antibody ( Abcam #ab5176 ) .", "After overnight incubation , the worms were assessed for GFP induction in the germline as described above .", "To assess the efficiency of the HU treatment , the E . coli strain MG1693 ( E . coli stock center ) , with incorporated 5-ethynyl-20-deoxyuridine ( EdU ) , was used to feed L3/L4 worms .", "EdU in combination with DAPI staining was performed similar to the procedure described previously ( Ito and McGhee , 1987 ) and according to the manufacturer's instructions ( Invitrogen , Europe ) of the EdU labeling kit .", "The Click-iT EdU reaction buffer ( Invitrogen , Europe ) was mixed with Alexa Fluor azide ( \u2018click\u2019 reaction ) dye to detect cells that were replicating DNA .", "Staining was performed by freeze cracking worms after fixation with 2% formaldehyde .", "Parental animals were raised at 15\u00b0C and shifted to 25\u00b0C for egg laying .", "Offspring was dissected after the L4-adult transition .", "Fifty gonads per analyzed genotype in triplicates were dissected in M9 containing levamisole .", "RNA was isolated using the PicoPure RNA Isolation Kit ( Applied Biosystems ) according to the manufacturer\u2019s recommendations .", "Total RNA ( 200 ng for the Notch ON/OFF experiments or 100 ng for the mes/wild-type experiments ) was amplified using the Affymetrix GeneChip WT Amplified Double Stranded cDNA Synthesis Kit according to the manufacturer\u2019s instructions .", "The Affymetrix GeneChip WT Double-Stranded cDNA Terminal Labeling Kit was used for the fragmentation and labeling of 7 . 5\u2009\u03bcg cDNA .", "The labeled material was loaded onto Affymetrix GeneChip C . elegans Tiling 1 . 0R Arrays and hybridized at 65\u00baC for 16\u2009hrs .", "The arrays were washed in an Affymetrix Fluidics station with the protocol FS450_0001 and scanned in an Affymetrix GeneChip Scanner 3000 with autoloader using Affymetrix GCC Scan Control v . 3 . 0 . 0 . 1214 software .", "All tiling arrays were processed in R ( 32 , 33 ) using Bioconductor ( 34 ) and the packages tilingArray and preprocessCore .", "The arrays were RMA background corrected and log2 transformed on the oligo level using the following command: expr <- log2 ( rma . background . correct ( exprs ( readCel2eSet ( filenames , rotated = TRUE ) ) ) ) .", "We mapped the oligos from the tiling array ( bpmap file from www . affymetrix . com ) to the C . elegans genome assembly ce6 ( www . genome . ucsc . edu ) using bowtie ( Langmead et al . , 2009 ) , allowing no error and unique mapping position .", "Expressions for individual transcripts were calculated by intersecting the genomic positions of the oligos with transcript annotation ( WormBase WS190 ) and averaging the intensity of the respective oligos .", "For the mes-4/wt experiment , no quantile normalization was performed as the distributions for the mes-4 mutant and the wt differed substantially .", "In the case of the Notch ON/OFF dataset quantile normalization was performed on the level of transcripts .", "The p-values were calculated in R with the hypergeometric distribution function 'phyper' .", "RNA was isolated as described above .", "cDNA was synthesized with oligo dT primer using the ImProm II Reverse Transcription System from Promega according to the manufacturer\u2019s instructions .", "cDNA was used for qPCR with the Absolute QPCR SYBR Green ROX Mix ( AbGene ) on an ABI PRISM 7700 system ( Applied Biosystems ) .", "qPCR reactions were performed as described previously ( Biedermann et al . , 2009 ) .", "At least one primer in each pair is specific for an exon-exon junction .", "Sequences of the used primers are described in detail in the Supplementary file 3C .", "Mouse RNA was added before RNA isolation and reverse transcription , allowing for normalization to cyt-c and thereby correcting for variations in RNA isolation and reverse transcription .", "Standard curves for quantification were generated from a serial dilution of input cDNA for each primer pair .", "The amount of target present in each replicate was derived from the standard curve; an average was calculated for each of the triplicates .", "To compare total mRNA levels , the qPCR results were normalized to mouse cyt-c and to the C . elegans tubulin gene tbb-2 , and fold enrichments were calculated .", "RNA in situ hybridization was performed and analyzed as previously described ( Biedermann et al . , 2009 ) .", "Description of the primer pairs to generate probes from cDNA can be found in the Supplementary file 3C .", "Images were captured with a Zeiss AxioImager Z1 microscope , equipped with a Zeiss AxioCam MRc camera .", "Images were taken in linear mode of the Axiovision software ( Zeiss ) and processed with Adobe Photoshop CS4 in an identical manner .", "ChIP was performed as described ( Askjaer et al . , 2014 ) .", "In brief , worms ( strains OP591 , RRID:WB_OP591 , and BAT890 ) were washed with M9 buffer and frozen as \u2018worm popcorn\u2019 in liquid nitrogen prior to pulverization with a mortar and pestle .", "The powder was dissolved in 10 volumes of 1 , 1% formaldehyde in PBS + 1\u00a0mM PMSF and incubated 10\u2009mins with gentle rocking at room temperature with subsequent quenching for 5\u2009mins at room temperature by adding 2 , 5 molar glycine ( final concentration 125\u2009mM ) .", "After centrifugation with 4 . 000\u2009g at 4\u00b0C the pellet was washed with ice-cold PBS+1\u00a0mM PMSF and resuspended in 50\u2009mM FA buffer ( 50\u2009mM HEPES/KOH pH 7 , 5; 1\u00a0mM EDTA; 1% Triton-X 100; 0 , 1% sodium deoxycholate; 150\u2009mM NaCl ) + 1% sarkosyl + protease-inhibitors .", "Samples were sonicated twice using the Biorupter ( 15 times 30 s ON , 30 s OFF ) on high settings at 4\u00b0C followed by spinning at 13 . 000\u2009g , 15\u2009min , 4\u00b0C .", "The supernatant corresponding to 4 mg of protein measured by Bradford assay was used for ChIPs .", "Samples were incubated with 50 \u00b5l of FLAG or HA antibodies coupled to \u00b5MACS microbeads ( Milteny ) ( all blocked with 5% milk in FA-buffer ) .", "After incubating 1\u2009hr at 4\u00b0C , the beads where washed in \u00b5MACS matrix columns in a magnetic rack with FA buffer containing 1\u00a0M and 0 . 5\u2009M NaCl and subsequent wash with TE and TEL buffer ( 0 , 25\u2009M LiCl; 1% Sodium deoxycholate; 1\u2009mM EDTA; 10\u2009mM Tris pH 8 , 0 ) .", "Bound material was eluted with 65\u00b0C pre-warmed 125 \u00b5l ChIP elution buffer ( 1% SDS , 250\u2009mM NaCl , 10\u2009mM Tris pH 8 . 0 , 1\u2009mM EDTA ) and fixation was reversed using 2 \u00b5l of 10 mg/ml Proteinase K at at 50\u00b0C for 1\u2009hr followed by 65\u00b0C incubation overnight .", "DNA was purified using the Quiaquick PCR purification kit in a final volume of 40 \u00b5l and 1 \u00b5l was used for qPCR .", "Negative controls were used to assess the quality of the ChIP and fold enrichment of the target genes: lysates ( N2 worms ) which do not express the recombinant target protein with specific antibody ( anti-FLAG coupled to \u00b5MACS beads ) and lysates of worms expressing the recombinant target protein with unspecific antibody ( anti-HA coupled to \u00b5MACS beads ) controls , respectively .", "Primer for qPCRs was designed using Primer3Plus ( Untergasser et al . , 2007 ) with the following settings: amplified region min . 100 bp \u2013 max .", "200 bp; GC content: 50\u201360%; min . primer length: 18 nt \u2013 max .", "length 24 nt; melting temperature: min . 58\u00b0C \u2013 max .", "63\u00b0C; max .", "; 3' self complementary allowance set to 1; max .", "allowed length of a mononucleotide repeat ( max . poly-x ) : 3 .", "Sequences of the used primers are listed in in the Supplementary file 3C .", "The qPCRs were run on CFX96 Touch Real-Time PCR Detection System from BioRad using the Maxima SYBR Green/ROX qPCR Master Mix ( 2X ) .", "The data analysis was performed by calculating the \u0394\u0394Ct-values .", "Differences were assessed using Student's t-test .", "Worms were transferred to a slide and fixed by adding 10\u201320 \u00b5l 95% ethanol and letting evaporate the ethanol .", "The ethanol fixation was repeated 2 more times before adding the DAPI solution in microscopy mounting media ( vectashield from Vector or similar ) .", "The samples were sealed with a coverslip and nail polish before microscopy .", "Fluorescent micrographs were recorded with Zeiss AxioImager Z1 microscope and the SensicamII camera ( PCO ) and the micromanager software was used to capture Z-stack images with 0 . 5 \u00b5m slice steps .", "Images subject to direct comparison were taken at identical exposure times .", "Counting of germ cells within the range from the DTC to the turn of gonadal arms of glp-1 ( ar202 ) ; hsp::che-1; gcy-5::gfp animals treated with either mock or lin-53 RNAi was performed using the Z-stacks .", "Micromanager was used to control the Z-stack levels and the ImageJ plugin for cell counting for scoring the number of germ cells .", "Germ cell counts in gonads of Notch ON: gld-2 ( q497 ) gld-1 ( q485 ) ; glp-1 ( ar202 ) and Notch OFF: gld-2 ( a497 ) gld-1 ( q485 ) ; glp-1 ( e2144 ) ( Figure 1\u2014figure supplement 2 ) and germline tumor phenotype in glp-1 ( ar202 ) and glp-1 ( ar202 ) ; rrf-1 ( pk1417 ) were scored after dissection , formaldehyde fixation and DAPI staining .", "For Notch ON and Notch OFF mutants , the central plane of the gonads was imaged and germ cells in the entire dissected gonad were counted using the CellCounter plugin with ImageJ .", "For each of the two strains , germ cells in the entire gonad of 15 dissected gonads were counted .", "Antibody stainings of intact worms were performed using a freeze-crack procedure as described ( Duerr , 2006 ) .", "In brief , after washing , worms were resuspended in 0 . 025% glutaraldehyde , and frozen between two frost-resistant glass slides on dry ice .", "Separating the glass slides while frozen creates additional cracks in the cuticle .", "Acetone/methanol or 4% paraformaldehyde in 0 . 1\u00a0M phosphate buffer for 1\u2009hr on ice fixation was used .", "Worms were washed off the slides in PBS , blocked with 0 . 2% gelatin + 0 . 25% Triton in PBS , and stained .", "Primary antibodies were diluted in PBS with 0 . 1% gelatin and 0 . 25% Triton and fixed worms were incubated 4\u2009hrs - overnight at 4\u00b0C .", "After PBS washes secondary antibody was applied for 3\u2009hrs .", "After PBS washes worms were mounted with DAPI-containing mounting medium ( Dianova , #CR-38448 ) on glass slides .", "The primary antibodies used were anti-H3K27me3 ( 1:400; gift from Dr . Hiroshi Kimura ) ; anti-HA ( 1:100 , Roche #12CA5; acetone fixation ) ; anti-H3Ser10ph ( 1:400 , Abcam , #ab14955; acetone fixation ) .", "Secondary antibodies were Alexa Fluor dyes applied at 1:1000 dilution .", "Stainings for H3K27me3 on dissected gonads were performed using anti-H3K27me3 from Millipore ( catalogue number 07\u2013449 , Lot 1959680; courtesy of Jan Padeken , Gasser laboratory ) on dissected gonads .", "The\u00a0adult animals were dissected in M9 containing levamisole , fixed with 2% paraformaldehyde in PBS on poly-lysine coated slides , snap-frozen on dry ice , freeze-cracked , incubated for 5 mins in ice-cold DMF at \u221220\u00b0 , washed for 5\u2009mins in PBS 0 . 1% Tween-20 at room temperature , blocked for 20\u2009mins in PBS 0 . 1% Tween-20 + 5% BSA and incubated with the primary antibody over night at 4\u00b0C .", "Secondary antibodies ( Alexa 488 , goat anti rabbit , 1:500 ) were applied for 2\u00a0hrs at room temperature .", "Slides were then washed three times for 5\u2009mins in PBS 0 . 1% Tween-20 at room temperature and mounted with Vectashield mounting medium containing DAPI .", "The transcriptional reporter gene putx-1::gfp-h2b ( rrrSi185 ) was constructed from the 1302 bp putative promoter region of the gene utx-1 ( human UTX ( Ubiquitously transcribed TPR on X ) homolog - 1 ) fused to sequences encoding for GFP-H2B and the ubiquitously expressed tbb-2 3\u2019UTR using the Gateway Reporter Cloning System ( Merritt et al . , 2008 ) .", "The reporter gene putx-1::gfp-h2b ( rrrSi185 and rrrSi281 ) was constructed with the following primers: putx-attB4: GGGGACAACTTTGTATAGAAAAGTTGGGATTTTATCTTCATCGGACCTG putx-attB1 : GGGGACTGCTTTTTTGTACAAACTTGTGGCGGTGTGAGAAGCGATAC The full-length functional transgene putx-1::flag-gfp-utx-1::utx-1 3\u2019UTR ( rrrSi189 ) was constructed with the following primers: utx-1+3UTR+attB2 L ggggacagctttcttgtacaaagtggACGACGAATCAGAACCTCTGCCGGAGGAGCGTCATgtaag utx-1+3UTR+attB3 R ggggacaactttgtataataaagttgaatgcggatactgccttctc The functional UTX-1 transgene putx-1::flag-gfp-tev::utx-1::utx-1 3\u2019utr ( rrrSi189 ) contains the same promoter as the transcriptional reporter , the full-length utx-1 genomic sequence as well as the endogenous 3\u2019UTR , and was equipped with N-terminal GFP , FLAG , and TEV tags .", "Transgenic animals were produced\u00a0as\u00a0single-copy integrants\u00a0using the MosSCI direct insertion protocol ( Fr\u00f8kjaer-Jensen et al . , 2008 ) .", "The rrrSi189 transgene is functional , as it rescues the utx-1 mutant ( ok3553 allele ) .", "For GFP quantification , gonads were dissected from live animals in M9 buffer containing levamisole and mounted to glass microscopy slides ( Fr\u00f8kjaer-Jensen et al . , 2008 ) .", "Fluorescent micrographs were recorded with Zeiss AxioImager Z1 microscope and a Zeiss Axioncam MRm REV 2 CCD camera was used to capture images .", "Fluorescence intensities were quantified using ImageJ .", "GFP intensities were normalized to the picture background and corrected with the average autofluorescences measured in wild type ( N2 ) gonads at the corresponding temperatures .", "Images subject to direct comparison were taken at identical exposure times and were processed with Adobe Photoshop CS4 in an identical manner .", "The numbers of analyzed gonads were as follows: n = 44 for wild-type reporter; n = 36 for glp-1 ( gf ts ) ; n = 55 for wild-type reporter on control RNAi; n = 48 for mes-2 ( RNAi ) ; n = 15 for mes-3 ( RNAi ) ; n = 29 for mes-6 ( RNAi ) , and n = 20 for LAG-1 binding sites deleted reporter .", "Alleles used were glp-1 ( ar202 ) and mes-2 ( bn11 ) .", "Worms were grown at the semi-permissive temperature of 20\u00b0C and gonads were dissected and DAPI-stained shortly after the L4-young adult transition .", "The experiment was performed twice .", "In a first round , a low number of gonads were examined to identify whether the double mutant had a phenotype and to define phenotypic categories to score .", "Based on the observation of a clear and penetrant phenotype , gonads were scored in a second round according to the categories defined in the first round ."]], "headings": ["Introduction", "Results", "Discussion", "Materials and methods"], "abstract": ["Cell-fate reprograming is at the heart of development , yet very little is known about the molecular mechanisms promoting or inhibiting reprograming in intact organisms .", "In the C . elegans germline , reprograming germ cells into somatic cells requires chromatin perturbation .", "Here , we describe that such reprograming is facilitated by GLP-1/Notch signaling pathway .", "This is surprising , since this pathway is best known for maintaining undifferentiated germline stem cells/progenitors .", "Through a combination of genetics , tissue-specific transcriptome analysis , and functional studies of candidate genes , we uncovered a possible explanation for this unexpected role of GLP-1/Notch .", "We propose that GLP-1/Notch promotes reprograming by activating specific genes , silenced by the Polycomb repressive complex 2 ( PRC2 ) , and identify the conserved histone demethylase UTX-1 as a crucial GLP-1/Notch target facilitating reprograming .", "These findings have wide implications , ranging from development to diseases associated with abnormal Notch signaling ."], "summary": ["The DNA in genes encodes the basic information needed to build an organism or control its day-to-day operations .", "Most cells in an organism contain the same genetic information , but different types of cell use the information differently .", "For example , many of the genes that are active in a muscle cell are different from those that are active in a skin cell .", "These different patterns of gene activation largely determine a cell\u2019s identity and are brought about by DNA-binding proteins or chemical modifications to the DNA ( which are both forms of so-called epigenetic regulation ) .", "Nevertheless , cells occasionally change their identities \u2013 a phenomenon that is referred to as reprograming .", "This process allows tissues to be regenerated after wounding , but , due to technical difficulties , reprograming has been often studied in isolated cells grown in a dish .", "Seelk , Adrian-Kalchhauser et al . set out to understand how being surrounded by intact tissue influences reprograming .", "The experiments made use of C . elegans worms , because disturbing how this worm\u2019s DNA is packaged can trigger its cells to undergo reprograming .", "Seelk , Adrian-Kalchhauser et al . show that a signaling pathway that is found in many different animals enhances this kind of reprograming in C . elegans .", "On the one hand , these findings help in understanding how epigenetic regulation can be altered by a specific tissue environment .", "On the other hand , the findings also suggest that abnormal signaling can result in altered epigenetic control of gene expression and lead to cells changing their identity .", "Indeed , increased signaling is linked to a major epigenetic mechanism seen in specific blood tumors , suggesting that the regulatory principles uncovered using this simple worm model could eventually provide insights into a human disease .", "A future challenge will be to determine precisely how the studied signaling pathway interacts with the epigenetic regulator that controls reprograming .", "Understanding this interaction in molecular detail could help to devise strategies for controlling reprograming .", "These strategies could in turn lead to treatments for people with conditions that cause specific cells types to be lost , such as Alzheimer\u2019s disease or injuries ."], "keywords": ["developmental biology"]}