Datasets:

princeton-nlp

/

TextbookChapters

like 6

pH Acids and Bases We can call any compound that adds H+ ions (a free proton) into solution an acid. Along with this, we would expect that any compound that would decrease the concentration of free H+ of a solution as a base. pH is the power of H+ of a solution. We define this power as a molar concentration of H+ in solution. This concentration invariably ends up being a relatively small number (though great in absolute numbers) and is expressed as a decimal number. Because the range of the concentrations is so great, we express these numbers as logarithmic numbers to avoid writing many 0’s after the decimal and to facilitate communicating the concentration. Since these numbers are so (relatively) small, we use the negative logarithm to describe this concentration. Mathematically defined, The pH scale ranges so that anything below pH 7 is acidic and anything above pH 7 is alkaline. So a smaller number is more acidic. But didn’t we just state that something acidic contains more H+ ions? Remember, because we are dealing with a negative Logarithm, this means the concentration is higher. Logarithmic Scales If we have a quantity that is 102, we know that translates into 100. Just as if we have a quantity of 104, we know that translates into 10000. Just as it becomes inconvenient to keep writing all those 0’s, it’s really impractical to write many many 0’s after a decimal. It’s really hard to talk about too! So we likewise will express numbers like 0.0001 as 10-4. A logarithm is the reverse function of an exponent. Therefore: So how do we define a solution that is pH 2? Well, we already decided that this solution is below pH 7 — making it an acid. But what does this mean in terms of H+ ion concentration? Let’s work this out algebraically: • Let’s bring the (-) over to the other side • Now let’s reverse the Log → base 10 • Plug in the pH → molar concentration of [H+] As we can now see, a solution of pH 2 is acidic because the molar concentration of [H+] is 10-2mole/L or 0.01M Dissociation of Ions: That Number is Small! It’s not a small number. Remember that a mole is 6.022 X 1023. That’s a very large number! Think about it! A solution of pH 4 is acidic, but if we plug in the formula, we realize that this is equal to 0.0001M H+ – less than pH 2 at 0.01M! But let’s compare it to the [H+] content of H2O. Now I’m going to sound crazier! Water can be thought of as being in an equilibrium where some of the molecules are ionizing and deionizing. We can express this in 2 ways: • H2O ⇋ H+ + OH • 2H2O ⇋ H3O+ + OH So at any given point, a liter of H2O at neutral pH (7) has 10-7 moles of H+ ions. Incidentally, it also has 10-7 moles of OH in solution. The second expression indicates the formation of a hydronium ion (H3O+) instead of a free proton in solution. So something that is pH 2 is a stronger acid than pH 4, right? Nope. That just indicates the amount of free protons in solution. It is more acidic but acid strength means something else. When we talk about strong acids, it means that it is more likely to donate a proton to the solution because it is more likely to ionize. Let’s look at the following: • HA ⇋ H+(aq) + A(aq) Where HA is an acid dissociating in solution If this dissociation is very high, then we say that it is a strong acid. Similarly, a compound like NaOH readily dissociates completely in solution and provides OH ions that can readily remove H+ from the solution—a strong base! We speak of dissociation in terms of rates and we express this as the acid dissociation constant, Ka. This is calculated using the concentrations of [H+] (proton), [A] (conjugate base) and [HA] (non-dissociated) at equilibrium: Just like the orders of magnitude we have when discussing pH, the rates of dissociation are more conveniently communicated on a logarithmic scale. Think about it this way, if the concentration of the dissociated ions is very high, the numerator in the rate is very high → Ka is great. In other words, at equilibrium, the dissociation reaction looks more unidirectional than bi-directional as the compound is readily ionized: • HA → H+(aq) + A(aq) On this scale, we refer to anything with a pKa < -2 as a strong acid since it will readily dissociate in solution. This form of the dissociation constant is extremely useful in estimating the pH of buffered solutions and for finding the equilibrium pH of the acid-base reaction (between the proton and the conjugate base). We can estimate the pH by utilizing the Henderson-Hasselbalch Equation: Buffered Solutions A buffer is something that resists change. A buffered solution is one that consists of a weak acid or weak base that will control the pH of a solution. Imagine a buffer to be a reservoir of available H+ or OH- ions. If a buffered solution is pH 2, adding a basic solution to it will not cause a drastic change to the pH because the reservoir of H+ will continuously neutralize the base. Eventually, this store or reservoir of H+ will be depleted. When this happens, the pH will suddenly change. The range in which acid or base is added without a significant change in pH is called the buffered zone or the buffering capacity. When this store of H+ or buffering capacity is expended, we have reached the equivalence point that describes the point at which the base has completely neutralized the weak acid. Titration of an acid by a base The solution has a good buffering capacity between pH 3 and pH 5 Acids and Bases Simulation Click here to run the simulation on Acids and Bases pH simulation Click here to run the simulation on pH scales Use the table below to indicate whether an item is an acid or a base and what you predict the pH to be. We can determine these in class through measuring. Solution Acid or Base Predicted pH Actual pH Coffee Cola Distilled H2O Detergent Bleach Apple Juice Antacid Solution 2.06: pH (Activity) Inquire! • What is the mechanism of action for antacids? • Do they all antacids have the same efficacy? Explore: Determine the pH of Common Solutions 1. Use the table below to indicate whether an item is an acid or a base and what you predict the pH to be. We can determine these in class through measuring. Solution Acid or Base Predicted pH Actual pH Coffee Cola Distilled H2O Detergent Bleach Apple Juice Antacid Solution 2. Using the pH meter, measure the pH and validate your predictions.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/02%3A_Chemistry/2.05%3A_pH.txt

Introduction: Carbohydrates Carbohydrates serve 2 major functions: energy and structure. As energy, they can be simple for fast utilization or complex for storage. Simple sugars are monomers called monosaccharides. These are readily taken into cells and used immediately for energy. The most important monosaccharide is glucose (C6H12O6), since it is the preferred energy source for cells. The conversion of this chemical into cellular energy can be described by the equation below: C6H12O6 (s) + 6 O2 (g) → 6 CO2 (g) + 6 H2O (l) + energy Long polymers of carbohydrates are called polysaccharides and are not readily taken into cells for use as energy. These are used often for energy storage. Examples of energy storage molecules are amylose, or starch, (plants) and glycogen (animals). Some polysaccharides are so long and complex that they are used for structures like cellulose in the cell walls of plants. Cellulose is very large and practically indigestible, making it unsuitable as a readily available energy source for cells. Carbohydrates: Carbohydrates are composed of sugar units referred to as -saccharides. Many monosaccharides such as glucose and fructose are reducing sugars, meaning that they possess free aldehyde or ketone groups that reduce weak oxidizing agents such as the copper in Benedict’s reagent. The double bond in the carbonyl group is a source of electrons that can be donated to something else. That is to say, those electrons can be “lost” by the sugar and “gained” by another chemical. Benedict’s reagent contains cupric (copper) ion complexed with citrate in alkaline solution. Benedict’s test identifies reducing sugars based on their ability to reduce the cupric (Cu2+) ions to cuprous oxide (Cu+) at basic (high) pH. Cuprous oxide is green to reddish-orange. Roughly speaking, reduction is a type of chemical reaction that is paired with oxidation. In oxidation/reduction reactions (RedOx), some chemical loses electrons (oxidized) to another chemical that gains them (reduced). We remember whether a compound is reduced or gained by using the pneumonic: LEO goes GER or Loss of Electrons is Oxidation & Gain of Electrons is Reduction. Monosaccharides contain a carbonyl group. The carbonyl is a source of electrons (the double bond on the oxygen). These electrons can be donated (or lost and oxidized) to reduce another compound (that gains those electrons). Glucose is the preferred carbohydrate of cells. In solution, it can change from a linear chain to a ring. Monosaccharides are capable of isomerizing. This means they alternate in structure from a linear chain to a ring form in solution. In the chain form, the aldehyde is free to donate (lose) electrons to reduce another compound. When monosaccharides undergo dehydration synthesis to form polymers, they can no longer isomerize into chains with free aldehydes and are unable to act as reducing sugars. Green color indicates a small amount of reducing sugars, and reddish-orange color indicates an abundance of reducing sugars. Non-reducing sugars produce no change in color (i.e., the solution remains blue). Note: Cu2+ has fewer electrons than Cu+. When monosaccharides undergo dehydration synthesis to form polymers, they can no longer isomerize into chains with free aldehydes and are unable to act as reducing sugars. Green color indicates a small amount of reducing sugars and reddish-orange color indicates an abundance of reducing sugars. Non-reducing sugars produce no change in color (i.e., the solution remains blue). Structural Carbohydrates In food, more complex carbohydrates are derived from larger polysaccharides. These larger carbohydrates are fairly insoluble in water. Dietary fiber is the name given to indigestible materials in food most often derived from the complex carbohydrates from vegetable material. Some of this material serves the plants as a structural component of the cells and is completely insoluble. Cellulose is the major structural carbohydrate found in plant cell walls. Similarly, animals and fungi have structural carbohydrates that are composed of the indigestible compound called chitin. We will not be testing for these items. Cellulose is a complex carbohydrate of glucose molecules. It is the major structural component of plant cell walls. It’ structural durability is enhanced by intramolecular hydrogen bonds. Chitin is a structural carbohydrate found in animal shells or fungi cell walls. The polymer contains amide groups that differentiate it from other carbohydrates composed of glucose. A cicada molting from its shell made of chitin. Detection of Carbohydrates (Activity) Materials: • potato juice • apple juice • urine sample 1 • urine sample 2 • reducing sugar solution • starch solution • Benedict’s Reagent • Sucrose solution • glucose solutions • distilled water • hot plates • beakers of water • test tubes • test tube rack Stop and Think • Use your senses and previous observations/experiences about the qualities of the experimentals. • Formulate some hypotheses about the carbohydrate content of the experimentals or unknowns. • Identify if the sample is experimental or control before making a hypothesis. Question: Are There Simple Reducing Sugars in my Juice? Are There Simple Reducing Sugars in my Urine? Diabetes mellitus is a disease that refers to the inability of the cells to take in glucose. The word diabetes refers to urination and mellitus refers to sweetness. Since the cells of diabetics cannot remove glucose from the blood, there is an excess of glucose circulating that is eliminated in the urine. The traditional method of diagnosing someone with diabetes mellitus was to taste the sweetness of the patient’s urine. Let’s use Benedict’s test for the detection process instead of the unhygienic alternative. Make a hypothesis and ask what we would predict from a Benedict’s test if testing a urine sample of someone with diabetes mellitus. Benedict’s Test For Reducing Sugars 1. Obtain 9 test-tubes and number them 1-9. 2. Add to each tube the materials to be tested. Your instructor may ask you to test some additional materials. If so, include additional numbered test tubes. 3. Indicate in the table whether the sample you are testing is positive control, a negative control, or an experimental. 4. Before you begin the heating of the samples, predict the color change (if any) for each sample. (use the sample type to aid in your prediction) 5. Add 40 drops (or 2 ml) Benedict’s solution to each tube. 6. Place all of the tubes in a boiling water bath for 3 min or until a noticeable color change and observe colors during this time. 7. After 3 minutes, remove the tubes from the water bath and let them cool to room temperature. Record the color of their contents in the Table. Iodine Test for Starch Carbohydrates that are used for energy storage are not reducing sugars since they are polymers that lack free aldehydes. Plant cells store energy in the form of starches like amylose or pectin. Since these molecules are larger than monosaccharides or disaccharides, they are not sweet to the taste and are not very soluble in water. Iodine (iodine-potassium iodide, I2KI) staining distinguishes starch from monosaccharides, disaccharides, and other polysaccharides. The basis for this test is that starch is a coiled polymer of glucose — iodine interacts with these coiled molecules and becomes bluish-black. Iodine does not react with other carbohydrates that are not coiled and remains yellowish brown. Therefore, a bluish-black color is a positive test for starch, and a yellowish-brown color (i.e., no color change) is a negative test for starch. Notably, glycogen, a common energy storage polysaccharide in animals, has a slightly different structure than does starch and produces only an intermediate color reaction. Plants store carbohydrates as a simple repeating polymer of glucose called starch. Amylose is a type of starch. Animal cells store glucose into a storage polymer called glycogen which is slightly more complicated than amylose. Activity: Iodine Test For Starch 1. Obtain 7 test-tubes and number them 1-7. 2. Hypothesis Testing: Indicate in the table if the sample is experimental or control. Predict your expected color changes for each sample. 3. Add to each tube the materials to be tested as indicated in the table below. Your instructor may ask you to test some additional materials. If so, include additional numbered test tubes. 4. Add 10 drops of iodine to each tube. This test does NOT require boiling. 5. Record the color of the tubes’ contents in the table below. Questions for Reflection 1. In the Benedict’s test, which of the solutions is a positive control? Which is a negative control? 2. Which is a reducing sugar, sucrose or glucose? 3. Which contains more reducing sugars, potato juice or onion juice? 4. Is there a difference between the storage of sugars in onions and potatoes? 5. Which patient sample likely comes from a diabetic patient and how do we know this? 6. In the Iodine test, which of the solutions is a positive control? Which is a negative control? 7. Which is more positive for the iodine test: onion juice or potato juice? 8. What can you infer about the storage of carbohydrates in onions? In potatoes? 9. Describe the half-reaction Cu2+Cu+ as oxidation or reduction. 10. Describe the half-reaction Cu+ →Cu as oxidation or reduction.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/02%3A_Chemistry/2.07%3A_Carbohydrates.txt

Structure of Lipids Lipids are the class of macromolecules that mostly serve as long-term energy storage. Additionally, they serve as signaling molecules, water sealant, structure, and insulation. Lipids are insoluble in polar solvents such as water and are soluble in nonpolar solvents such as ether and acetone. Fats or triglycerides are made of glycerol and three fatty acid chains. They form through 3 dehydration synthesis reactions between a hydroxyl of the glycerol and the carboxyl group of the fatty acid. Saturated versus Unsaturated Fats • A saturated fatty acid. The molecule takes up little space in three dimensions. Many molecules can stack upon each other. Saturated fats are solid at room temperature. • A polyunsaturated fatty acid. A kink from the double bond increases the amount of three-dimensional space that the molecule fills. Unsaturated fats tend to be liquid at room temperature. • A trans-fatty acid. Despite an unsaturated bond, the molecule fills as much space as a saturated fatty acid and is solid at room temperature. Trans fats usually arise from artificial saturation techniques. Butterfat is almost completely saturated. Notice how molecules can stack very closely. Because butterfat can stack together very closely, it is dense and found as a solid at room temperature. Credit: Steve Karg (CC BY 2.5) Testing for Lipids Tests for lipids are based on a lipid’s ability to selectively absorb pigments in fat-soluble dyes such as Oil Red O or Sudan IV. 2.09: Proteins Proteins are Polymers of Amino Acids Proteins provide much of the structural and functional capacity of cells. Proteins are composed of monomers called amino acids. Amino Acids are hydrocarbons that have an amino group (-NH2) and an acidic carboxyl group (-COOH). The R group represents a hydrocarbon chain with a modification that alters the properties of the amino acid. 20 universal amino acids are used to construct proteins. The variation in functional groups along the amino acid chain gives rise to the functional diversity of proteins. 20 amino acids and their properties. A 21st amino acid on this table represents the non-universally found selenocysteine. Monomers bond together through a dehydration synthesis reaction between adjacent amino and carboxyl groups to yield a peptide bond. Three amino acids bound into a tripeptide. How Amino Acids Interact with Each Other and the Environment Use the following simulation to test how a polypeptide chain with fold based on the type of solution it is in and the composition of the amino acids. Levels of Structure • Primary Structure (1°): The sequence of amino acids read from the Amino or N-terminal end of the molecule to the Carboxyl or C-terminal end • Tyr-Cys-Arg-Phe-Leu-Val-…. • Secondary Structure (2°): local three-dimensional structures that form from interactions of amino acids, like hydrogen bonding • Alpha Helix – coils occurring from the H-bonds between N-H and C=O groups along the backbone of the protein Side view of α-helix illustrating H-bonds in magenta between carboxyl oxygen (red) and amine nitrogen (blue) Top-down view of an α-helix Side view of ribbon diagram of α-helices traversing a membrane. • Beta Sheets – laterally connected strands or sheets of amino acids occurring from the H-bonds between N-H and C=O groups along the backbone of the protein Ribbon diagram of β-sheets • Tertiary Structure (3°): overall 3-D structure of the peptide chain • Quaternary Structure(4°): multimeric protein structure from assembling multiple peptide subunits Diversity of Proteins Learn more about the complexity of protein structures at the Protein Data Bank. Protein Detection (Activity) Protein Detection Theory: Proteins can be detected through the use of the Biuret test. Specifically, peptide bonds (C-N bonds) in proteins complex with Cu2+ in Biuret reagent and produce a violet color. A Cu2+ must complex with four to six peptide bonds to produce a color; therefore, free amino acids do not positively react. Long polypeptides (proteins) have many peptide bonds and produce a positive reaction to the reagent. Biuret reagent is an alkaline solution of 1% CuSO4, copper sulfate. The violet color is a positive test for the presence of protein, and the intensity of the color is proportional to the number of peptide bonds in the solution. Biuret Test 1. Examine the table below. Indicate if the sample is a negative control, positive control or an experimental. 2. Predict the color change of the solution. • Formulate a hypothesis about the components of the experimentals. 3. Obtain 6 test tubes and number them 1-6. 4. Add the materials listed in the table. 5. Add 3 drops of Biuret reagent (1.0% CuSO4 with NaOH) to each tube and mix. 6. Record the color of the tubes’ contents in Table. Conclusions about the Urine Samples Based on the results of the Benedict’s test and the Biuret test, can we make any conclusions?

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/02%3A_Chemistry/2.08%3A_Lipids.txt

Nucleic Acids Nucleic acids are composed of linked nucleotides. DNA includes the sugar, deoxyribose, combined with phosphate groups and combinations of thymine, cytosine, guanine, and adenine. RNA includes the sugar, ribose with phosphate groups and combinations of uracil, cytosine, guanine, and adenine. DNA and RNA are nucleic acids and make up the genetic instructions of an organism. Their monomers are called nucleotides, which are made up of individual subunits. Nucleotides consist of a 5-Carbon sugar (a pentose), a charged phosphate and a nitrogenous base (Adenine, Guanine, Thymine, Cytosine or Uracil). Each carbon of the pentose has a position designation from 1 through 5. One major difference between DNA and RNA is that DNA contains deoxyribose and RNA contains ribose. The discriminating feature between these pentoses is at the 2′ position where a hydroxyl group in ribose is substituted with a hydrogen. DNA has a double-helical structure. Two antiparallel strands are bound by hydrogen bonds. The following video illustrates the structure and properties of DNA. DNA is a double helical molecule. Two antiparallel strands are bound together by hydrogen bonds. Adenine forms 2 H-bonds with Thymine. Guanine forms 3 H-bonds with Cytosine. This AT & GC matching is referred to as complementarity. While the nitrogenous bases are found on the interior of the double helix (like rungs on a ladder), the repeating backbone of pentose sugar and phosphate form the backbone of the molecule. Notice that phosphate has a negative charge. This makes DNA and RNA, overall negatively charged. There are 10 bases for every complete turn in the double helix of DNA. Nucleic Acids: DNA Extraction and Dische’s Diphenylamine Test (Activity) Prelab Questions 1. What are fruits? 1. Where do they come from? 2. What are they made of? 2. Use phylogeny to classify plants (DKPCOFGS) 3. Where is DNA located within the fruits? Where is it located in you? 4. Why would you want to extract DNA from an organism? 5. What class of molecule is DNA? Extraction of DNA from fruit single panel instructions can be found at https://github.com/jeremyseto/bio-oer/blob/master/figures/chemistry/DNA/fruitdnaisolation.svg 1. Mash about 10g or 3cm of over-ripe banana OR 3 grapes OR 1 strawberry in zip-top bag. • Over-ripe banana is best since the cell walls are already decomposing • Physical mashing continues to break up the cell walls 2. Add 7ml of salt solution. • The salt solution helps the DNA to aggregate (clump together). 3. Add 7ml of liquid detergent and mix. • Dissolves the lipids in the cell and nuclear membranes • Releases DNA into the salt solution 4. Place a coffee filter over a cup or beaker and fasten with an elastic band. • Pour mash through the filter into a beaker 5. Pour about 5ml of filtrate into a test tube. 6. Slowly pour an EQUAL volume of cold ethanol down the side of the tube to form a layer on top of the fruit fluid. • Carefully run the alcohol down the side to form a separate layer on top of the fruit solution. • Do not mix the alcohol and banana solution. • Ice-cold 100% ethanol works best. 7. Spool the DNA: use a plastic loop or glass rod to gently swirl at the interface of the two solutions. • The interface is where the two solutions meet. • DNA is not soluble in alcohol. • Bubbles may form around a wooly substance (this is the DNA). 8. Transfer the DNA. Dische Diphenylamine Test For DNA DNA can be identified chemically with the Dische diphenylamine test. Acidic conditions convert deoxyribose to a molecule that binds with diphenylamine to form a blue complex. The intensity of the blue color is proportional to the concentration of DNA. The Dische’s Test will detect the deoxyribose of DNA and will not interact with the ribose in RNA. The amount of blue corresponds to the amount of DNA in solution. The diphenylamine compound of the Dische’s test interacts with the deoxyribose of DNA to yield a blue coloration. 1. Obtain 3 test tubes and number them 1-3. 2. Suspend the spooled DNA in 3 ml of distilled water. MIX. 3. Add to tubes: 1. 2 ml of DNA solution 2. 1 ml of DNA solution with 1 ml H2O 3. 2 ml of H2O 4. Add 2 ml of the Dische’s diphenylamine reagent to each tube and mix thoroughly. 5. Place in a boiling water bath for 10 minutes. 6. Evaluate your results. A clear tube indicates no nucleic acids. A blue color indicates the presence of DNA. A greenish color indicates the presence of RNA. 2.11: Biological Molecules (Concept) Macromolecules Concept Map Download the PDF. Summarizing Macromolecule Detection: A nutrition label illustrates the breakdown of chemical components of Macaroni and Cheese. This is not limited to the macromolecules discussed here. Items like Iron and Sodium are ions that are important for the function of the cell. Fill in the table below to illustrate how molecules in the above nutrition table were detected. What would you use as a Positive control? What would be the outcome of that Positive Control (color)? What about negative controls? Using the nutrition label above or a similar one, indicate what the test result would be if using the individual tests and indicate if that molecule is absent or present. Remember, if the sugars (simple reducing sugars) and the dietary fiber don’t add up to the total carbohydrates, the remainder is starch.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/02%3A_Chemistry/2.10%3A_Nucleic_Acids.txt

• 3.1: Introduction Light is a type of energy that travels as a wave-particle. The wavelength of light is the distances between peaks in the waves as light travels. Wavelengths are measured in nanometers (nm) and different wavelengths of light represent differing colors. Light of long wavelengths (infra-red) and very short wavelengths (ultraviolet) are invisible to humans but can be observed by other organisms. As the wavelength decreases, the energy of the light is increased. • 3.2: Enzymes In biological systems, energy is roughly defined as the capacity to do work. Molecules are held together by electrons. Breaking and building these bonds requires an input of energy. The energy needed to initiate such reactions is referred to as activation energy (EA). Catalysts are chemicals that take part in facilitating reactions by reducing the energy of activation. If the activation energy is reduced, the likelihood of a reaction occurring is greatly enhanced. • 3.3: Exploring Beer's Law (Virtual) In this lab, you will use a simulation where you can alter the properties involved in spectrophotometry and examine the Beer-Lambert Law. • 3.4: Quantitative Detection of Protein (Activity) Bovine Serum Albumin (BSA) is a protein that circulates in the blood of cows. Purified BSA can be used with Biuret solution in serial dilutions to generate a Standard Curve. The standard curve will illustrate the relationship between concentration (the dependent variable) and absorbance at 540 nm (the independent variable). We can then use this curve to estimate the concentration of unknown samples. In this lab, you will use a normal spectrophotometer to measure the absorbances at 540 nm. • 3.5: Quantitative Detection of Proteins (SpectroVis Plus) Bovine Serum Albumin (BSA) is a protein that circulates in the blood of cows. Purified BSA can be used with Biuret solution in serial dilutions to generate a Standard Curve. The standard curve will illustrate the relationship between concentration (the dependent variable) and absorbance at 540 nm (the independent variable).  We can then use this curve to estimate the concentration of unknown samples. In this lab, you will use a LabQuest spectrophotometer to measure the absorbances at 540 nm. • 3.6: Enzyme Kinetics (Activity) In this activity, you will examine how different factors, such as pH, temperature, and enzyme concentration, affect enzyme activity. • 3.7: Enzyme Kinetics with Spectrovis This exercise uses turnip extract as a source of peroxidase. This turnip extract requires a source of electrons (a reducing agent) in order for the reaction to occur. In this case, a colorless organic compound called guaiacol is used. Guaiacol is oxidized in the process of converting the peroxide and becomes brown. Enzymatic activity can then be traced using a spectrophotometer to measure the amount of brown being formed. 03: Quantitative Determinations Properties of Light Credit: Inductiveload, NASA (CC-BY-SA 3.0) Light is a type of energy that travels as a wave-particle. The wavelength of light is the distances between peaks in the waves as light travels. Wavelengths are measured in nanometers (nm) and different wavelengths of light represent differing colors. White light is a mixture of the visible light spectrum. Light of long wavelengths (infra-red) and very short wavelengths (ultraviolet) are invisible to humans but can be observed by other organisms. As the wavelength decreases, the energy of the light is increased. Diffraction of light through a prism exposes the components wavelengths of light. Spectrophotometry Spectrophotometers (spectro-image/color; photo-light; meter-measure) are used for chemical analysis of solutions based on properties of absorption or transmission. Schematic of a spectrophotometer. The monochromator is a prism that splits the light. A single wavelength of light is focused through the aperture to pass through the solution in the cuvette. GYassineMrabetTalk [CC-BY-SA]. Transmittance refers to the amount of light that passes through the solution. The transmittance of a light source through a cuvette. The intensity of light, I0, decreases as it passes through the solution. The light detected by the sensor, I, reflects the transmittance of the solution. If the light is being absorbed by chemicals in the solution, this results in a lower transmission. Absorbance is therefore inversely related to transmittance as expressed by the equation: Follow the virtual demonstration at http://www.virtual-labs.leeds.ac.uk/pres/spectrophotometry/ (CC-BY-NC-SA) for a more in-depth explanation of spectrophotometry. Beer’s Law Beer’s Law is a relationship between the concentration or amount of a dissolved substance in a solution that is reducing the amount of transmitted light due to the absorption of the radiant energy. Lambert’s Law states that the reduction of transmittance was related to the length of the path of light. As the light path increases through a substance, there is a reduction in transmittance. Collectively, these ideas are referred to as Beer-Lambert Law, but most observers will control the path length and simply refer to it as Beer’s Law.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/03%3A_Quantitative_Determinations/3.01%3A_Introduction.txt

Energy and Catalysts In biological systems, energy is roughly defined as the capacity to do work. Molecules are held together by electrons. Breaking and building these bonds requires an input of energy. The energy needed to initiate such reactions is referred to as activation energy (EA). Sometimes the necessary energy to initiate a reaction is so large that it greatly limits the likelihood of the reaction ever occurring. Catalysts are chemicals that take part in facilitating reactions by reducing the energy of activation. If the activation energy is reduced, the likelihood of a reaction occurring is greatly enhanced. In cells, the catalysts are often made of proteins and called enzymes. Reaction coordinate of an exothermic reaction with and without an enzyme. The enzyme reduced the EA to facilitate the likelihood that the reaction occurs. This catabolic reaction breaks complex things down, thus increasing entropy and releasing energy into the system. Enzymes Reactants in enzymatic reactions are called substrates. They have an imperfect fit to a binding domain of the enzyme called the active site. Substrate binding to this active site induces a change in the shape of the protein that coordinates the substrate into a transition state that will reduce the amount of EA required for the reaction to go to completion. The induced fit of the protein also aids in coordinating other cofactors or coenzymes that will aid in the reaction. Induced fit model of enzymes and substrates. The active site of the protein is an imperfect match for the substrate. Intermolecular interactions between the enzyme and substrate induce a new fit that facilitates the formation of a transition state and results in the catalysis of the reaction. The reaction follows the standard flow where the Enzyme (E) and the Substrate (S) interact to form an Enzyme-Substrate Complex (ES). The ES then dissociates into Enzyme and the resultant Product (P). E + S ⇒ ES ⇒ E + P The induced fit of the enzyme-substrate complex coordinates the transition state to facilitate the reaction. This induced fit occurs through non-covalent means that result in a tugging on the molecules (an application of energy) while molecules are coaxed into the reactions. Hexokinase enzyme interacts with an ATP and a hexose. These interactions alter slightly the structure of the enzyme (induced fit). This pulling on the enzyme and the substrates aids in catalyzing the reaction through coordinating the molecules, sometimes with the aid of cofactors and coenzymes. The yellow sphere represents the cofactor Mg2+. Coenzymes can be covalently linked to amino acid side chains of the enzyme and are also referred to as prosthetic groups. While prosthetic groups are organic in nature, they may also involve the coordination of metal ions, like the heme group which binds to iron. These prosthetic groups enhance the repertoire of the amino acids to provide additional functioning to the entire protein. Early coenzymes were described as being vital to normal functioning and were characterized as organic molecules with amine groups. Because of this coincidence, they were referred to as vitamins (for vital amines) though not all vitamins have amine groups. The trace metal ions that work with these groups are also required and represent the minerals on food items.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/03%3A_Quantitative_Determinations/3.02%3A_Enzymes.txt

Use the link below to launch a simulation where you can alter the properties involved in spectrophotometry and examine the Beer-Lambert Law. Increase and decrease the concentration slider in the simulation: 1. What happens to the contents in the cuvette? 2. How does this change the Transmittance and Absorbance readings? 3. Click “variable” and use the slider. What happens to the readings when the Wavelength of the laser is a similar color as the solution in the cuvette? 4. Consult the color star below and find the color wavelength that is opposite of the color of the solution. Set the laser to this color using “variable” and the slider. 1. What is the effect on Transmittance and Absorbance with this color? 2. Using the previous observations (using variable wavelength slider), how would you use the relationship on Transmittance/Absorbance to best measure the concentration of a solution? Click on image above to begin Beer’s Law Simulation 3.04: Quantitative Detection of Protein (Activity) Experimental Background Bovine Serum Albumin (BSA) is a protein that circulates in the blood of cows. Purified BSA can be used with Biuret solution in serial dilutions to generate a Standard Curve. The standard curve will illustrate the relationship between concentration (the dependent variable) and absorbance at 540 nm (the independent variable). We can then use this curve to estimate the concentration of unknown samples. 1. On a graph, do you remember which axis is the dependent and which is the independent variable? 2. In the table below, can you identify which samples are the negative controls and which are the positive controls? 3. What is the prediction of the absorbance or color intensity of the different tubes? Dilute BSA Standards 1. Label 9 tubes 1-9. 2. Combine the components of the table below to generate the appropriate concentration of solutions. 1. Place tube 1 (blank) into a cuvette and measure the absorbance (A) in the spectrophotometer at 540 nm. 2. Calibrate the spectrophotometer to read 0 at A540nm. 3. Sequentially read each sample at A540nm and record values in the table below. 1. Plot each BSA dilution in a spreadsheet program like Excel as a scatterplot. 2. Generate best-fit line for these standards with the equation of the line. 3. Use the equation of the line to estimate the concentration of the unknown sample. Curve Fitting Run the simulation below to understand how you can use the standard dilution series to estimate your sample concentrations. Click on the image above to begin simulation on curve fitting. Scatterplot Tutorial Use the tutorial below and watch at 1.25X to plot your own data. 3.05: Quantitative Detection of Proteins (SpectroVis Plus) Experimental Background Bovine Serum Albumin (BSA) is a protein that circulates in the blood of cows. Purified BSA can be used with Biuret solution in serial dilutions to generate a Standard Curve. The standard curve will illustrate the relationship between concentration (the dependent variable) and absorbance at 540 nm (the independent variable). We can then use this curve to estimate the concentration of unknown samples. 1. On a graph, do you remember which axis is the dependent and which is the independent variable? 2. In the table below, can you identify which samples are the negative controls and which are the positive controls? 3. What is the prediction of the absorbance or color intensity of the different tubes? Dilute BSA Standards 1. Label 9 tubes 1-9 2. Combine the components of the table below to generate the appropriate concentration of solutions 1. The instructor will begin to set-up the units for distribution. 1. Connect SpectroVis Plus to LabQuest2. 2. Power on. 3. Select the LabQuest App. 4. On the “Meter” tab, tap on Mode. 1. Change the mode to “Events with Entry“. 2. Enter the Name: Concentration. 3. Enter Units: mg/ml. 4. Select “OK”. 5. If a message appears about saving run, choose Discard. 6. Tap on the red area showing Absorbance to trigger menu items 1. Select “Change Wavelength“. 2. Enter 540. 7. Tap on the red area showing Absorbance to trigger menu items. 1. Select “Calibrate”. 2. Select “Warm Up”. 3. Select Finish Calibration. 2. Place tube 1 (0 mg/ml) into a cuvette for measuring the absorbance (A) in the SpectroVis Plus. • Tap on the file cabinet icon to store this data. 3. Sequentially read each sample at the stored wavelength (A540nm)and record values in the table below. 1. Plot each BSA dilution in plot.ly as a scatterplot (Log-on using Facebook/Google/Twitter credentials for free). 2. Generate best-fit line for these standards with the equation of the line. 3. Use the equation of the line to estimate the concentration of the unknown sample. Curve Fitting Run the simulation below to understand how you can use the standard dilution series to estimate your sample concentrations. Click on the image above to begin simulation on curve fitting. Scatterplot Tutorial You can watch this tutorial at 1.25X and pause when needed.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/03%3A_Quantitative_Determinations/3.03%3A_Exploring_Beer%27s_Law_%28Virtual%29.txt

The Enzyme Amylase is an enzyme that breaks down amylose (starch) into glucose molecules. 1. What test can be used to indicate the presence of Starch? 2. What parameters would influence the ability of the enzyme to facilitate the rate of the reaction? 3. What is the role of an enzyme in a chemical reaction and what is it made of? 4. What test can be used to indicate the presence of glucose? Salivary amylase is produced in the mouth, where digestion begins. Pancreatic amylase is produced in the pancreas and is supplied to the duodenum of the small intestines. Overlay of salivary (green) and pancreatic (teal) amylase molecules. Effect of Temperature on Enzyme Activity 1. Add 5 ml of H2O to a tube (this is the BLANK). 2. Add 5 ml of starch (substrate) to 3 separate tubes. • One on ice (0°C), one on the bench (25°C), and one in a 40°C water bath 3. Add 2 drops of iodine to each tube and mix: Blank, 0°C, 25°C, and 40°C. 4. Read the Blank in the spectrophotometer and calibrate it to 100% transmittance at 560nm. 5. Read each tube in the spectrophotometer. This is time 0 minute. 6. Add 35 drops of amylase solution to each tube simultaneously. Mix and ensure incubation is occurring at the correct temperature. 7. At 2 minute intervals, quickly read ALL tubes in the spectrophotometer and immediately return the tubes to the proper temperature. 8. Continue reading the samples every 2 minutes until you reach 22 minutes on the table below. Time (min) 0ºC % Trans 25ºC % Trans 40ºC % Trans 0 2 4 6 8 10 12 14 16 18 20 22 Effect of pH on Enzyme Activity 1. Add 5 ml of water to an empty tube (this is the BLANK) 2. To 3 separate tubes, add 2.5 ml of buffer pH 3, pH 5 or pH 7 1. Add 2.5 ml of starch (substrate) to each of these tubes (excluding BLANK) 3. Add 2 drops of iodine to each tube and mix: Blank, pH 3, pH 5, pH 7 4. Read the Blank in the spectrophotometer and calibrate it to 100% transmittance at 560nm 5. Read each tube in the spectrophotometer. This is time 0 min. 6. Add 35 drops of amylase solution to each tube simultaneously, mix to homogeneity. 7. At 2 minute intervals, quickly read ALL tubes in the spectrophotometer. 8. Continue reading the samples every 2 minutes until you reach 22 minutes on the table below. Time (min) pH 3 % Trans pH 5 % Trans pH 7 % Trans 0 2 4 6 8 10 12 14 16 18 20 22 Effect of Enzyme Concentration on Enzyme Activity 1. Add 5 ml of water to an empty tube (this is the BLANK) 2. Add 5 ml of pH 7 buffer to 3 separate tubes. 3. Follow the dilution scheme below: Dilution scheme for amylase (enzyme) 1. In 4 separate tubes, ADD 4 ml of starch solution. • Label them 1x, 1/5x, 1/25x, 1/125x 2. Add 2 drops of iodine to each starch tube and the Blank. 3. Read the Blank in the spectrophotometer and calibrate it to 100% transmittance at 560nm. 4. Read each tube in the spectrophotometer. This is time 0 minute. 5. Add 35 drops of diluted amylase solutions to the appropriately labeled tubes simultaneously and mix. • Each tube receives a different Amylase dilution. 6. At 2 minute intervals, quickly read ALL tubes in the spectrophotometer. 7. Continue reading the samples every 2 minutes until you reach 22 minutes on the table below. Time (min) 1 X % Trans 1/5 X % Trans 1/25 X % Trans 1/125 X % Trans 0 2 4 6 8 10 12 14 16 18 20 22 Effect of Substrate Concentration on Enzyme Activity 1. Add 5 ml of water to an empty tube (this is the BLANK) 2. Add 5 ml of pH 7 buffer to 3 separate tubes 3. Follow the dilution scheme below: 1. In 4 cuvettes, ADD 4 ml of the diluted starch solution. • Label them 1x, 1/2x, 1/4x, 1/8x. 2. Add 2 drops of iodine to each starch tube and the Blank. 3. Read the Blank in the spectrophotometer and calibrate it to 100% transmittance at 560nm. 4. Read each tube in the spectrophotometer. This is time 0 minute. 5. Add 35 drops of amylase solution to each tube simultaneously and mix. 6. At 2 minute intervals, quickly read ALL tubes in the spectrophotometer. 7. Continue reading the samples every 2 minutes until you reach 22 minutes on the table below. Time (min) 1 X % Trans 1/2 X % Trans 1/4 X % Trans 1/8 X % Trans 0 2 4 6 8 10 12 14 16 18 20 22 Plot the Results 1. Using a plot.ly, plot the data on the same chart. 2. Calculate the line of best fit of each dataset. 3. The slope represents the activity of the enzyme in each condition. What is the unit of this activity?

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/03%3A_Quantitative_Determinations/3.06%3A_Enzyme_Kinetics_%28Activity%29.txt

Enzyme Kinetics of Turnip Peroxidase Hydrogen peroxide (H2O2) is a strong oxidizing agent that can damage cells and is formed as a by-product of oxygen consumption. Fortunately, aerobic cells contain peroxidases that break down peroxide into water and oxygen. This enzyme reduces hydrogen peroxide into H2O by oxidizing an organic compound (AH2 -> A). This exercise uses turnip extract as a source of peroxidase. This turnip extract requires a source of electrons (a reducing agent) in order for the reaction to occur. In this case, a colorless organic compound called guaiacol is used. Guaiacol is oxidized in the process of converting the peroxide and becomes brown. The enzymatic activity can then be traced using a spectrophotometer to measure the amount of brown being formed. Set-up and Calibrate LabQuest with SpectroVis Plus 1. Set-up the cuvette to serve as a Blank. 1. Add 10 drops 0.02% hydrogen peroxide. 2. Add 5 drops 0.2% guaiacol. 3. Add 20 drops of pH 7 buffer. 4. Add 10 drops extraction buffered. 2. Connect a LabQuest2 to a SpectroVis plus and start the data collection program. 3. Calibrate the SpectroVis. 1. Change Mode. 1. Select “Time-Based” from the dropdown menu and press OK when done. • Rate: 0.5 samples/s • Interval: 2 s/sample • Duration: 200 s 2. Press the Play button (green arrow). 1. Perform Warm-up for 90 seconds. 1. Choose "Finish Calibration". 2. Press "OK". 2. Press the "Stop" button (Red Square). 4. Select “Meter Icon” (top left most of the display). 1. Press the large red area showing the current absorbance reading. 2. Choose “Change Wavelength”. 3. Set Wavelength to 500nm. Effect of pH on Peroxidase Activity 1. Set-up the cuvette for pH 3. 1. Add 10 drops 0.02% hydrogen peroxide. 2. Add 5 drops 0.2% guaiacol. 3. Add 20 drops of pH 3 buffer. 4. Add 10 drops turnip extraction last. 5. Quickly invert the cuvette and place the cuvette into the Spectrovis Plus. 6. Press play button to begin recording data (choose “discard data” if prompted). 1. After 200s, remove SpectroVis from USB. 2. Insert a USB flash drive and wait 1 minute. 3. Press File → Export → choose USB icon and rename the file and add “.csv” to the end of the file name. 4. Press OK. 2. Sequentially repeat the experiment exchanging the pH buffer with pH 5, 7, 10. Effect of Temperature on Peroxidase Activity 1. Set-up the cuvette for 0ºC 1. Add 10 drops 0.02% hydrogen peroxide (incubated at 0ºC for 10 minutes). 2. Add 5 drops 0.2% guaiacol. 3. Add 20 drops of extraction buffer at 0ºC. 4. Add 10 drops turnip extraction (incubated at 0ºC for 10 minutes) last. 5. Quickly invert the cuvette and place the cuvette into the Spectrovis Plus. 6. Press play button to begin recording data (choose “discard data” if prompted). 1. After 200s, remove SpectroVis from USB. 2. Insert a USB flash drive and wait 1 minute. 3. Press File → Export → choose USB icon and rename the file and add “.csv” to the end of the file name. 4. Press OK. 2. Sequentially repeat the experiment exchanging the buffers stored at 20ºC, 40ºC, 60ºC. Effect of Substrate Concentration on Peroxidase Activity 1. Set-up the cuvette for 1X substrate. 1. Add 10 drops 0.02% hydrogen peroxide. 2. Add 5 drops 0.2% guaiacol. 3. Add 20 drops of extraction buffer. 4. Add 10 drops turnip extraction last. 5. Quickly invert the cuvette and place the cuvette into the Spectrovis Plus. 6. Press play button to begin recording data (choose “discard data” if prompted). 1. After 200s, remove SpectroVis from USB. 2. Insert a USB flash drive and wait 1 minute. 3. Press File → Export → choose USB icon and rename the file and add “.csv” to the end of the file name. 4. Press OK. 2. Sequentially repeat the experiment with different amounts of buffer and peroxide: 1. Repeat the experiment with 0.2X substrate and export data to a USB drive. 2. Repeat the experiment with 2X substrate and export data to a USB drive. 3. Repeat the experiment with 3X substrate and export data to a USB drive. Effect of Enzyme Concentration on Peroxidase Activity 1. Set-up the cuvette for 1X enzyme. 1. Add 10 drops 0.02% hydrogen peroxide. 2. Add 5 drops 0.2% guaiacol. 3. Add 20 drops of extraction buffer. 4. Add 10 drops turnip extraction last. 5. Quickly invert the cuvette and place the cuvette into the Spectrovis Plus. 6. Press play button to begin recording data (choose “discard data” if prompted). 1. After 200s, remove SpectroVis from USB. 2. Insert a USB flash drive and wait 1 minute. 3. Press File → Export → choose USB icon and rename the file and add “.csv” to the end of the file name. 4. Press OK. 2. Sequentially repeat the experiment with different amounts of buffer and extract: 1. Perform the experiment on 1X enzyme and export data to a USB drive. 2. Repeat the experiment with 0.2X enzyme and export data to a USB drive. 3. Repeat the experiment with 2X enzyme and export data to a USB drive. 4. Repeat the experiment with 3X enzyme and export data to a USB drive.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/03%3A_Quantitative_Determinations/3.07%3A_Enzyme_Kinetics_with_Spectrovis.txt

• 4.1: Introduction The cell membrane is the barrier that separates the cytoplasm from the external world. The cell membrane consists primarily of phospholipids in a bilayer. Phospholipids are amphipathic with a polar head (phosphate group) and a hydrophobic tail (2 hydrocarbon chains). Due to the chemical properties of the heads being attracted to water and the tails having a desire to avoid water, phospholipids self-assemble into micelles. • 4.2: Why Are Cells Small? (Activity) In this lab, you will perform a simulation using agar cubes (representing cells) and figure out why cells are generally extremely small. • 4.3: Do Larger Things Diffuse Faster? (Activity) Agar is a gelatinous substance derived from a structural carbohydrate found in seaweed. It is often used in cooking as a vegetarian alternative to gelatin and can be used as a thickener. Altering the amount of fluid solution will change the pores between fibers. More fluid will create a looser gel that has larger spaces between molecules. Reducing the fluid solution volume will conversely create a stiffer gel with smaller spaces between fibers. • 4.4: Gummy Bears- Tonicity (Activity) We’re all familiar with gelatin (Jello!). Gummy candies are made of gelatin. Gelatin is a protein that exists as long fibers. When gelatin is dissolved in a liquid and cooled, the gelatin fibers tangle together in a mesh-like network. Gummy candies are considerably more firm than the gelatin molds we have as desserts because they contain a lot less fluid. Like a cell, a gummy candy placed in solution will be affected by the properties of osmosis when submerged in different solutions. • 4.5: Observing Osmosis (Activity) In this lab, you will hypothesize and observe what happens when bags filled with different concentrations of sucrose is placed in beakers with different concentrations of sucrose. • 4.6: Agar Cubes (Preparation) In this page, you will find instructions on how to prepare the Agar Cube used in the "Why Are Cells Small" activity. 04: Osmosis and Diffusion Understanding Membranes The cell membrane is the barrier that separates the cytoplasm from the external world. The cell membrane consists primarily of phospholipids in a bilayer. Phospholipids are amphipathic with a polar head (phosphate group) and a hydrophobic tail (2 hydrocarbon chains). Due to the chemical properties of the heads being attracted to water and the tails having a desire to avoid water, phospholipids self-assemble into micelles. Cell membranes form from a phospholipid bilayer where the lipid tails interact with each other and the phosphate heads face the external water environment or the internal cytoplasm of the cell. The cell membrane does not solely consist of phospholipids but also have proteins and cholesterol inserted into the bilayer. As the image of the bilayer above indicates, the molecules are constantly moving and flow in a lateral motion. Cholesterol modulates the fluidity of this motion. Proteins associated with the membrane may sit on either side (peripheral proteins) of the membrane or pass through both layers of the membrane (transmembrane proteins). The model that describes the components of the cellular membrane is referred to as the Fluid Mosaic Model. This model states that the cell membrane is a mosaic of 1) Phospholipids 2) Proteins 3) Cholesterol that moves about in a side to side motion. The fluid mosaic of phospholipids, proteins, and cholesterol that create the selective barrier between the interior and the exterior of the cell. Small uncharged molecules pass through the double layer of phospholipids. Polar, charged or large molecules have great difficulty passing through the membrane and require the aid of transmembrane proteins. An example of a transmembrane protein that facilitates the movement of a polar substance is aquaporin, which permits the free movement of water. Diffusion Diffusion is the net movement of a substance from high concentration to low concentration. This difference in concentration is referred to as a concentration gradient. This movement does not require any external energy but uses the free energy intrinsic to the system. • Temperature Effects on Diffusion • Molecular Mass Effects on Diffusion Concentrated dye diffuses along the concentration gradient until reaching equilibrium (no net movement). Osmosis Osmosis is a special case of diffusion. Instead of observing the net change in solute, osmosis follows the net movement of a solvent across a semipermeable membrane. Since a semi-permeable membrane permits specific things to pass through, some solutes are partitioned. A semi-permeable membrane allows the solvent to pass but not this red salt molecule. The water moves along the concentration gradient (of water) . This movement of water causes an osmotic pressure. A cell lacking a cell wall is affected greatly by the tonicity of the environment. In a hypertonic solution where the concentration of dissolved solute is high, water will be drawn out of the cell. In a hypotonic solution where the concentration of dissolved solute is lower than the interior of the cell, the cell will be under great osmotic pressure from the environmental water moving in and can rupture. Plants have rigid cell walls composed of cellulose. These cell walls permit for maintenance of cellular integrity when the external environment is hypotonic (less dissolved substances). In this situation, the water moves into the cell. Without the cell wall, the cell would burst open from the excessive water pressure entering the cell. This state of swelling is referred to as turgid, resulting from turgor pressure. Cell walls of a plant retain the shape of the cell despite the state of external tonicity. When the exterior environment is hypertonic (greater amount of dissolved substances), the reverse condition occurs whereby the cellular fluid exiting the cell reduces the size of the cytoplasm. This condition is referred to as plasmolysis.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/04%3A_Osmosis_and_Diffusion/4.01%3A_Introduction.txt

Introduction 1. Take 3 blocks of agar of different size (1cm, 2cm, 3cm) → these are our cell models. 2. Measure the length, width, and height of each cube using a ruler. 3. Calculate the area of each face of the cubes and add all the areas together for a single cube. • A cube has 6 faces → the total surface area is the same as the area of one side multiplied by 6. 1. Calculate the volume of each cube. 2. Report the surface area-to-volume in the table below. Data Table: Calculating Surface Area-to-Volume Ratio Cell Model (Cube) Length Width Height Total Surface Area Volume of cell Surface Area: Volume 1 2 3 Stop and Think • Which cube has the greatest surface area:volume ratio? • Which cube has the smallest surface area:volume ratio? • Hypothesize: In an osmosis or diffusion experiment, which cube size would have the greatest diffusion rate? Procedures 1. Each group will acquire three agar cubes: A 3cm cube, a 2cm cube, and a 1cm cube. CUT AS ACCURATELY AS POSSIBLE. (This may be already completed for you.) 2. Place cubes into a beaker and submerge with 200 ml NaOH. 3. Let the cubes soak for approximately 10 minutes. 4. Periodically, gently stir the solution, or turn the cubes over. 5. After 10 minutes, remove the NaOH solution. 6. Blot the cubes with a paper towel. 7. Promptly cut each cube in half and measure the depth to which the pink color has penetrated. Sketch each block’s cross-section. 8. Record the volume that has remained white in color. 9. Do the following calculations for each cube and complete the following data table: Data Table: Calculation of Diffusion Area-to-Volume Cube Size Cube volume (cm3) (Vtotal) Volume white (cm3) (Vwhite) Sketch of each Cube Volume of the diffused cube ( Vtotal – Vwhite ) = (Vdiffused) Percent Diffusion (Vdiffused/Vtotal) Surface Area: Volume (from the previous table) 1 cm. 2 cm. 3 cm. Conclude 1. Which cube had the greatest percentage of diffusion? 2. Did this meet your expectations with your hypothesis? 3. If you designed a large cell, would it be a large sphere or something long and flat? 4.03: Do Larger Things Diffuse Faster (Activity) Introduction Agar is a gelatinous substance derived from a structural carbohydrate found in seaweed. It is often used in cooking as a vegetarian alternative to gelatin and can be used as a thickener. Microbiologists pour plates of agar containing nutrients in order to isolate and grow bacteria and other microbes. As with gelatin, the long fibery nature of this structural carbohydrate permits it to be melted and tangled together in a mesh-like network where the spaces between molecules are filled with solution. Altering the amount of fluid solution will change the pores between fibers. More fluid will create a looser gel that has larger spaces between molecules. Reducing the fluid solution volume will conversely create a stiffer gel with smaller spaces between fibers. 1. Take 2 tubes of agar and a solution of Malachite green (365 g/mole) and a solution of Potassium permanganate (164 g/mole). 2. Mark the top of the agar on the outside of the tube (the starting point). 3. Add 10 drops of malachite green to one tube and 10 drops of Potassium permanganate to the other. 4. Take note of the time. 5. At 20 minute intervals, measure the distance from the top that the agar has moved. Do this for at least 1 hour. 6. Plot the data and compare the trends. Describe the rate of diffusion for each. Stop and Think • Hypothesize which solution will move faster through the agar and provide a reason. DIFFUSION SPEED OF DYE MOLECULES DYE MOLECULAR WEIGHT HYPOTHESIS (FAST OR SLOW DIFFUSION) Malachite Green 365 g/mole Potassium Permanganate 164 g/mole Conclude • Which solution actually moved faster?_____________________________________________________________________________________________________________ • Did this meet your expectations?_________________________________________________________________________________________________________________ • Propose a reason why a certain dye moved faster.___________________________________________________________________________________________________ • Review through simulation

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/04%3A_Osmosis_and_Diffusion/4.02%3A_Why_Are_Cells_Small_%28Activity%29.txt

Introduction We’re all familiar with gelatin (like the Jello brand). Gummy candies are made of gelatin. Gelatin is a protein that exists as long fibers. When gelatin is dissolved in a liquid and cooled, the gelatin fibers tangle together in a mesh-like network. The space in between the gelatin molecules is filled with the fluid it was dissolved in. Gummy candies are considerably more firm than the gelatin molds we have as desserts because they contain a lot less fluid. Nonetheless, gummy candies are filled with a sugary solution with coloring. Like a cell, a gummy candy placed in solution will be affected by the properties of osmosis when submerged in different solutions. Stop and Think • Is distilled water hypertonic, hypotonic, or isotonic compared to the sugar solution inside a gummy candy? • Based on your answer, hypothesize if a gummy candy submerged in distilled water or 40% salt solution will swell faster? Label the diagram below with your hypothesis. Procedures 1. Obtain 2 gummy bears and place them in 2 different small flasks. 2. Drown 1 bear in distilled water and drown the other in 40% salt solution. 3. At the end of the lab session, remove the bears from the solution and document the size difference with your mobile phone. Hypothesized swelling of the bear based on tonicity Condition Tonicity Inside Bear Relative to the Solution Tonicity Outside relative to the Bear Hypothesis about swelling A B 4.05: Observing Osmosis (Activity) Observe Osmosis Along A Free Energy Gradient 1. Obtain four pieces of water-soaked dialysis tubing 15 cm long and eight pieces of string. Seal one end of each tube by tying it into a knot. 2. Open the other end of the tube by rolling it between your thumb and finger. 1. Write A, B, C, D on 4 pieces of paper. 2. Insert the labels into individual bags. 3. Fill the bags with the contents shown in the figure below with 10 ml of solution. 1. Bag A 10 ml 1% Sucrose 2. Bag B 10 ml 1% Sucrose 3. Bag C 10 ml 25% Sucrose 4. Bag D 10 ml 50% Sucrose 4. For each bag, loosely fold the open end and press on the sides to push the fluid up slightly and remove most of the air bubbles. Tie the folded ends securely, rinse the bags, and check for leaks. 5. Blot excess water from the outside of the bags and weigh each bag to the nearest 0.1 gram. 6. Record the weights in Data Table 1: Weight of Dialysis Bags. 7. Place bags B, C, and D in a beaker or large bowl filled with 1% sucrose. Record the time. 8. Place bag A in an empty beaker and fill the beaker with just enough 50% sucrose to cover the bag. Record the time. 9. Remove the bags from the beakers at 10-minute intervals for the next hour, blot them dry, and weigh them to the nearest 0.1 g. Handle the bags delicately to avoid leaks, and quickly return the bags to their respective containers. For each 10-minute interval record the total weight of each bag and its contents in Data Table 1. Then calculate and record in Data table 2: Change in Weight of Dialysis Bags the change in weight from the initial weight. Stop and Think • Define the tonicity of the solution inside the bag relative to the outside • Based on your definitions, hypothesize the direction the solution will move (in or out of the bag) and fill in the table below Hypothesized Movement of Solution based on Tonicity Bag Tonicity Inside Bag Relative to the Solution Tonicity of Outside Solution relative to the Bag Hypothesized solution movement (in, out, none) A B C D Present Your Data • Plot your data using only the Change in Weight. (subtract the Initial Weight at 0 minutes from the Total Weight at each time point) • Using a computer, create a scatter plot of the data from Table 2 and calculate the equation of the line • Change in Weight = Total Weight(current_time) – Initial Weight(time_0) Conclude • Did your results match your hypotheses?__________________________________________________________________________________________________________ • What do the slopes of the lines generated from plotting Change Weight indicate to you?____________________________________________________________________ • Can you analyze and articulate in words what has occurred with respect to these slopes?___________________________________________________________________ ___________________________________________________________________________________________________________________________________________ ___________________________________________________________________________________________________________________________________________ ___________________________________________________________________________________________________________________________________________ 4.06: Agar Cubes (Preparation) Procedures 1. Prepare a 2% solution of agar. • Mix 20 g of agar with 1 L of distilled water. 2. Heat almost to a boil. Stir frequently until the solution is clear. 3. Remove from heat and add 10 mL of 1% phenolphthalein solution. • 1 g phenolphthalein in 100 mL 95% ethanol (If pink, titrate with HCl until clear.) 4. Pour agar into a shallow tray to a depth of 3 cm and allow it to set (overnight). Silicone Ice-cube trays can be used. It is difficult to find them in the appropriate metric measurements. 3 cm cubes are approximately 1.2 inches and there are molds for this.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/04%3A_Osmosis_and_Diffusion/4.04%3A_Gummy_Bears-_Tonicity_%28Activity%29.txt

• 5.1: Introduction Energy is stored in the bonds of the carbohydrates. Breaking these bonds releases that energy. Crushing sugar crystals creates tiny electrical fields that give off invisible ultraviolet light. The wintergreen chemical (methyl salicylate) gets excited by these excited electrons and fluoresces in a visible blue wavelength. This phenomenon is called triboluminescence. • 5.2: Fermentation Yeasts are single-celled fungi. The species called Saccharomyces cerevisiae is commonly called Baker’s or Brewer’s yeast. Like other eukaryotes with mitochondria, yeast can use oxygen to generate ATP in the process of oxidative phosphorylation. These yeast are facultative aerobes which means they can also switch to an anaerobic mechanism of ATP production called fermentation. • 5.3: Cell Respiration (Concept) This page contains a concept map regarding cellular respiration. 05: Cellular Respiration Glucose is the preferred carbohydrate of cells. In solution, it can change from a linear chain to a ring. Energy is stored in the bonds of the carbohydrates. Breaking these bonds releases that energy. Crushing sugar crystals creates tiny electrical fields that give off invisible ultraviolet light. The wintergreen chemical (methyl salicylate) gets excited by these excited electrons and fluoresces in a visible blue wavelength. This phenomenon is called triboluminescence. Glycolysis Glucose is the preferred carbohydrate of cells. Glycolysis (glyco – sugar; lysis – splitting) is a universal process of all cells that occurs in the cytosol whereby the glucose (a 6-carbon sugar) is split into two pyruvates (a 3-carbon molecule) molecules to generate ATP and reduced NADH. ATP (adenosine triphosphate) is the energy currency of the cell that stores chemical energy in 3 high energy phosphate bonds. NADH (reduced nicotinamide adenine dinucleotide) is a high energy electron carrier that acts as a coenzyme in reactions and as a rechargeable battery of sorts. The uncharged state that is not carrying high energy electrons is called NAD+. Glycolysis is the splitting of glucose into 2 pyruvate molecules to generate 2 NADH and 2ATP molecules. ATP contains 3 high energy phosphates and acts as cellular energy currency. NADH is the reduced form of NAD+. The High energy electrons associated with the reduced form come with a Hydrogen atom. Fermentation In the absence of oxygen, cells may decide to utilize the pyruvate from glycolysis to rapidly generate additional ATP molecules in a process called fermentation. Fermentation is the anaerobic process of reducing pyruvate to generate ATP. This process uses the NADH generated from glycolysis as the reducing agents. Fermentation is a familiar process that occurs in yeast to generate ethanol. In other organisms, like humans, fermentation results in the production of lactic acid. Both lactic acid and ethanol are toxic, but this aids the cells in generating ATP when energy is required rapidly. Fermentation also generates CO2 as a waste molecule as pyruvate is broken down into a 2-carbon compound. Fermentation in yeast generates ATP in the absence of oxygen but yields little ATP at the cost of the reduced NADH. Credit: Davidcarmack (CC-BY-SA) The Preparatory Reaction In the presence of O2, aerobic organisms will use a reaction of pyruvate decarboxylation in the cytosol. This reaction generates a molecule of Acetyl-CoA from the Coenzyme A which can enter the mitochondria. Coenzyme A (CoA) is charged with an Acetyl group (2 carbon compound) to generate Acetyl-CoA and a CO2. When there is an excess of carbohydrates, the Acetyl-CoA is used as a starting point for long-term energy storage in lipid synthesis. Mitochondria Mitochondria are the power station of eukaryotic cells. They are derived from a process described by the endosymbiotic theory whereby aerobic prokaryotes were engulfed by a proto-eukaryote. In this mutualistic arrangement, the prokaryote detoxified the deadly O2 gas in the environment and used it to fully break down glucose to yield many ATP molecules. Evidence for this theory comes from the independent replication of the mitochondria, the bacterial-like mitochondrial DNA, the bacterial-like mitochondrial ribosomes, the bacterial lipids found in the inner membrane and the eukaryotic nature of the outer membrane. Mitochondria are genomically similar to bacteria of the order Rickettsiales. Some bacteria of this order are still free-living and some are intracellular pathogens. Credit: Kelvinsong (CC-BY-SA 3.0) Aerobic Respiration Cellular Respiration. Left side is glycolysis (anaerobic). The Right side is what occurs in the presence of oxygen in eukaryotes. The aerobic reactions occur inside the mitochondria after being fed Acetyl-CoA molecules from the cytoplasmic preparatory reaction. Credit: RegisFrey (CC-BY-SA 3.0) Acetyl-CoA enters the mitochondrial matrix where it is used in the Krebs Cycle (aka Tricarboxylic acid cycle (TCA), aka Citric acid cycle). For each pyruvate, there are 2 turns of the cycle where additional NADH and another high energy electron carrier FADH2 (flavin adenine dinucleotide) are generated. The electrons stored by NADH and FADH2 are transferred to proteins called cytochromes that have metal centers for conducting these electrons. In the process of moving these electrons, the cytochromes in this Electron Transport Chains (ETC) power the movement of protons into the intermembrane space. The terminus of these electrons is an O2 molecule that is reduced into 1/2 H2O molecules. This apparent movement of water molecules from the chemical synthesis is termed chemiosmosis. A channel in the membrane called ATP synthase acts as a gateway for the H+ back into the matrix, but use this motion to convert ADP into ATP. Closeup of the Electron Transport Chain (ETC) that takes place on the inner membrane of mitochondria. This is where oxygen is utilized as the final electron acceptor. Reduction of 1/2 O2 results in the generation of a water molecule (chemiosmosis). Credit: Jeremy Seto (CC-BY-NC-SA 3.0) Metabolic Pool The catabolic pathways involved in the glycolysis and the Krebs cycle constitute the metabolic pool that supplies building blocks for other anabolic reactions in the cell. An excess of carbohydrates can result in an accumulation of Acetyl-CoA molecules. If there is a great excess of Acetyl-CoA, the acetyl groups can be committed to fatty acid synthesis for long-term energy storage. Glycolytic products can also be the starting point for amino acid synthesis. 3-phosphoglycerate can be used to synthesize glycine, cysteine and serine. Pyruvate can be used to generate alanine, valine, and leucine. Oxaloacetate from the Krebs cycle can be used as a starting point for aspartate, lysine, asparagine, methionine, threonine, and isoleucine. Glutamate and glutamine are synthesized from α-ketoglutarate formed during the Krebs cycle. While most of the 20 amino acids can be synthesized de novo, there are 9 essential amino acids in humans that can not be synthesized in sufficient quantity and therefore must be gained from the diet. These essential amino acids include histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine. 5.02: Fermentation Introduction Yeasts are single-celled fungi. The species called Saccharomyces cerevisiae is commonly called Baker’s or Brewer’s yeast. Like other eukaryotes with mitochondria, yeast can use oxygen to generate ATP in the process of oxidative phosphorylation. These yeast are facultative aerobes which means they can also switch to an anaerobic mechanism of ATP production called fermentation. In all organisms, the process of glycolysis occurs anaerobically in the cytoplasm to produce two pyruvate molecules from a single glucose. This process produces 2 new ATP molecules and reduced nicotinamide adenine dinucleotide (NADH). In ethanol fermentation. One glucose molecule breaks down into two pyruvates via glycolysis (1). The energy from these exothermic reactions is used to bind inorganic phosphates to ADP and convert NAD+ to NADH. The two pyruvates are then broken down into two Acetaldehyde and give off two CO2 as a waste product (2). The two Acetaldehydes are then reduced to two ethanol, and NADH is oxidized back into NAD+ (3). Fermentation is an anaerobic process that occurs in the cytoplasm and quickly generates an additional ATP through the reduction of pyruvate. NADH is the source of electrons in this process that is oxidized to NAD+. Many organisms will ferment to generate lactic acid and CO2 from the pyruvate in order to generate ATP. Yeast fermentation produces ethanol. Fermentation Set-up 1. Mix the solutions in the table below in a fermentation tube. 2. Eliminate the air bubble in the sealed end of the fermentation tube. 3. Place rubber stopper into the open end of the fermentation tube and place at the appropriate temperature for an hour. 4. Predict the amount of CO2 generated in the last column of the table using +, – or +++. • After an hour, measure the headspace created by the bubbles and compare with your predictions. TUBE YEAST SUGAR ADDITIVE TEMP. CO2 generation 1 10 ml yeast None 20 ml H2O 25°C 2 10 ml yeast 10 ml glucose 10 ml H2O 25°C 3 10 ml yeast 10 ml glucose 10 ml H2O 37°C 4 10 ml yeast 10 ml lactose 10 ml H2O 37°C 5 10 ml yeast 10 ml sucrose 10 ml H2O 37°C 6 10 ml yeast 10 ml maltose 10 ml H2O 37°C 7 10 ml yeast 10 ml glucose 10 ml 0.1M MgSO4 37°C 8 10 ml yeast 10 ml glucose 10 ml 0.1 M NaF 37°C 9 10 ml yeast 10 ml lactose 10 ml H2O + LactAid pill 37°C Questions to Direct Hypothesis Formation 1. What is the preferred energy source of all cells? 2. What types of sugars are being used in each tube (monosaccharide, disaccharide, etc)? 3. What effect should temperature have on the fermentation reactions? 4. What does CO2 indicate in these tubes? 5. What do you think the additives do? What effect will they have? 5.03: Cell Respiration (Concept) Cellular Respiration concept map.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/05%3A_Cellular_Respiration/5.01%3A_Introduction.txt

• 6.1: Introduction Chloroplasts arose through a second endosymbiotic event in plants and various protists. These light-harvesting organelles share a similarity in structure and genome to photoautotrophic cyanobacteria. The thylakoid membranes of chloroplasts and cyanobacteria provide additional surface area for energy capture of light to occur. The light-dependent reactions in chloroplasts utilize two protein complexes referred to as Photosystem I (PSI) and Photosystem II (PSII) located on the thylakoid membranes. • 6.2: Photosynthetic Pigments In this page, you will find instructions on how to extract and separate photosynthetic pigments as well as some questions to consider when performing chromatography analysis. • 6.3: Absorbance Spectra of Photosynthetic Pigments Visible light wavelengths (between 400nm-700nm) are strongly absorbed by the pigments in leaves. These pigments utilize the energy of these wavelengths to take part in the light reactions. The cellular structure of leaves does not absorb wavelengths longer than these wavelengths (>700nm in the infra-red range). By comparing the amount of visible light to the amount of near infra-red lights that are reflected, one can gauge the relative health of leaves, forests, or jungles. • 6.4: Photosynthesis (Concept) This page contains the link to the 'Exploring Light' simulation and a concept map regarding photosynthesis. 06: Photosynthesis Chloroplasts Credit: elvinsong [CC-BY-SA 3.0] Chloroplasts arose through a second endosymbiotic event in plants and various protists. These light-harvesting organelles share a similarity in structure and genome to photoautotrophic cyanobacteria. Light-Harvesting The thylakoid membranes of chloroplasts and cyanobacteria provide additional surface area for energy capture of light to occur. The light-dependent reactions in chloroplasts utilize two protein complexes referred to as Photosystem I (PSI) and Photosystem II (PSII) located on the thylakoid membranes. At the center of each photosystem complexes are photopigments optimized to absorb specific wavelengths of light. When light is absorbed in a photosystem, an electron is excited and transferred to the electron transport chain. In PSII, the electron is regenerated by splitting of two water molecules into 4H+ + 4e + O2. As the electrons move through the ETC, protons are pumped into the thylakoid space. The ETC leads to the reduction of a high energy electron carrier NADP+ to NADPH. Since this pathway uses consumes water in a chemical reaction, the apparent loss of water in the thylakoid space is referred to as chemiosmosis. PSI is also known as the cyclic pathway since the excited electron runs through a closed circuit of the ETC to regenerate the lost electron. This closed circuit also generates a proton gradient through powering of a proton pump but does not lead to the reduction of NADPH. As with the ETC-powered proton pump in mitochondria, the proton gradient is used to power ATP-synthase in producing ATP molecules. Light Independent Reactions Credit: Mike Jones [CC-BY-SA 3.0] The light-independent reactions are also known as the dark reactions or Calvin Cycle and utilize the ATP and NADPH from the light-dependent reactions to fix gaseous CO2 into carbohydrate backbones. Photosynthesis is often simplified into 6CO2 + 6H2O + light –> C6H12O6 + 6O2 . However, the true product is 3-phosphoglycerate that can be used to generate longer carbohydrates like glucose. The starting point of carbon fixation is the carbohydrate Ribulose 1,5-bisphosphate. The enzyme Ribulose Bisphosphate Carboxylase (RuBisCO) captures a CO2 molecule onto Ribulose 1,5-bisphosphate to generate 2 molecules of 3-phosphoglycerate which can enter the process of gluconeogenesis to generate glucose. ATP from the light reactions can then facilitate the conversion of 3-phosphoglycerate to 1,3 bisphosphoglycerate which can be reduced by NADPH to glyceraldehyde-3-phosphate (G3P). G3P can then be used to regenerate Ribulose 1,5-bisphosphate. 1: Carbon fixation by RuBisCO 2: Reduction by NADPH 3: Ribulose, 5-bisphosphate regeneration The Great Oxygenation Event Two estimates of the evolution of atmospheric O2. The upper red and lower green lines represent the range of the estimates. Stage 1 (3.85–2.45 Ga) represents the primordial reducing atmosphere. Stage 2 (2.45–1.85 Ga) coincides with the emergence of oceanic cyanobacteria where O2 was being absorbed by the oceans and sediment. O2 escaped the oceans during Stage 3 (1.85–0.85 Ga). O2sinks filled in Stage 4 (0.85–0.54 Ga ) and Stage 5 (0.54 Ga–present) leading to atmospheric accumulation. Banded iron formations in 2.1 billion-year-old rock illustrate the oxidation of dissolved oceanic iron that precipitated in response to accumulating O2 concentrations. The Carbon Cycle illustrates carbon sequestration and release between various carbon sinks. Projection of atmospheric CO2 accumulation without reduction of fossil fuel reduction by NASA.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/06%3A_Photosynthesis/6.01%3A_Introduction.txt

Extract and Separate the Pigments 1. Lay a strip of filter paper on the bench. 2. About 2 cm from the bottom of the strip, place a fresh spinach leaf and rub a coin across the leaf to transfer pigment to the strip. 3. The instructor will be provided with a spoonful of Spirulina powder that has been soaked in 10ml acetone overnight. • On a separate strip, the instructor will apply the Spirulina extract approximately 2cm from the bottom of the strip. 4. Suspend the strips by a dowel or paper clip in a tube with about 3ml chromatography solution (2 isooctane: 1 acetone: 1 diethyl ether). 5. Develop the strips until the solvent reaches about 2 cm from the top. Chromatography Analysis 1. How many different pigments separate from the spinach extract? From the spirulina? 2. Are all pigments represented between the two extracts? 3. The mobile phase is non-polar. What are the properties of each pigment? 4. Measure the Rf of each pigment. 6.03: Absorbance Spectra of Photosynthetic Pigments Prelab Exercise 1. Fill the Color field in the table below 2. Use plot.ly to create a line graph with the 3 samples below (A, B, C) • Plot % Reflectance on the Y-axis and Wavelength (nm) on the X-axis % Reflectance Color nm A B C 400 68 92 78 425 40 71 77 450 90 38 51 475 97 49 57 500 100 92 45 525 100 100 66 550 96 97 100 575 98 96 100 600 96 98 100 625 97 80 100 650 79 71 100 675 56 96 100 700 88 100 100 Stop and Think: Reflectance A sign of plant health is viewed through the near infra-red. While we cannot see this spectrum of light with our eyes, we can use other sensors to detect this light. Compare the images of the Black & White with the Infra-red image. What differences can you see in the 2 images that will help you understand how this is a useful measure of plant health? How do you think this corresponds to the table above? The English Garden The English Garden (black & white) The English Garden (near infra-red) Visible light wavelengths (between 400nm-700nm) are strongly absorbed by the pigments in leaves (Chlorophylls, Xanthophylls, and Carotenoids). These pigments utilize the energy of these wavelengths to take part in the light reactions. The cellular structure of leaves does not absorb wavelengths longer than these wavelengths (>700nm in the infra-red range). By comparing the amount of visible light to the amount of near infra-red lights that are reflected, one can gauge the relative health of leaves, forests, or jungles. This is the rough description of the Normalized Differential Vegetation Index (NDVI) that scientists use in conjunction with satellite imagery to assess the health of vegetation. The Role of Light in Carbohydrate Synthesis 1. Pick a leaf from a geranium exposed to light and one kept in the dark for 48 hours. • Keep the stem on the leaf grown in the light. • Remove the stem from the leaf grown in the dark. 2. Hydrolyze the cell walls of the geranium leaves by boiling in a water bath for 5 minutes or until it looks like over-cooked vegetables). 3. Bleach the leaves by removing the pigments. Place the leaves in hot alcohol for 7 minutes or until they turn white. 1. Save this green solution for Absorbance Spectrum exercise. 4. Remove the leaves and place it in a petri dish. 5. Add iodine to the dish. If starch is present, the leaf will turn a deep bluish-black color. 6. Photograph the leaf with your phone to document the effects of light on carbohydrate storage. Measuring the Absorbance 1. Connect the Spectrovis to the LabQuest2. 2. Turn on the Labquest2 units. 3. Choose the Labquest app. 4. Select the icon that looks like X|Y. 5. Press the green Play button on the bottom left. 6. Press OK to calibrate. 7. Let the machine calibrate for 90 seconds. 8. Choose “Finish calibration”. 9. Insert the Geranium pigment from the bleaching reaction. 1. Do NOT use Acetone in these plastic cuvettes since it will frost over the plastic. 10. Press the Red Stop button. 11. Students should record the absorbance values at every 10 nm from 380nm-700nm. 12. The professor will prepare Spirulina extract diluted in ethanol in a cuvette and obtain the continuous absorbance spectrum. 13. Plot Relative Absorbance against wavelength using a line graph and compare the absorption spectrum of the extracts. 1. Relative Absorbance sets the maximum value in each dataset as a denominator. 2. Every value is divided by this maximum value. 6.04: Photosynthesis (Concept) Exploring Light Run the simulation below to understand how white light, specific wavelengths of light, and filtered light work. Concept map for Photosynthesis. Download PDF

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/06%3A_Photosynthesis/6.02%3A_Photosynthetic_Pigments.txt

• 7.1: Introduction The cell cycle refers to a series of events that describe the metabolic processes of growth and replication of cells. The bulk of the cell cycle is spent in the “living phase”, known as interphase. Interphase is further broken down into 3 distinct phases: G1 (Gap 1), S (Synthesis) and G2 (Gap 2). G1 is the phase of growth when the cell is accumulating resources to live and grow. • 7.2: Mitosis (Activity) Cells in your body reproduce at different rates. Skin cells reproduce frequently (about once per day); liver cells reproduce rarely (about once per year). Some specialized cells (like nerve and muscle cells) almost never reproduce and are in a special stage called G0. The whole process of mitosis, prophase to telophase, takes approximately 90 minutes. This exercise uses onion root tips to illustrate the amount of time spent in each phase of mitosis. • 7.3: Modeling Mitosis and Meiosis (Activity) In this page, you will find the instructions on how to simulate mitosis using pop-beads. Pop-beads are small, colored beads that can be joined together to simulate chromosome strands. We will use the pop-it beads to simulate the process that chromosomes undergo during cell division. • 7.4: Chromosomes and Karyotypes Chromosomes in Interphase are not visible individually. In preparation for nuclear division (mitosis or meiosis), they begin to organize tighter and condense in preparation for movement to subsequent daughter nuclei. The animation below illustrates the process of histone packaging and the molecular visualization of DNA replication. Histones are proteins that aid in the packaging of the chromosomes into organized coils that give rise to the recognizable chromosomes during metaphase. 07: Cell Division Introduction: The Cell Cycle and Mitosis The cell cycle refers to a series of events that describe the metabolic processes of growth and replication of cells. The bulk of the cell cycle is spent in the “living phase”, known as interphase. Interphase is further broken down into 3 distinct phases: G1 (Gap 1), S (Synthesis) and G2 (Gap 2). G1 is the phase of growth when the cell is accumulating resources to live and grow. After attaining a certain size and having amassed enough raw materials, a checkpoint is reached where the cell uses biochemical markers to decide if the next phase should be entered. If the cell is in an environment with enough nutrients in the environment, enough space and having reached the appropriate size, the cell will enter the S phase. S phase is when metabolism is shifted towards the replication (or synthesis) of the genetic material. During S phase, the amount of DNA in the nucleus is doubled and copied exactly in preparation to divide. The chromosomes at the end of G1 consist of a single chromatid. At the end of S phase, each chromosome consists of two identical sister chromatids joined at the centromere. When the DNA synthesis is complete, the cell continues on to the second growth phase called G2. Another checkpoint takes place at the end of G2 to ensure the fidelity of the replicated DNA and to re-establish the success of the cell’s capacity to divide in the environment. If conditions are favorable, the cell continues on to mitosis. Eukaryotic cell cycle is governed by the expression of cyclin proteins along with their activity. Credit: Jeremy Seto (CC-BY-SA) Mammalian cells in culture going through the Cell Cycle. Green marker proteins expressed during the G1 phase. Red marker proteins are expressed during S/G2/M. During the G1 to S transition, fluorescence disappears as the marker proteins also transition in expression. Mitosis is the process of nuclear division used in conjunction with cytokinesis to produce 2 identical daughter cells. Cytokinesis is the actual separation of these two cells enclosed in their own cellular membranes. Unicellular organisms utilize this process of division in order to reproduce asexually. Prokaryotic organisms lack a nucleus, therefore they undergo a different process called binary fission. Multicellular eukaryotes undergo mitosis for repairing tissue and for growth. The process of mitosis is only a short period of the lifespan of cells. Mitosis is traditionally divided into four stages: prophase, metaphase, anaphase, and telophase. The actual events of mitosis are not discreet but occur in a continuous sequence—separation of mitosis into four stages is merely convenient for our discussion and organization. During these stages, important cellular structures are synthesized and perform the mechanics of mitosis. For example, in animal cells, two microtubule-organizing centers called centrioles replicate. The pairs of centrioles move apart and form an axis of proteinaceous microtubules between them called spindle fibers. These spindle fibers act as motors that pull at the centromeres of chromosomes and separate the sister chromatids into newly recognized chromosomes. The spindles also push against each other to stretch the cell in preparation of forming two new nuclei and separate cells. In animal cells, a contractile ring of actin fibers cinches together around the midline of the cell to coordinate cytokinesis. This cinching of the cell membrane creates a structure called the cleavage furrow. Eventually, the cinching of the membrane completely separates into two daughter cells. Plant cells require the production of new cell wall material between daughter cells. Instead of a cleavage furrow, the two cells are separated by a series of vesicles derived from the Golgi. These vesicles fuse together along the midline and simultaneously secrete cellulose into the space between the two cells. This series of vesicles is called the cell plate. Binary Fission Mitosis refers to nuclear division, which happens to coincide with cytokinesis. Prokaryotes do not have nuclei, therefore they do not undergo a process of mitosis. Instead, prokaryotes undergo the process of binary fission. Growth of new membranes during the cellular growth and expansion in a prokaryote occurs by 2 mechanisms 1) along the center of the cell or 2) apically. The chromosome of prokaryotes is organized in a circular form. A mechanism called the rolling circle model describes the replication of the chromosome that accompanies binary fission. This is also the mechanism utilized by extrachromosomal DNA called plasmids. Introduction: Meiosis Meiosis is a process of nuclear division that reduces the number of chromosomes in the resulting cells by half. Thus, meiosis is sometimes called “reductional division.” For many organisms, the resulting cells become specialized “sex cells” or gametes. In organisms that reproduce sexually, chromosomes are typically diploid (2N) or occur as double sets (homologous pairs) in each nucleus. Each homolog of a pair has the same sites or loci for the same genes. You might recognize that you have one set of chromosomes from your mother and the remaining set from your father. Meiosis reduces the number of chromosomes to a haploid (1N) or single set. This reduction is significant because a cell with a haploid number of chromosomes can fuse with another haploid cell during sexual reproduction and restore the original, diploid number of chromosomes to the new individual. In addition to reducing the number of chromosomes, meiosis shuffles the genetic material so that each resulting cell carries a new and unique set of genes in a process of independent assortment. As in mitosis, meiosis is preceded by replication of each chromosome to form two chromatids attached at a centromere. However, reduction of the chromosome number and production of new genetic combinations result from two events that don’t occur in mitosis. First, meiosis includes two rounds of chromosome separation. Chromosomes are replicated before the first round, but not before the second round. Thus, the genetic material is replicated once and divided twice. This produces half the original number of chromosomes. Crossing over between chromatids of homologous chromosomes increases genetic diversity during meiosis I. Synapsis occurs during prophase I as the homologous chromosomes begin to pair up. Credit: Jeremy Seto (CC-BY-NC-SA) Second, during an early stage of meiosis each chromosome (comprised of two chromatids) pairs along its length with its homolog. This pairing of homologous chromosomes results in a physical touching called synapsis, during which the four chromatids (a tetrad) exchange various segments of genetic material. This exchange of genetic material is called crossing-over and produces new genetic combinations. During crossing-over there is no gain or loss of genetic material. But afterward, each chromatid of the chromosomes contains different segments (alleles) that is exchanged with other chromatids. Stages and Events of Meiosis Stages of Meiosis. Credit: Ali Zifan (CC-BY 4.0) Although meiosis is a continuous process, we can study it more easily by dividing it into stages just as we did for mitosis. Indeed, meiosis and mitosis are similar, and their corresponding stages of prophase, metaphase, anaphase, and telophase have much in common. However, meiosis is longer than mitosis because meiosis involves two nuclear divisions instead of one. These two divisions are called Meiosis I and Meiosis II. The chromosome number is reduced (reductional division) during Meiosis I, and chromatids comprising each chromosome are separated in Meiosis II. Each division involves the events of prophase, metaphase, anaphase, and telophase. Fertilization Summary of Cell Division Mitosis Meiosis Number of Cells at the Start Number of Cells at the End Number of Cell Divisions Chromosome Number (N) Start:______ End:______ Start:______ End:______ Number of Chromosomes in the Cell at the Start of the Process (Human Cell) Number of Chromosomes in the Cell at the End of the Process (Human Cell). Daughter Cells (N or 2N) Daughter Cell Genetics (Identical or Non-identical) Purpose of Division

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/07%3A_Cell_Division/7.01%3A_Introduction.txt

Identifying Mitotic Phases Identifying phases of mitosis in the onion root tip. Click on the image to view a larger image. The original figure without red boxes. Activity: Estimating the Time Spent in the Phases of Mitosis Cells in your body reproduce at different rates. Skin cells reproduce frequently (about once per day); liver cells reproduce rarely (about once per year). Some specialized cells like nerve and muscle cells almost never reproduce and are in a special stage called G0. The whole process of mitosis, prophase to telophase, takes approximately 90 min. In plants, an area of rapid growth is the tips of roots. This exercise uses onion root tips to illustrate the amount of time spent in each phase of mitosis. 1. Work as a team to look at onion root tips under the microscope. This area of the root is undergoing rapid cell reproduction. • If time is short, use the slides below 1. Identify the phases of the cell cycle for 20 randomly chosen cells. Record this information in the table. 2. Trade results with 3 other people. 3. In an onion root tip, the entire cell cycle takes about 12 hours or 720 minutes 4. Calculate the percentage of time spent in each phase by counting the total number of cells in each phase (total in interphase, in prophase, etc.) and dividing each by the total number of cells you counted. 5. Multiply the percentage of time in each phase by the total time of the cell cycle (720 minutes) and this gives you an estimate of the time spent in each phase. Number of Cells in each phase Interphase Prophase Metaphase Anaphase Telophase Total You (25) Partner 1 (25) Partner 2 (25) Partner 3 (25) Totals Estimate of time spent in each phase of the cell cycle. Interphase Prophase Metaphase Anaphase Telophase Total % of cells in each phase 100% Estimated Time 720 minutes Test Yourself at Home Use the following resource bio.rutgers.edu/~gb101/lab2_mitosis/section1_frames.html to test yourself and practice without a microscope. 7.03: Modeling Mitosis and Meiosis (Activity) Mitosis Simulation with Pop-it Beads Pop-beads are small, colored beads that can be joined together to simulate chromosome strands. We will use the pop-it beads to simulate the process that chromosomes undergo during cell division. Imagine that the beads represent long stretches of DNA that comprises the genetic instructions for the cell. Start with a cell with a chromosome number of 4 (4 chromosomes, or 2 homologous pairs). We will use red to identify the chromosome from the mother and yellow for the chromosome from the father. Pop-it Bead Chromosomes (2N=4) 1. Make 4 chromosomes: two long chromosomes (one red and one yellow) and two short chromosomes (one red and one yellow). The two long chromosomes should each have the same number of beads, as should the two short chromosomes. The two long chromosomes are one homologous pair; the two short chromosomes are the second homologous pair. 2. Simulate S phase: Replicate your chromosomes by making an identical set of pop-it bead chromosomes (you should have a total of eight pop-it bead strands; four long and four short). Attach the identical replicas (chromatids) by their magnetic centromeres. 3. Simulate Mitosis: Move the “chromosomes” through each of the four stages of mitosis. Draw and label the pop- bead chromosomes for ONE of the phases on a separate sheet. It is not necessary to draw each individual bead. 4. Draw a large circle on the paper to represent the cell and the nucleus with a pencil. 5. Place your chromosomes in this and walk through each stage of Meiosis. 6. Erase the outlines as you go along and re-draw the boundaries of nuclei. 7. Document each stage with your cell phone: 1. Prophase 2. Metaphase 3. Anaphase 4. Telophase

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/07%3A_Cell_Division/7.02%3A_Mitosis_%28Activity%29.txt

Chromosomal Features Chromosomes are made of double-stranded DNA molecules wound about histones and condensed into the familiar X-shape. Under regular functioning, these chromosomes are decondensed in the nucleus and not recognizable. Chromosomes in Interphase are not visible individually. In preparation for nuclear division (mitosis or meiosis), they begin to organize tighter and condense in preparation for movement to subsequent daughter nuclei. The animation below illustrates the process of histone packaging and the molecular visualization of DNA replication. Histones are proteins that aid in the packaging of the chromosomes into organized coils that give rise to the recognizable chromosomes during metaphase. Large-scale genomic rearrangements result in genetic abnormalities. Biologists utilize a technique called a chromosome spread followed by a karyotype or karyogram. To make a chromosome spread, one blocks the progression of mitosis at metaphase where chromosomes are condensed into the structures we are familiar with. A karyotype analysis is an arrangement of the chromosome spread into the homologous pairs of chromosomes. Events associated with the improper separation of chromosomes during metaphase results in an alteration of chromosome number in the subsequent generation of cells. Using the Pop-beads, we can understand better how the timing of these events will lead to differences in the karyotype. A “spectral” karyotype of a female nucleus. Each homologous pair is “painted” to differentiate them. Abnormal Karyotypes Down’s Syndrome is a common genetic abnormality referred to as Trisomy 21. Instead of having the complement of 46 chromosomes of 22 homologous pairs plus 2 sex chromosomes, there are 47 chromosomes consisting of an additional Chromosome 21. Standard Human Karyotype with 46 chromosomes. Both XX and XY are also shown here. The appearance of extra or missing chromosomes arises during meiosis in an event called nondisjunction. After fertilization, a zygote with an improper chromosome complement occurs. From left to right, the ploidy of the resultant zygotes: 2N, 2N, 2N+1, 2N-1; 2N+1, 2N+1, 2N-1, 2N-1 Nondisjunction can occur during Meiosis I or Meiosis II to yield aneuploid states of 2N+1 or 2N-1. Down’s syndrome karyotype showing the traditional trisomy 21. Translocation Translocation is the movement of a piece or a whole chromosome onto another chromosome. The acrocentric nature of Chr 21 and it’s small size makes it prone to an event called Robertsonian Translocation whereby two acrocentric chromosomes fuse. Down’s Syndrome from a 14:21 translocation. A spectral karyogram of a brain cancer (glioblastoma) illustrating multiple translocation problems and chromosome instability. Credit: Thomas Reid, NCI (CC-BY-NC) Abnormalities in mitosis also occur and can result in diseases from translocations. Polyploidy Some organisms and cells have entire sets of chromosomes additional to the standard 2N diploid. Cells that have extra sets in the formula of 3N are called triploid. If they are 4N, they are called tetraploid. This is different than the case of Down’s syndrome, which has a chromosome complement of 2N+1. Any time there are abnormal numbers of chromosomes, cells are referred to as aneuploid. A special case of aneuploid occurs from having entire sets more of chromosomes—polyploid. Plants are especially robust in the regard of polyploidy and often have different species arise in such a way. Some plants become sterile in the case of polyploidy and will not produce seeds properly. Wild bananas or plantains (Musa acuminata or Musa balbisiana) are deemed inedible because of their large seeds. Have you ever seen a banana with these large seeds? The answer is most likely “No!” since these are not regarded as being edible. However, due to selective breeding practices, most edible plantains and bananas are hybrids of the two species Musa acuminata or Musa balbisiana that are 3N or 4N. In this case, the fruits are sterile and the seeds don’t develop. Other seedless fruits are also developed this way and require propagation through clonal means.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/07%3A_Cell_Division/7.04%3A_Chromosomes_and_Karyotypes.txt

• 8.1: Introduction Agarose is a linear carbohydrate polymer purified from the cell walls of certain species of algae. Agar is a combination of the crude extract that contains agarose and the smaller polysaccharide agaropectin. When dissolved and melted in liquid, agarose strands become tangled together to form a netting that holds the fluid in a gel. Reduction of the fluid creates a higher percentage of the gel that is firmer and contains smaller pores within the netting. • 8.2: DNA Replication The Polymerase Chain Reaction (PCR) is a method of rapidly amplifying or copying a region of DNA in a tube. As the name implies, the technique uses a thermostable DNA Polymerase enzyme to mimic in a tube what happens within a cell during DNA replication. The chain reaction permits us to rapidly copy DNA from very minute source material in an exponential way. This technique is used in forensic science, genetic testing and cloning of rare genes. • 8.3: Variable Number Tandem Repeats The difference in nucleotide sequences between humans lies between 0.1-0.4%. This means that people are greater than 99% similar. But when you look at your classmates around the room, you can see that that small difference amounts to quite a bit of variation within our species. The bulk of these differences aren’t even within the coding sequences of genes but lie outside in regulatory regions that change the expression of those genes. • 8.4: Propagating DNA in Bacteria George Beadle and Edward Tatum first described the concept that each gene corresponded to an enzyme in a metabolic pathway by exposing the yeast Neurospora crassa to mutagenic conditions (Beadle & Tatum, 1941). Following these procedures, Joshua Lederberg continued these studies with Tatum where they generated two mutants strains in Escherichia coli. These bacteria were auxotrophs, unable to generate some basic nutrients necessary to sustain their growth. • 8.5: Restriction Enzymes DNA can be cut by restriction endonucleases (RE). Endonucleases are enzymes that can hydrolyze the nucleic acid polymer by breaking the phosphodiester bond between the phosphate and the pentose on the nucleic acid backbone. Molecular biologists also tend to use these special molecular scissors that recognize palindromes of 6 or 8. By using 6-cutters or 8-cutters, the sequences occur throughout large stretches rarely, but often enough to be of utility. • 8.6: DNA Fingerprinting (RFLP) Restriction fragment length polymorphism (RFLP) is a technique that exploits variations in DNA sequences. DNA from differing sources will have variations or polymorphisms throughout the sequence. Using Restriction Enzymes, these differences in sequences may be teased out. However, if one were to take the entirety of the human genome and chop it up with a restriction enzyme, many indecipherable fragments would be made. • 8.7: Cheek Cell DNA Extraction This page contains instructions on how to extract cheek cells using a cytobrush as well as how to use the PCR beads. • 8.8: D1S80 VNTR (Genotyping) The minisatellite marker D1S80 is located at 1p35-p36. This VNTR is 16 bases long. With a variation of alleles between 3-24 repeats, the locus displays enough diversity to aid in distinguishing between people. Although this is not a CoDIS marker, the use of multiple loci is required to definitively identify samples. The large repeat (16bp) permits the use of standard agarose gel electrophoresis to explore the diversity of this locus in our lab. PCR products range from 430bp to 814bp long. • 8.9: DNA Miniprep by Alkaline Lysis (Activity) Once DNA is introduced and carried in bacteria, we would like to isolate the DNA again for further manipulation. In order to do so, bacteria containing the plasmid of interest is grown in a liquid culture of nutrient-rich broth made of yeast extract called Luria-Bertani Broth (LB). These cultured bacteria are grown until they are of a high concentration overnight. The resulting pellet of bacteria is resuspended in a physiological buffer containing the chelator EDTA. • 8.10: Sanger Sequencing of DNA The polymerization of nucleic acids occurs in a 5′ → 3′ direction. The 5′ position has a phosphate group while the 3′ position of the hexose has a hydroxyl group. Polymerization depends on these 2 functional groups in order for a dehydration synthesis reaction to occur and extend the sugar-phosphate backbone of the nucleic acid. In the 1970s, Fred Sanger’s group discovered a fundamentally new method of ‘reading’ the linear DNA sequence using special bases called chain terminators. • 8.11: Next Gen Sequencing Traditional sequencing of genomes was a long and tedious process that cloned fragments of genomic DNA into plasmids to generate a genomic DNA library (gDNA). These plasmids were individually sequenced using Sanger sequencing methodology and computational was performed to identify overlapping pieces, like a jigsaw puzzle. As technology improved, the cost of sequencing genomes became less expensive. This technology outpaced Moore’s Law, resulting in a dramatic price decrease. 08: Analyzing DNA Agarose Gel Electrophoresis Agarose is a linear carbohydrate polymer purified from the cell walls of certain species of algae. Agar is a combination of the crude extract that contains agarose and the smaller polysaccharide agaropectin. When dissolved and melted in liquid, agarose strands become tangled together to form a netting that holds the fluid in a gel. Reduction of the fluid creates a higher percentage of the gel that is firmer and contains smaller pores within the netting. Placing a comb within the melted agarose creates spaces that allow for the insertion of samples when the gel is solidified. Molecules can traverse through the pores as they are drawn by electrical currents. Charged compounds will migrate towards the electrode of opposite charge but migration rate will be influenced by the size of the molecules. Smaller compounds can easily traverse through the webbing while larger items are retarded by the pore size. Follow this simulation to get a better idea of how we use Agarose Gel Electrophoresis in molecular biology to study DNA fragments. DNA molecules are not readily visible when resolved (separated) on an agarose gel. In order to visualize the molecules, a DNA dye must be administered to the gel. In research labs, a DNA intercalating agent called Ethidium Bromide is added to the molten gel and will bind to the DNA of the samples when run. Ethidium Bromide can then be visualized on a UV box that will fluoresce the compound and reveal bands where DNA is accumulated. Since Ethidium Bromide is known as a carcinogen, teaching labs will use a safer DNA intercalating agent known as Sybr Green. This can be visualized in a similar fashion but will fluoresce a green color instead. Agarose gels visualized on a UV transilluminator. Left shows a gel with Ethidium bromide. Right shows a gel with Sybr Green. Agarose gels are made of and bathed in a buffered solution, usually of Tris-Borate-EDTA (TBE) or Tris-Acetate-EDTA (TAE). Regardless of the buffered solution, the buffer provides necessary electrolytes for the current to pass through and maintain the pH of the solution. DNA samples are prepared in a buffer similar to the solution that it will be run in to ensure that the phosphate backbone of the DNA remains deprotonated and moves to the positive electrode. Additionally, glycerol or another compound is added to this buffer in order for the solution to sink into the wells without spreading out. A dye is often included in this loading buffer in order to visualize the loading in the wells and to track the relative progression of gel. Agarose Gel Set-up Click here to watch the "Assembling the Rig & Loading/Running The Gel" video: Electrophoresis of Dyes (Activity) 1. Prepare a 1% agarose gel by adding 60ml Tris-Borate-EDTA buffer (TBE) to 0.6g agarose in an Erlenmeyer flask 2. Place the flask in a microwave or on the heat until agarose is melted. • Stop periodically and swirl solution and do not permit to boil over. 3. Assemble the casting tray by blocking the ends with tape or plastic gaskets. 4. Place the comb into the center of the casting tray. 5. You may place the casting trays inside a refrigerator and pour the solution into the tray. 6. Wait until the gel is solidified. 7. Carefully separate the gaskets from the tray. 8. Remove the comb and place the casting tray into an electrophoresis chamber. 9. Cover the gel with TBE buffer. 10. Using a micropipettor, load 40-50μl dye samples sequentially into the wells. 11. Cover the electrophoresis chamber with the lid and ensure good contact between electrodes. • It is conventional that the POSITIVE side of the tank is nearest to you. • With the POSITIVE side nearest to you, load the samples from left to right. 12. Set the power supply to 100-120V and press the Run button (you should see bubbles at each electrode) and allow to run for at least 40 minutes. 13. After 40 minutes, stop the current and remove the gel in the casting tray. 14. Place tray on a white background and document your gel. Activity Follow-up 1. What colors were the dyes originally before loading into the wells? 2. How many separate bands of dye are in each well following the run? 3. What does it mean that there are multiple bands in a lane? What does it mean that there is only one band in a lane? 4. What does the length of migration illustrate to us about the properties of the dye molecules? 5. In which direction did the dye molecules migrate? What does the direction of migration indicate about the analytes? 6. Are there lanes where there are multiple bands of the SAME color?

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/08%3A_Analyzing_DNA/8.01%3A_Introduction.txt

Francis Crick proposed 3 models for how DNA might replicate. Credit: Jeremy Seto (CC-BY 3.0) Meselson & Stahl Experiment Meselson & Stahl revealed semi-conservative replication as the method through use of radiolabeling DNA in bacteria. Credit: Jeremy Seto (CC0) Polymerase Chain Reaction (PCR) The Polymerase Chain Reaction (PCR) is a method of rapidly amplifying or copying a region of DNA in a tube. As the name implies, the technique uses a thermostable DNA Polymerase enzyme to mimic in a tube what happens within a cell during DNA replication. The chain reaction permits us to rapidly copy DNA from very minute source material in an exponential way. This technique is used in forensic science, genetic testing and cloning of rare genes. Because of the exponential copying process, a stray cell left behind can provide enough genetic material to make billions of copies of this DNA. The process of PCR can be observed in an animation found at Cold Spring Harbor Laboratory’s DNA Learning Center website (http://www.dnalc.org/resources/3d/19-polymerase-chain-reaction.html). Primers are reverse complementary to one of the 2 strands of DNA. They flank the area of interest and become incorporated into the replicated product. Credit: Jeremy Seto (CC-BY 3.0) As with any DNA replication process, one needs to start off with a template. The template is the source material that is meant for duplication. In this process, scientists are not interested in copying the entirety of the genome, just a small segment of interest. DNA polymerases require primers to begin the polymerization process. Primers are designed as small oligonucleotide segments that flank the area of interest. These are short strands of DNA that reverse complement to the DNA area of interest so that the DNA polymerase has a starting point and is guided only to the DNA segment of interest. These primers tend to be about 18-24 bases long. However, a double-stranded DNA molecule is already base-paired together into a double helix so our primers can not interact. The first step of PCR is to separate the double-stranded DNA molecule by denaturing the H-bonds using high heat (95°C). The primer concentrations are much higher than the original template. The next step of PCR is called annealing. During this step, the temperature is reduced to a temperature of about 55°C. This temperature is still hot by our standards but is necessary to enhance the stringency of the correct base pairing of the primers to their targets on the template. The DNA Polymerase used in this process is derived from a bacteria that lives in very high temperatures and does not denature as other proteins would under such conditions (thermostable). The original enzyme was isolated from an organism called Thermus aquaticus, so we call the enzyme Taq polymerase or just Taq for short. This bacteria lives in hot springs where the temperatures are about 50°C but it thrives at a range between 50-80°C. The temperature is raised again to a higher temperature of 72°C for the polymerase to extend (also called elongation) or continue the polymerization step from the primer. PCR is accomplished by cycling rapidly between these three steps: denature, anneal, and extension. The rate-limiting step is the extension which limits the length of DNA to be copied. If the original template is only a single copy, we would have 2 copies after the completion of a cycle. The subsequent cycle would have 4 copies, then 8, then 16, then 32, and so on. The doubling process is exponential so from 1 copy undergoing 30 cycles; we would have 230 or 1,073,741,824 copies. This is over a billion copies in a few hours of time. Exponential amplification by PCR. Credit: Jeremy Seto (CC-BY 3.0) External Resources • Walkthrough of the steps in PCR • www.dnalc.org/view/15924-Making-many-copies-of-DNA.html

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/08%3A_Analyzing_DNA/8.02%3A_DNA_Replication.txt

Polymorphisms The difference in nucleotide sequences between humans lies between 0.1-0.4%. This means that people are greater than 99% similar. But when you look at your classmates around the room, you can see that that small difference amounts to quite a bit of variation within our species. The bulk of these differences aren’t even within the coding sequences of genes but lie outside in regulatory regions that change the expression of those genes. Imagine if there were mutations to the coding sequences, this could be very deleterious to the well-being of the organism. We say that the coding sequences of genes that ultimately lead to proteins have selective pressure to remain the same. The areas outside of the coding sequences have a reduced and sometimes non-existent selection pressure. These areas are allowed to mutate in sequence and even expand or contract. Areas of changes or differences are called polymorphic (many forms). If you were to read a repetitive set of sequences and count the repetition, you’ would make mistakes and lose count. Likewise, DNA polymerase will make errors or stutter in areas of repetitiveness and produce polymorphic regions. Tandem Repeats A type of polymorphism occurs due to these repeats expanding and contracting in non-coding regions. These regions are called variable number tandem repeats (VNTRs)or sometimes short tandem repeats (STRs). Any region or location on a chromosome is referred to as locus (loci for plural). Scientists use polymorphic loci that are known to contain VNTRs/STRs in order to differentiate people based on their DNA. This is often used in forensic science or in maternity/paternity cases. Any variation of a locus is referred to as an allele. In standard genetics, we often think of an allele as a variation of a gene that would result in a difference in a physical manifestation of that gene. In the case of STRs, these alleles are simply a difference in the number of repeats. This means the length of DNA within this locus is either longer or shorter and gives rise to many different alleles. VNTRs are referred to as minisatellites while STRs are called microsatellites. CoDIS The FBI and local law enforcement agencies have developed a database called the Combined DNA Index System (CoDIS) that gathers data on a number of STRs. By establishing the number of repeats of a given locus, law enforcement officials can differentiate individuals based on the repeat length of these alleles. CoDIS uses a set of 20 loci that are tested together. As you would imagine, people are bound to have the same alleles of certain loci, especially if they were related. The use of 20 different loci makes it statistically improbable that 2 different people could be confused with each other. Think about this in terms of physical traits. As you increase the number of physical traits used to describe someone, you are less likely to confuse that person with someone else based on those combinations of traits. Using the CoDIS loci increases the stringency since there are many alleles for each locus. The twentieth locus in CoDIS (called AMEL) discriminates between male and female. Crime Scene Investigation This lab uses a CoDIS locus called TH01. TH01 is a locus on chromosome 11 that has a repeating sequence of TCAT. There are reported to be between 3-14 repeats in this locus. With the exception of X and Y in a male, all chromosomes have a homologous partner. Therefore, each individual will have 2 alleles for each CoDIS locus. At a crime scene, criminals don’t often leave massive amounts of tissue behind. Scant evidence in the form of a few cells found within bodily fluids or stray hairs can be enough to use as DNA evidence. DNA is extracted from these few cells and amplified by PCR using the specific primers that flank the STRs used in CoDIS. Amplified DNA will be separated by gel electrophoresis and analyzed. Size reference standards and samples from the crime scene and the putative suspects would be analyzed together. In a paternity test, samples from the mother, the child, and the suspected father would be analyzed in the same manner. A simple cheek swab will supply enough cells for this test.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/08%3A_Analyzing_DNA/8.03%3A_Variable_Number_Tandem_Repeats.txt

Complementation George Beadle and Edward Tatum first described the concept that each gene corresponded to an enzyme in a metabolic pathway by exposing the yeast Neurospora crassa to mutagenic conditions (Beadle & Tatum, 1941). Following these procedures, Joshua Lederberg continued these studies with Tatum where they generated two mutants strains in Escherichia coli. These bacteria were auxotrophs, unable to generate some basic nutrients necessary to sustain their growth. The two strains were described as met bio Thr+ Leu+ Thi+ (Strain A) and Met+ Bio+ thr leu thi (Strain B). Strain A can sufficiently synthesize the amino acids threonine, leucine, and the cofactor thiamine while deficient in producing the cofactor biotin and the amino acid methionine while the converse was true of Strain B. When either of these two strains was plated onto minimal media, no growth occurred. Supplementing minimal media with methionine and biotin permitted Strain A to grow as normal. When the two strains were mixed together and plated on minimal media, there was a growth of bacteria. The two strains were capable of complementing each other in some way as if a sexual exchange of genetic material had occurred (Lederberg & Tatum, 1946). Bacteria are equipped with all the necessary capacities to replicate DNA. Common bacterial species have bee adapted for use in the lab to carry DNA and propagate it for uses in biotechnology. In addition to chromosomal DNA of the bacterial genome, bacteria also have extrachromosomal DNA called plasmids. These plasmids replicate independently of the bacterial chromosome and can occur in a high copy. These circular pieces of DNA are modified in labs to carry specific pieces of DNA so they can be studied or used for expression into proteins. Plasmids can naturally carry important traits, including antibiotic resistance. Plasmids are relatively small, ranging in size from 1000 bases to 1,000,000 bases long (1kb-1000kb). Bacterial DNA usually exists as a large circular chromosome (red). Plasmids are extrachromosomal and autonomously replicating pieces of DNA (blue). Through a process called conjugation, bacteria can “sexually” transfer genetic material to another by passing plasmids through a structure called a conjugation pilus. Conjugation process between a plasmid bearing donor and a plasmid-less recipient. The donor creates a conjugation pilus to create a cytosolic bridge with the donor where the plasmid is replicated into the recipient through the rolling circle method of replication. The recipient then becomes competent to act as a donor. Features of Plasmids Plasmids that are designed by Biologists to shuttle pieces of DNA for study are referred to as vectors because they move a piece of DNA. These plasmid vectors have the same hallmarks as traditional plasmids with the capacity to replicate independently of the bacterial genome. The feature that allows these DNA’s to replicate is called an origin of replication (ori) that is usually rich in A’s and T’s. However, these plasmid vectors have the additional properties that make them easy to work with and distinguishable from bacterial plasmids; a selection marker and a multiple cloning site. A selection marker usually comes in the form of a gene that encodes resistance to a specific antibiotic. In the pictured plasmid, Ampicillin resistance granted by the β-lactamase gene. The multiple cloning site (MCS), also known as the polylinker, is the location in which the DNA of interest is incorporated into the vector. MCSs are defined by a set of unique sites where the DNA can be cut by restriction endonucleases (RE). As the name implies, restriction enzymes are “restricted” in their ability to cut or digest DNA. The restriction that is useful to biologists is usually palindromic DNA sequences. Palindromic sequences are the same sequence forwards and backward. Some examples of palindromes: RACE CAR, CIVIC, A MAN A PLAN A CANAL PANAMA. With respect to DNA, there are 2 strands that run antiparallel to each other. Therefore, the reverse complement of one strand is identical to the other. EcoRI generates sticky of cohesive ends SmaI generates blunt ends Restriction enzymes hydrolyze covalent phosphodiester bonds of the DNA to leave either “sticky/cohesive” ends or “blunt” ends. This distinction in cutting is important because an EcoRI sticky end can be used to match up a piece of DNA cut with the same enzyme in order to glue or ligate them back together. While endonucleases cut DNA, ligases join them back together. DNA digested with EcoRI can be ligated back together with another piece of DNA digested with EcoRI, but not to a piece digested with SmaI. Another blunt cutter is EcoRV with a recognition sequence of GAT | ATC. By “cutting and pasting” DNA into vectors, we can introduce foreign or exogenous DNA into bacteria. This type of DNA is now called Recombinant DNA and is the heart of biotechnology. Recombinant DNA Technology Questions for Thought 1. Why do you think that the origins of replication are made of A’s and T’s? 2. What is different about the types of bonds holding the double strands together versus phosphodiester bonds of the DNA backbone? 3. Can DNA be digested with SmaI be ligated to DNA digested with EcoRV? 4. If so, which enzyme will be able to digest this new DNA? • Beadle, G. W.; Tatum, E. L. (1941). “Genetic Control of Biochemical Reactions in Neurospora”. Proceedings of the National Academy of Sciences. 27 (11): 499–506. doi:10.1073/pnas.27.11.499. PMC 1078370. PMID 16588492 • Lederberg J, Tatum EL (1946). “Gene recombination in E. coli“. Nature. 158 (4016): 558. doi:10.1038/158558a0 8.05: Restriction Enzymes DNA can be cut by restriction endonucleases (RE). Endonucleases are enzymes that can hydrolyze the nucleic acid polymer by breaking the phosphodiester bond between the phosphate and the pentose on the nucleic acid backbone. This is a very strong covalent bond while the weaker hydrogen bonds maintain their interactions and double strandedness. As the name implies, restriction endonucleases (or restriction enzymes) are “restricted” in their ability to cut or digest DNA. The restriction that is useful to biologists is usually palindromic DNA sequences. Palindromic sequences are the same sequence forwards and backwards. Some examples of palindromes: RACE CAR, CIVIC, A MAN A PLAN A CANAL PANAMA. With respect to DNA, there are 2 strands that run antiparallel to each other. Therefore, the reverse complement of one strand is identical to the other. Molecular biologists also tend to use these special molecular scissors that recognize palindromes of 6 or 8. By using 6-cutters or 8-cutters, the sequences occur throughout large stretches rarely, but often enough to be of utility. Restriction enzymes hydrolyze covalent phosphodiester bonds of the DNA to leave either “sticky/cohesive” ends or “blunt” ends. This distinction in cutting is important because an EcoRI sticky end can be used to match up a piece of DNA cut with the same enzyme in order to glue or ligate them back together. While endonucleases cut DNA, ligases join them back together. DNA digested with EcoRI can be ligated back together with another piece of DNA digested with EcoRI, but not to a piece digested with SmaI. Another blunt cutter is EcoRV with a recognition sequence of GAT | ATC. EcoRI generates sticky of cohesive ends SmaI generates blunt ends

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/08%3A_Analyzing_DNA/8.04%3A_Propagating_DNA_in_Bacteria.txt

Restriction fragment length polymorphism (RFLP) is a technique that exploits variations in DNA sequences. DNA from differing sources will have variations or polymorphisms throughout the sequence. Using Restriction Enzymes, these differences in sequences may be teased out. However, if one were to take the entirety of the human genome and chop it up with a restriction enzyme, many indecipherable fragments would be made. In fact, the resulting agarose gel would simply show a large smear of DNA. RFLP analysis requires that a probe to a specific area of DNA be used to identify specific locations. Agarose gels would be transferred to a membrane or filter where they would be hybridized to these radioactive probes. Homologous chromosomes with restriction sites noted by triangles. the rectangle sitting on the chromosomes correspond to a probe locus. Credit: Jeremy Seto (CC0) RFLP analysis was designed for forensic science to discriminate between people. Since people are 2N, they have pairs of homologous chromosomes with the same loci. However, these loci may contain different alleles. In this case, the phenotype for these alleles is the actual sequence that may or may not contain restriction sites. The presence or absence of a restriction site may arise from single nucleotide polymorphisms (SNPs) that reveal the natural variation between people. The schematic below illustrates a comparison of restriction profiles between two sources. Note that the probe overlaps a restriction site in one of the alleles. This probe will be able to bind to both fragments given sufficient sequence overlap. Upon resolving on an agarose gel, genomic DNA that does not hybridize with the probe will obscure the locus of interest as a large smear. A filter is placed on top of the agarose and pressed against it to transfer the DNA in a process called Southern Blotting. Following a lengthy transfer, the filter is denatured to and incubated with the radioactive probe. To visualize this probe hybridization, a film is exposed to the filter and processed. Following restriction digestion, the samples are resolved on an agarose gel. Digestion of genomic DNA will result in a large smear. Following transfer of the DNA onto a membrane through capillary action, the membrane is probed with radioactive probe DNA. The probe binds selectively to complementary sequences to reveal a series of distinct bands. An interactive demonstration of the first DNA fingerprinting. Credit: Oder Zeichner: abigail [ or CC-BY-SA-3.0] /Autoradiogram Sample A only reveals one band after processing because this person is homologous for the same allele. Sample B is heterozygous and reveals three bands. Credit: Retama (CC-BY-SA 4.0) RFLPs represent inheritable markers and can reveal relationships between different individuals. A pedigree can illustrate the relationship of the inherited alleles. The technique can be more informative if using multiple probes simultaneously for different loci or to use multi-locus probes that hybridize to multiple locations. RFLPs may arise from differences in the STR/VNTR repeats between restriction sites. Credit: Jeremy Seto (CC0) While RFLPs can arise from SNPs, they may also be caused by the expansion or contraction of repeated elements between restriction sites. These repeated elements of DNA are referred to as Variable Number Tandem Repeats (VNTR) and illustrate polymorphisms that normally occur in non-coding regions of the genome. DNA Fingerprinting (Activity) 1. The origin of the DNA samples for this exercise will be explained by the Instructor as numerous scenarios may be used (Edvotek Cat. #109). 2. Prepare a 1% agarose gel by adding 60ml Tris-Borate-EDTA buffer (TBE) to 0.6g agarose in an Erlenmeyer flask. 3. Place the flask in a microwave or on the heat until agarose is melted. • Stop periodically and swirl the solution. Do not permit to boil over. 4. Assemble the casting tray by blocking the ends with tape or plastic baskets. 5. Place the comb into the casting tray at the NEGATIVE end. 6. The instructor will add 6μl Sybr Safe to his/her own gel solution at this time. 7. You may place the casting trays inside a refrigerator and pour the solution into the tray. 8. Wait until the gel is solidified. 9. Carefully separate the gaskets from the tray ensuring not to tear apart the wells made by the comb. 10. Remove the comb and place the casting tray into an electrophoresis chamber. 11. Cover the gel with TBE buffer. 12. Using a micropipettor, load 40-50μl dye samples sequentially into the wells. 13. Cover the electrophoresis chamber with the lid and ensure good contact between electrodes. • It is conventional that the POSITIVE side of the tank is nearest to you. • With the POSITIVE side nearest to you, load the samples from left to right. 14. Set the power supply to 100-120V, press the Run button (you should see bubbles at each electrode), and allow to run for at least 40 minutes. 15. After 40 minutes, stop the current and remove the gel in the casting tray. 16. Slide the gels into the staining solution if they do not include Sybr Safe for visualization the subsequent meeting time. 17. The instructor will slide the gel onto a UV transilluminator behind a shield and show the results to the class. • Document the findings of the gel by photographing with your phone. • The instructor will discuss the results and ask for you to interpret the findings. Activity Follow-up 1. Why are the samples loaded at the negative side of the gel? 2. What is the role of the dye in these samples? Should we be alarmed that the samples are all the same color? 3. What does it mean that there are multiple bands in a lane? What does it mean that there is only one band in a lane? 4. What can we conclude from the banding patterns in this forensics or paternity case? Is this sufficient data for these conclusions? 8.07: Cheek Cell DNA Extraction Using Cytobrush 1. Use a sterile cytobrush and insert into mouth. 2. Brush the cytobrush on the inside of your cheek 25 times. 3. Swirl the cytobrush in 100 μl of Chelex suspension (10% w/v). 4. Place a centrifuge tube with Chelex and cell suspension on a 100 °C heat block for 10 minutes. 5. Centrifuge the tubes at maximum speed for 5 minutes. 6. DNA is in the supernatant. Avoid beads at the bottom. 7. Store DNA at -20 °C. PCR with PCR Beads 1. Add 22 μl of the primer mix (forward and reverse) to beads. 2. Ensure that the bead is dissolved. 3. Add 3 μl of DNA. 8.08: D1S80 VNTR (Genotyping) The minisatellite marker D1S80 is located at 1p35-p36. This VNTR is 16 bases long. With a variation of alleles between 3-24 repeats, the locus displays enough diversity to aid in distinguishing between people. Although this is not a CoDIS marker, the use of multiple loci is required to definitively identify samples. The large repeat (16bp) permits the use of standard agarose gel electrophoresis to explore the diversity of this locus in our lab. PCR products range from 430bp to 814bp long. • D1S80-for: 5′-GAAACTGGCCTCCAAACACTGCCCGCCG-3′ • D1S80-rev: 5′-GTCTTGTTGGAGATGCACGTGCCCCTTGC-3′ 1. PCR the DNA samples extracted from cheek cells using the PCR Beads. 2. Pour 2% agarose into casting apparatus in the refrigerator. • 2 gels per class need to be made → 100ml of TBE with 2g agarose • Add 5μl SYBR safe solution into the molten agarose before casting. • Place 2 sets of combs into the gel → at one end and in the middle 3. Load the gel with a DNA ladder. • The sample is from the PCR. 4. Run the gel at 120V for 20 minutes. 5. Visualize on the UV transilluminator. Example Results 1. How many alleles are visible in each lane? 2. Are the genotypes distinguishable between individuals? 3. Are any of the alleles common between individual samples?

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/08%3A_Analyzing_DNA/8.06%3A_DNA_Fingerprinting_%28RFLP%29.txt

Alkaline Lysis Once DNA is introduced and carried in bacteria, we would like to isolate the DNA again for further manipulation. In order to do so, bacteria containing the plasmid of interest is grown in a liquid culture of nutrient-rich broth made of yeast extract called Luria-Bertani Broth (LB). These cultured bacteria are grown until they are of a high concentration overnight. They are harvested through centrifugation and the broth is removed. The resulting pellet of bacteria is resuspended in a physiological buffer containing the chelator EDTA. A chelator is a chemical that removes divalent cations like Ca2+ or Mg2+ from solution. This is significant because divalent cations are necessary for DNA digesting enzymes to be active. By chelating the ions, the DNA we ultimately wish to purify will be safe from degradation. After resuspension of the bacteria, an alkaline solution of 0.1N NaOH is mixed into the bacterial mix. This solution also contains an ionic detergent called sodium dodecyl sulfate (SDS) that aids in denaturing proteins and disrupting their interactions with the DNA. The mixture becomes viscous as the bacteria burst open and their contents leak into the solution. This basic solution is then neutralized with a potassium acetate buffer at pH5.5. As the solutions mix together, the pH approaches 7 and the potassium interacts with the SDS to cause the precipitation of the genomic chromosomal DNA and proteins. In order to separate the precipitate from the solution, the mixture is centrifuged at high speed to pellet the genomic DNA and protein. The supernatant, or solution, is transferred to a column containing a silica membrane. Under high salt conditions, DNA adheres to glass or silica. By passing the solution through this column, the plasmid DNA in the supernatant is trapped onto the silica membrane and removed from the solution. Additional washes are used to removed stray contaminants and remove the excessive salt. Plasmid DNA is finally removed from the column through elution by a low salt buffer. This low salt buffer is Tris pH 8 with EDTA (TE). Plasmid DNA can be stored stably in the TE buffer in the freezer for extended periods. Exercise 1: Plasmid DNA Mini-Prep by Alkaline Lysis 1. Inoculate 2 ml of rich medium (LB, YT, or Terrific Broth) containing the appropriate antibiotic with a single colony of transformed bacteria. Incubate the culture overnight at 37°C with vigorous shaking. (This is what you were provided) 1. Each group should take 2 cultures 2. Centrifuge culture tubes directly at maximum for 5 minutes. 1. If incapable of spinning in these tubes, transfer 1.5 ml of the culture into a microfuge tube (Eppendorf Tube). 2. Centrifuge at maximum speed for 30 sec. 1. When centrifugation is complete, pour the broth solution into a container of bleach. 2. Resuspend the bacterial pellet in 250 μl of ice-cold P1 solution by vigorous shaking and transfer back into a microcentrifuge tube. • P1 is a physiological solution of 50mM Tris at pH 8. • P1 contains a Chelator called EDTA. • Chelators bind up excess divalent cations that are required for DNAse activity. 1. Lyse: Add 250μl of P2 solution to each bacterial suspension. Close the tube tightly, and mix the contents by inverting the tube gently five times. Do not vortex! Store the tube on ice. • This is the lysis buffer containing the detergent Sodium Dodecyl Sulfate and NaOH. 1. Neutralize: Add 350 μl of ice-cold P3 solution. Close the tube and disperse lysis solution by inverting the tube several times. Store the tube on ice for 3-5 minutes. • This is the neutralization buffer containing Potassium Acetate. • Neutralization restores pH to near 7 and also causes the precipitation of genomic DNA and proteins into a gloopy mess (snot-like). 1. Centrifuge the bacterial lysate at maximum speed for 5 minutes in a microfuge. • Snot-like substances should be tightly packed into a pellet at the bottom of the tube after this step. • The solution or supernatant contains the plasmid DNA. 1. Column Purification of DNA: Transfer the supernatant to a fresh tube with a silica-membrane column • DNA likes to bind to glass under high salt conditions. • The white membrane is made of glass fiber. 1. Centrifuge the supernatant through the column for 1 minute at maximum speed in a microfuge. • The DNA will be bound to the membrane on the column (silica) 1. Wash: Discard flow-through and place column back into the waste tube. Wash column with 500 μl PE. Centrifuge the supernatant through the column for 1 minute at maximum in a microfuge. • PE is a solution that helps to wash away the non-specifically bound substances 1. Discard flow-through and place column back into the waste tube. Wash Column with 700 μl PE. Centrifuge the supernatant through the column for 1 minute at maximum in a microfuge. Discard flow-through and repeat spin to dry column. 2. Place column in a fresh centrifuge tube and Elute the nucleic acids in 50 μl of TE (pH 8.0) by binding for 1 minute and spinning at maximum speed for 1 minute. Identification of Plasmid DNA Once plasmids are isolated, they require identification. Plasmid vectors have known sequences and are mapped of their major features. Knowing the sequence of these pieces of DNA means knowing the locations of RE digestion sites. By using Res, digesting plasmids into known sizes aids in the verification of plasmid identity without the need to have the entire plasmid re-sequenced. A common plasmid is called pUC18 or pUC19. The “p” stands for plasmid, the “UC” stands for University of California (where it was designed) and 18 or 19 refer to the difference in the MCS. This plasmid is 2,686 base pairs or ~2.7kb (kilobase) long with a single EcoRI site in the MCS. Another plasmid of interest in learning Molecular Biology is called pGlo. This plasmid has a jellyfish gene in the MCS that codes for a protein that will fluoresce green when expressed under UV light. pGlo is 5.4kb long and contains a single EcoRI site. Once digested, by an enzyme, these plasmids can be identified based on size separation on an agarose gel. Usually, it is best to identify by using 2 different REs. Digestion is important before size comparisons since circular DNA migrates through agarose differently than linear DNA. Additionally, circular DNA can sometimes be “super-coiled” and lead to very rapid migration despite the size. Feature map of pUC19 including the locations of some restriction enzymes. Close up view of the pUC19 Multiple Cloning Site (MCS). These restriction sites appear only once throughout the entirety of the plasmid sequence. Plasmid feature map of pGlo. This is not a cloning vector, so an MCS does not exist. Exercise 2: Restriction Digestion Identification of Plasmids 1. The class should prepare 2X 0.8% agarose gels by preparing 0.4g agarose in 50ml TBE buffer. 1. Melt agarose solution by microwaving for 1 minute. 2. Add 5μl Sybr Safe solution into the 100ml gel solution. 3. Pour this solution into a casting tray inside the refrigerator. 4. Insert a comb. 2. To a new tube add 2μl of plasmid DNA to 8μl of EcoRI fast digest mixture. 1. 1μl Fast Digest Buffer 2. 1μl Fast Digest EcoRI enzyme 3. 6μl H2O 3. Incubate at 37°C for 10 minutes. 4. Add 2μl of loading buffer to digestion mixture. 5. In a separate tube, combine 3μl plasmid DNA with 2μl loading buffer and 7μl of H2O. 6. Load gel with an appropriate size ladder in the first lane, load the Digested plasmid in the next lanes, then the undigested plasmid. • 3 groups can load onto one gel • D=digested plasmid • U=undigested plasmid 7. Run the gel at 110V for 30 minutes and visualize on a UV transilluminator. 8. Document with your camera.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/08%3A_Analyzing_DNA/8.09%3A_DNA_Miniprep_by_Alkaline_Lysis_%28Activity%29.txt

Radioactive Chain Termination The polymerization of nucleic acids occurs in a 5′ → 3′ direction. The 5′ position has a phosphate group while the 3′ position of the hexose has a hydroxyl group. Polymerization depends on these 2 functional groups in order for a dehydration synthesis reaction to occur and extend the sugar-phosphate backbone of the nucleic acid. In the 1970s, Fred Sanger’s group discovered a fundamentally new method of ‘reading’ the linear DNA sequence using special bases called chain terminators or dideoxynucleotides. The absence of a hydroxyl group at the 3′ position blocks the polymerization, resulting in termination. This method is still in use today and is called "Sanger dideoxynucleotide chain-termination method". This method originally used a radioactively labeled primer to initiate the sequencing reaction. Four reactions take place where each reaction is intentionally “poisoned” with a dideoxy chain terminator. For example, one reaction will have all 4 dNTPs (deoxynucleotide triphosphates) with the addition to a small amount of ddATP (dideoxyadenosine triphosphate). This reaction will result in a series of premature terminations of the polymerization specifically at different locations where an Adenine would be incorporated. dATP is a natural monomer used in the polymerization of DNA. The 3′-OH is the attachment point of the next subsequent nucleotide. The lack of a 3′-OH in this molecule of ddATP makes it a chain terminator that will prohibit the addition of another nucleotide to the DNA polymer. The product of these 4 separate sequencing reactions is run on a large polyacrylamide sequencing gels. The smallest fragments run through the gel the fastest and create a ladder-like pattern. This can be visualized through the use of an x-ray film that is sensitive to the radioactivity. Each lane of the gel corresponds to one of the four chain-terminating reactions. The bases are read sequentially from the bottom up and reveal the sequence of the DNA. The sequencing gel can be manually scored. The profiles of each lane have been created using ImageJ to illustrate the banding pattern and subsequent sequence. Credit: John Schmidt & Jeremy Seto (CC-BY-SA 3.0) Fluorescent Chain Termination and Capillary Electrophoresis Credit: Estevezj (CC-BY-SA 3.0) Radioactivity is dangerous and undesirable to work with so chain terminators with fluorescent tags were developed. This method synthesizes a series of DNA strands that are specifically fluorescent at the termination that is passed through a capillary electrophoresis system. As the fragments of DNA pass a laser and detector, the different fluorescent signal attributed to each ddNTP is identified and generates a chromatogram to represent the sequence. Fluorescent Chain Terminators are now used in reactions and run through a small capillary. The smallest fragments run through first and are detected to reveal a chromatogram. Fluorescent Chromatograms are used to score the nucleotide chain termination. The amplitude of each peak corresponds to the strength or certainty of the nucleotide call. Chromatogram files are usually provided alongside the sequence file with the extension *.ab1 while the sequence files are provided as a text file in the fasta format. More about these files can be found here. The ab1 files are extremely important to analyze when there are ambiguity or sequencing errors. These ab1 files can also be used to ascribe a quality score on the base call. When there is too much ambiguity in the signal because of multiple peaks, you will often find an N in place of one of the 4 nucleotides (A, T, C, and G). This video (source: www.yourgenome.org CC-BY) illustrates the mechanism of fluorescent chain termination and capillary electrophoresis. Sequencing Genomes Credit: Jeremy Seto (CC-BY-NC-SA 3.0) Traditional sequencing of genomes was a long and tedious process that cloned fragments of genomic DNA into plasmids to generate a genomic DNA library (gDNA). These plasmids were individually sequenced using Sanger sequencing methodology and computational was performed to identify overlapping pieces, like a jigsaw puzzle. This assembly would result in a draft scaffold. The video below is taken from yourgenome.org (CC-BY) and illustrates the sequencing of the human genome through the shotgun sequencing approach.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/08%3A_Analyzing_DNA/8.10%3A_Sanger_Sequencing_of_DNA.txt

Expansion of Sequencing Technology Credit: Jeremy Seto (CC-BY-NC-SA 3.0) Traditional sequencing of genomes was a long and tedious process that cloned fragments of genomic DNA into plasmids to generate a genomic DNA library (gDNA). These plasmids were individually sequenced using Sanger sequencing methodology and computational was performed to identify overlapping pieces, like a jigsaw puzzle. This assembly would result in a draft scaffold. As technology improved, the cost of sequencing genomes became less expensive. This technology outpaced Moore’s Law, a semiconductor projection about the speed of computers as time progressed. A dramatic price decrease in the cost of genome sequencing occurred around 2008 due to technical advances. As the cost of genome sequencing decreased, a dramatic increase in genome deposition into Genbank was observed. These deposits reflected small genomes of bacteria and archaea. Credit: Estevezj (CC-BY-SA 3.0) The decrease in per nucleotide sequencing cost came from the parallelization of sequencing. Whereas Sanger Sequencing is capable of sequencing one stretch at a time, a parallel assembly of sequencing reactions has led to the high throughput sequencing often dubbed Next Generation Sequencing (NGS). The Next Generation of Sequencing: High-Throughput Technologies Credit: Lex Nederbragt (CC-BY 3.0) Short Read Sequencing by Synthesis Illumina Illumina short-read sequencing uses flow cell technology where oligonucleotides complementary to adapter primers are physically seeded. Flow cell surface with the adapter oligonucleotides. Credit: DMLapato (CC-BY-SA 4.0) Fragmented DNA sequences are adapted with primers through ligation and hybridized to the flow cell. To increase the signal from sequencing, the short DNA sequences are amplified through a process called bridge amplification or cluster generation. Cluster generation through bridge amplification. A low numb er of PCR cycles is used. Cluster generation aids in subsequent signal/noise determination. Credit: DMLapato (CC-BY-SA 4.0) The flow cell undergoes successive rounds of flooding with a fluorescent nucleotide, permitted to incorporate with a DNA polymerase and washed away. After each flood/wash cycle, fluorescent signals are measured to indicate the incorporation. Specific locations of fluorescence are tracked and consolidated to indicate the sequence at each registered point. Each flow cycle introduces a fluorescent nucleotide for incorporation. Credit: Abizar Lakdawalla (CC-BY 3.0) Ion Torrent Fragmented DNA is ligated to adapter sequences and adhered onto microbeads. The beads are embedded into microwells on a semiconductor. Ion Torrent performs the sequencing reactions in an unbuffered solution since the semiconductor acts as a pH meter to identify nucleotide incorporation. Standard nucleotides are flooded onto the chip and incorporated. Because nucleotide incorporation creates a proton (H+), a microenvironment of low pH is detected in the unbuffered solution. Single-Molecule Real-Time Sequencing Pac Bio Pac Bio uses nano wells with covalent-bonded DNA polymerase to sequence individual molecules of DNA. Fluorescent nucleotides are incorporated during synthesis reactions and real-time incorporation can be measured. Pac Bio sequencing has the advantage of sequencing fragments of 10-20kb, in stark contrast to the short-read methods. Oxford Nanopore Credit: George Church (CC-BY 3.0) Oxford Nanopore utilizes the protein alpha-hemolysin integrated onto a semiconductor chip. The pore size of the protein is the correct ssize for a single DNA molecule to fit through. A DNA Polymerase molecule is linked to the opening of the pore where the replicated DNA is fed through. As the DNA traverses the pore, the voltage changes are measured and mapped to the qualities of specific bases. Link: youtu.be/BNz880V52rQ Sequence Output A sample ab1 file displaying the base calls, the chromatograms and the quality scores for each base. Notice the poor quality in the red box and the corresponding peaks/bases. The output file of the next-generation sequencing methods utilizes the fastq format. Like a fasta file, there is a header that describes the sequence. The first line is the header or title line which begins with ‘@‘ (remember that fasta begins with ‘>‘). The second line is the actual raw sequence (once again similar to fasta). The third line has no meaning while the fourth line is filled with symbols as long as the sequence line. This last line is the quality score of the base call. As with the Sanger sequencing, there may be ambiguity with the base call of the sequence and the certainty is maintained in the quality score. Sample fastq file displaying 5 short-read sequences. Phred scores were developed to assess the quality of the base calls arising from fluorescent Sanger sequencing during the Human Genome Project. The phred program scans the peaks of the chromatogram and scores based on the certainty or accuracy of the call. The scores are logarithmically based and scores greater than 20 represent greater than 99% accuracy of the base call. Using the phred scores embedded in the last line of fastq files, poor quality reads can be removed. Using a program like FastQC permits the assessment of the reads and produces the graphical representation of quality. FastQC quality output illustrating the Phred score for each base call. This short read sequence of about 100 nucleotides has all bases made at greater than 30, or > 99.9% accuracy. Assembly and Alignment Sequences from short reads must be assembled into a usable sequence. To do so, a reference genome may aid in the assembly after adapter sequences are trimmed using automated methods. In the case that there is no reference genome, a related species may be used or a more computationally intensive process of de novo assembly must take place. With de novo assembly, it may be useful to have some long reads performed with PacBio to create scaffolds for generating the assembly into contiguous sequences, or contigs. RNA-Seq Credit: Malachi Griffith, Jason R. Walker, Nicholas C. Spies, Benjamin J. Ainscough, Obi L. Griffith (CC-BY 4.0) https://doi.org/10.1371/journal.pcbi.1004393 Credit: Rgocs (CC-BY) RT-PCR and RT-qPCR can be used to measure the abundance of specific transcripts in a fairly low throughput way. Leveraging the concept of Reverse Transcription and coupling that to high-throughput sequencing technologies, transcripts can be sequenced and mapped to a genome to depict the quantity of transcripts as represented by the number of reads. Given sufficient read coverage, novel splice isoforms can also be identified as different exon-exon junctions are identified. The general workflow of RNA-Seq analysis follows: Credit: Salubrious Toxin (CC-BY-SA 4.0)

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/08%3A_Analyzing_DNA/8.11%3A_Next_Gen_Sequencing.txt

• 9.1: Introduction In the mid-1800s, an Augustinian friar named Gregor Mendel formalized quantitative observations on heredity in the pea plant. He undertook hybridization experiments that utilized purebred or true-breeding plants with specific qualities over many generations to observe the passage of these traits. Some of these physical traits included: seed shape, flower color, plant height, and pod shape. • 9.2: Bitter Taste (Activity) Some of our personal preferences arise from the way we were brought up. Culture plays a role in our likes and dislikes. Likewise, our experiences play a role in how we respond to certain stimuli. In our search for nutritive compounds, we have learned to avoid things that don’t taste good. Bitter things have a tendency to be associated with toxic compounds in nature. Hence, something bitter might make us learn to avoid this food item in the future. • 9.3: Sex-linked Genes For the most part, mammals have gender determined by the presence of the Y chromosome. This chromosome is gene poor and a specific area called sex determining region on Y (SRY) is responsible for the initiation of the male sex determination. The X-chromosome is rich in genes while the Y-chromosome is a gene desert. The presence of an X-chromosome is absolutely necessary to produce a viable life form and the default gender of mammals is traditionally female. • 9.4: Probability and Chi-Square Analysis Punnett Squares are convenient for predicting the outcome of monohybrid or dihybrid crosses. The expectation of two heterozygous parents is 3:1 in a single trait cross or 9:3:3:1 in a two-trait cross. Performing a three or four trait cross becomes very messy. In these instances, it is better to follow the rules of probability. Probability is the chance that an event will occur expressed as a fraction or percentage. • 9.5: Non-Mendelian Genetics During Mendel’s time, people believed in a concept of blending inheritance whereby offspring demonstrated intermediate phenotypes between those of the parental generation. This was refuted by Mendel’s pea experiments that illustrated a Law of Dominance. Despite this, non-Mendelian inheritance can be observed in sex-linkage and co-dominance where the expected ratios of phenotypes are not observed clearly. • 9.6: Hardy-Weinberg and Population Genetics The Hardy-Weinberg principle is a mathematical model used to describe the equilibrium of two alleles in a population in the absence of evolutionary forces. This model was derived independently by G.H. Hardy and Wilhelm Weinberg. It states that the allele and genotype frequencies across a population will remain constant across generations in the absence of evolutionary forces. 09: Genetics Writing the Rules of Heredity: In the mid-1800s, an Augustinian friar named Gregor Mendel formalized quantitative observations on heredity in the pea plant. He undertook hybridization experiments that utilized purebred or true-breeding plants with specific qualities over many generations to observe the passage of these traits. Some of these physical traits included: seed shape, flower color, plant height, and pod shape. The pea plant (Pisum sativum) offered a great advantage of being able to control the fertilization process and having large quantities of offspring in a short period of time. In a simple experiment of tracking the passage of a single trait (monohybrid cross) like flower color through multiple generations, he was able to formulate rules of heredity. In this case, pea plants either produced white flowers or purple flowers for many generations (true-breeding purple flower or true breeding white flower). These true-breeding plants are referred to as the Parental Generation (P). By removing the male parts of the pea flower (anthers containing pollen), Mendel was able to control for self-pollination. The hybridization came from applying the pollen from one true-breeding plant to the female part (the pistil) of the opposite true-breeding plant. The subsequent offspring are referred to as the First Filial Generation (F1). In the first generation, all the flowers are purple. Permitting self-pollination generates a Second Filial Generation (F2). This generation sees the re-emergence of the white-flowered plants in an approximate ratio of 3 purple-flowered to 1 white-flowered plants. Pea flowers Male and female parts of flowers. Mendel removed the anthers containing pollen to prohibit self-pollination and selectively applied the pollen to stigmas in order to control the “hybridization”. The loss of one variant on the trait in the F1 plants with the re-emergence in the F2prompted Mendel to propose that each individual contained 2 hereditary particles where each offspring would inherit 1 of these particles from each parent. Furthermore, the loss of one of the variants in the F1 was explained by one variant masking the other, as he explained as being dominant. The re-emergence of the masked variation, or recessive trait, in the next generation was due to both particles being of the masked variety. We now refer to these hereditary particles as genes and the variants of the traits as alleles. Mendel’s Rules of Segregation and Dominance: The observations and conclusions that Mendel made from the monohybrid cross identified that inheritance of a single trait could be described as passage of genes (particles) from parents to offspring. Each individual normally contained two particles and these particles would separate during the production of gametes. During sexual reproduction, each parent would contribute one of these particles to reconstitute offspring with 2 particles. In the modern language, we refer to the genetic make-up of the two “particles” (in this case, alleles) as the genotype and the physical manifestation of the traits as the phenotype. Therefore, Mendel’s first rues of inheritance are as follows: 1. Law of Segregation • During gamete formation, the alleles for each gene segregate from each other so that each gamete carries only one allele for each gene 2. Law of Dominance • An organism with at least one dominant allele will have the phenotype of the dominant allele. • The recessive phenotype will only appear when the genotype contains 2 recessive alleles. This is referred to as homozygous recessive • The dominant phenotype will occur when the genotype contains either 2 dominant alleles (homozygous dominant) or one dominant and one recessive (heterozygous) The F1 cross (Punnett square) illustrating flower color inheritance in the F2 Punnett Square is a tool devised to make predictions about the probability of traits observed in the offspring in the F2 generation and illustrate the segregation during gamete formation. The Single Trait Cross (Monohybrid Cross): Monohybrid cross (one trait cross) observing the pod shape of peas. Monohybrid cross (on trait cross) observing the pod color of peas. Corn Coloration in an F2 Population (Activity): A corn cob contains hundreds of kernels. Each kernel is a seed that represents an individual organism. In the cob, we can easily see kernel color as a phenotype. 1. Retrieve an F2 corn cob 2. Count a total of 100 kernels 1. Tally the number of Yellow Kernels within that 100 (in the dried state, anything yellow or honey-colored counts as yellow) 2. Tally the number of Purple Kernels within that 100 (in the dried state, purple colored kernels may appear brown) 3. Ignore any speckled kernels that may have yellow and purple within them 3. Compare numbers with the class as a whole 4. From the numbers: 1. Is there a dominant color?____________________________________________________________________________________________________________________ 2. Which is dominant, if there is?_________________________________________________________________________________________________________________ 3. Create a Punnett square to illustrate the expected number of each color in a simple dominant:recessive paradigm. The Two Trait Cross (Dihybrid Cross): Mendel continued his experimentation where he looked at two traits. These two trait crosses are called dihybrid crosses. While the monohybrid cross would yield 3:1 ratio of the phenotypes, the dihybrid crosses would yield 9:3:3:1 ratio of all the combinations of each phenotype. Mendel’s Rule of Independent Assortment: The dihybrid cross revealed another law of inheritance to Mendel. By observing the 9:3:3:1 ratio, Mendel concluded that traits were not tied to each other. That is to say, if a pea pod was yellow, it could still be either smooth or wrinkled in texture. This lack of linkage between genes yielding different characteristics was dubbed the Law of Independent Assortment. Genes for different traits can segregate independently during the formation of gametes. Kernel Coloration and Texture in an F2 Population (Activity): 1. Retrieve a dihybrid F2 corn cob 2. Count a total of 200 kernels 1. Tally the number of Yellow Kernels that are rounded and smooth in texture 2. Tally the number of Yellow Kernels that are shriveled and wrinkly in texture (honey-colored) 3. Tally the number of Purple Kernels within that rounded and smooth in texture 4. Tally the number of Purple Kernels within that are shriveled and wrinkly in texture 5. Ignore any speckled kernels that may have yellow and purple within them 3. Compare numbers with the class as a whole 4. Each kernel constitutes an individual organism ( a seed that can give rise to a whole new plant). From the numbers: 1. Is there a dominant texture (smooth or shriveled)?________________________________________________________________________________________________ 2. Which is dominant, if there is?_________________________________________________________________________________________________________________ 3. Is there a color that always pairs with a texture or do these characteristics assort independently?___________________________________________________________ 4. Create a Punnett square to illustrate the expected number of each color/texture combination in a simple dominant:recessive paradigm.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/09%3A_Genetics/9.01%3A_Introduction.txt

Genetics leaves a bad taste in my mouth… or not Some of our personal preferences arise from the way we were brought up. Culture plays a role in our likes and dislikes. Likewise, our experiences play a role in how we respond to certain stimuli. Another major factor that plays a role in our preferences comes wired in our genome. The DNA in our cells is the instruction manual for who we are. We are programmed to seek out things of nutritive values in order to acquire raw materials like carbohydrates, proteins, and lipids. In our search for nutritive compounds, we have learned to avoid things that don’t taste good. Bitter things have a tendency to be associated with toxic compounds in nature. When eating a food item for the first time, molecules hit our tongue and stimulate multiple sensations: sweet, sour, salty, savory, and bitter. Attributed to these multiple taste types are a diverse family of receptors that bind to the molecules that result in our perception of these sensations. Something bitter might make us learn to avoid this food item in the future. One type of bitter receptor senses the presence of a chemical called phenylthiocarbamide (PTC). This chemical chemically resembles toxic compounds found in plants but is non-toxic. The ability to taste PTC comes from a gene called TAS2R38. This gene encodes a protein that on our tongues that communicates the bitterness of this chemical. There are two common alleles of this gene with at least five more uncommon variants. Within the two common forms, a single nucleotide polymorphism (SNP) is responsible for changing one amino acid in the receptor. It’s this difference of one amino acid that results in the ability of the receptor to either respond or not respond to PTC. We inherit one copy of the gene from our father and one copy from our mother. How our parents' gametes formed and what alleles we received during the fertilization event determines how we respond to this chemical. Because we each have 2 copies of this gene, we can utilize simple Mendelian genetics to understand which allele is dominant or recessive. 1. Place a piece of “Control” paper on the tongue and indicate if there is a taste. 2. Place a piece of “PTC” paper on the tongue and indicate if there is a taste and the taste severity. 3. Fill out the table for the class to identify how many non-tasters, tasters, or super-tasters there are. 4. Indicate if you believe the trait is dominant or recessive (ability to taste or not taste). 5. Assign a descriptor allele for the dominant (a capital letter) or the recessive (a lowercase letter) and draw a Punnet square for the F2 generation of 2 Heterozygous parents. 6. Compare the class tally of tasters and non-tasters in the class and discuss with your instructor if there is a clear dominance of this trait. Table: PTC Tasting Tally Phenotypes Number % Total PTC Tasters (Dominant or Recessive) PTC Non-tasters (Dominant or Recessive) Total Questions: 1. How do you explain the presence of those who can’t taste PTC, those who can taste it and those who really can’t stand the taste of it? 2. This chemical is non-toxic and doesn’t exist in nature. Do you think there is a selective pressure that confers an advantage to those who do taste it? Exercise: Coding Bitterness: Prior to this exercise, review the Central Dogma. The full coding sequence of TAS2R38 is 1,002 bases (334 amino acids) long. A segment of the gene is shown below where the SNP (in red) occurs. Variant 1 is the version of the gene that encodes for the ability to taste PTC. Variant 2 is the version of the gene that is unable to bind to PTC. This SNP mutation is called a missense mutation because it changes the amino acid. Some mutations cause the insertion of a premature stop codon. This nonsense mutation results in a truncated protein and can be disastrous to the function. We already know that the simple substitution of one nucleotide translates to a change in one amino acid and determines the ability to taste PTC. Imagine if a large group of amino acids from the protein was missing. With the template strand (“Complement”) information: 1. Write the sequence of the coding strand. 2. Write the sequence of the mRNA 3. Use the Genetic Code Chart to translate the amino acid sequence Variant 1 Coding Strand : 5′- Complement : 3′-TTC TCC GTC CGT GAC TCG-5′ mRNA : 5′- Amino Acid : Variant 2 Coding Strand : 5′- Complement : 3′-TTC TCC GTC GGT GAC TCG-5′ mRNA : 5′- Amino Acid : PCR Genotyping the TAS2R38 PTC receptor: • 5’-CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG-3’ (Forward Primer) • 5′-AGGTTGGCTTGGTTTGCAATCATC-3′ (Reverse Primer) 1. PCR the DNA samples extracted from cheek cells using the PCR Beads. 2. Pour 2% agarose into casting apparatus in refrigerator. • 2 gels per class need to be made → 100ml of TBE with 2g agarose. • Add 5μl SYBR safe solution into the molten agarose before casting. • Place 2 sets of combs into the gel → at one end and in the middle. 3. Digest PCR product with Hae III. 1. Remove 10μl of PCR product into a fresh tube. 2. Add 1μl of HaeIII enzyme into the tube. 3. Incubate for 10 minutes at 37°C. 4. Load gel with DNA ladder, Digested and Undigested. • the undigested sample is from the original PCR. 5. Run gel at 120V for 20 minutes. 6. Visualize on the UV transilluminator. SNP Detection: The longer primer ends with the sequence “GG”. Both alleles at this locus will amplify equally well with this primer set, however, one allele will have the sequence “GGGC” and another “GGCC”. “GGCC” is the restriction site for the enzyme HaeIII. The digestion of this amplified DNA will be digestible for one allele and yield a DNA fragment the size of the large primer (44 bp) as well as the remainder of the amplicon. Because of this difference in digestion profile of the amplicon, we can identify the 2 alleles at this locus. Analysis Questions: 1. What is the size of the PCR product? • Perform an in silico PCR on the Tas2R38 gene and identify the size of the amplicon. 2. The long primer is 44bp. If the amplicon of the allele digests, what are the sizes of fragments expected following HaeIII? 3. Which allele is the one that can be identified through Hae III digestion? • Use the results of the PTC paper test. 4. Some lanes contain 3 bands instead of 1 or 2. Can you explain this?

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/09%3A_Genetics/9.02%3A_Bitter_Taste_%28Activity%29.txt

Sex Chromosomes For the most part, mammals have gender determined by the presence of the Y chromosome. This chromosome is gene-poor and a specific area called sex-determining region on Y (SRY) is responsible for the initiation of the male sex determination. The X-chromosome is rich in genes while the Y-chromosome is a gene desert. The presence of an X-chromosome is absolutely necessary to produce a viable life form and the default gender of mammals is traditionally female. Chromosomal painting techniques can reveal the gender origin of mammalian cells. By using fluorescent marker sequences that can hybridize specifically to X or Y chromosomes through Fluorescence In Situ Hybridization (FISH), gender can be identified in cells. Ishihara Tests (Activity) The genes encoding photoreceptor proteins for the long wave-length (reds) and middle wavelengths (greens) reside on the X chromosome at Xq25. Since the Y-chromosome is not homologous, any mutation to either of these genes that render them non-functional results in an inability to perceive either of those colors. Men are more susceptible to the condition of red-green colorblindness since they are hemizygous. This means that there is no corresponding gene that could complement a deficient red or green photoreceptor gene. Monochromatic representation of Ishihara test to a colorblind individual as it emerges to something visible to a color-sighted individual. Dr. Shinobu Ishihara published his test for color perception in 1917 and this test is widely used to detect deficits in color perception. Below are examples of the Ishihara plates. Record the number that you perceive in each plate and discuss with the rest of the class. Ishihara Test 1. As you go through the plates above, note the number that you see (if any). 2. The genes for the Red and Green receptors are on the X-chromosome, who are most affected by mutation? Create a Punnett Square to illustrate how this works. 3. Can women be color-blind for red/green? 4. Humans have 3 color light receptors and have trichromatic vision. Some women are described as possibly having tetrachromatic vision (seeing 4 colors) and being able to discriminate colors invisible to the rest of us. Describe a mechanism for why this could happen. Why is there a possible gender bias? The Case of Queen Victoria Hemophilia literally translates to blood-loving. This is a description of a series of disorders where an individual has an inability to clot blood after a cut. In modern times, clotting factors may be administered to an afflicted individual, but a prior treatment involved blood transfusions. A very famous family had a genetic predisposition to hemophilia and due to the proliferative nature of this family, we have some statistical power to verify predictions on the probabilities of passing the disease state. Below is a partial pedigree for Victoria, Queen of the United Kingdom of Great Britain and Ireland and Empress of India. The filled-in shapes represent individuals who suffered from hemophilia. Credit: Jeremy Seto (CC-BY-SA) Questions: 1. From the pedigree above, what can you say about this form of hemophilia with respect to dominance? 2. From this pedigree, can you comment on the probable chromosome where the deficiency occurs? 3. Assign genotypes for Prince Albert and Queen Victoria and perform a Punnett Square to illustrate if their offspring reflect your statements on dominance and chromosome location. 4. Albert and Victoria were 1st cousins. Do you believe this had anything to do with the propagation of this disease? What does your Punnett Square tell you? 5. Highlight the definitive carriers of the disease gene in the pedigree above. X-Inactivation The mammalian X-chromosome contains significantly more genetic information than the Y-chromosome. This gene dosage is controlled for in females through a process called X-inactivation where one of the X-chromosomes is shut down and highly condensed into a Barr body. Inactivation of the X-chromosome occurs in a stochastic manner that results in females being cellular mosaics where a group of cells has inactivated the paternal X-chromosome and other patches of cells have inactivated the maternal X-chromosome. The most striking example of mosaicism is the calico cat. A calico cat (tortoiseshell cat) is always a female. One of the genes that encodes coat color in cats resides on the X-chromosome and exist as either orange or black alleles. Due to the stochastic inactivation, the patterning of orange and black fur is a distinctive quality of calicos. Credit: Howcheng [CC-BY-SA-3.0] While the genetic information for the orange or black coat color exists in all cells, they are not equally expressed. This type of heritable trait in spite of the presence of the genetic material (DNA) is called epigenetic to imply that it is “above” (epi) genetics. Drosophila: Thomas Hunt Morgan Around 1908, Thomas Hunt Morgan began to explore the genetics of what was to become a model organism, Drosophila melanogaster (Fruit fly). This small organism had a relatively short life cycle, great fecundity and was easily managed. From these flies that normally have red eye coloring, he and his students found white-eyed mutants. The lab noted that white-eyed flies were almost exclusively male. This gender imbalance led Morgan to believe that the trait was sex-linked. In 1911, Morgan published a paper that described the inheritance patterns of 5 eye-colors in Drosophila (Morgan, 1911). Drosophila follows a sex determination based on the ratio of X:A chromosomes and not by the presence of a Y as in mammals. A 1:1 ratio results in a female and a 1:2 ratio results in a male where the Y is ignored. The standard 2N = 8. Credit: GYassineMrabet [CC-BY-SA 4.0] While DNA was not yet known as the source of genetic information, Morgan’s studies revealed that the location of genes most likely resided on the chromosomes. By cataloging many mutations in the lab, he was able to construct a map of gene locations. His 1922 paper specifically stated that some traits were sex-linked and therefore residing on the sex chromosome. When performing crosses of white-eyed males to wild-type females, he continued to find white-eyed trait only in males. However, in the subsequent cross of females from that generation with white-eyed males, the presence of white-eyed males and females were revealed. This indicated that the white-eyed trait was recessive and resided on the X chromosome. Analysis of the transmission of “White-Eyed” color in Drosophila. Credit: Jeremy Seto (CC-BY-SA) Morgan received the Nobel Prize in Physiology or Medicine in 1933 for his inference of chromosomes being a physical mechanism for packaging genetic information in the cells.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/09%3A_Genetics/9.03%3A_Sex-linked_Genes.txt

Probability: Past Punnett Squares Punnett Squares are convenient for predicting the outcome of monohybrid or dihybrid crosses. The expectation of two heterozygous parents is 3:1 in a single trait cross or 9:3:3:1 in a two-trait cross. Performing a three or four trait cross becomes very messy. In these instances, it is better to follow the rules of probability. Probability is the chance that an event will occur expressed as a fraction or percentage. In the case of a monohybrid cross, 3:1 ratio means that there is a $\frac{3}{4}$ (0.75) chance of the dominant phenotype with a $\frac{1}{4}$ (0.25) chance of a recessive phenotype. A single die has a 1 in 6 chance of being a specific value. In this case, there is a $\frac{1}{6}$ probability of rolling a 3. It is understood that rolling a second die simultaneously is not influenced by the first and is therefore independent. This second die also has a $\frac{1}{6}$ chance of being a 3. We can understand these rules of probability by applying them to the dihybrid cross and realizing we come to the same outcome as the 2 monohybrid Punnett Squares as with the single dihybrid Punnett Square. This forked line method of calculating probability of offspring with various genotypes and phenotypes can be scaled and applied to more characteristics. The Chi-Square Test The χ2 statistic is used in genetics to illustrate if there are deviations from the expected outcomes of the alleles in a population. The general assumption of any statistical test is that there are no significant deviations between the measured results and the predicted ones. This lack of deviation is called the null hypothesis (H0). X2 statistic uses a distribution table to compare results against at varying levels of probabilities or critical values. If the X2 value is greater than the value at a specific probability, then the null hypothesis has been rejected and a significant deviation from predicted values was observed. Using Mendel’s laws, we can count phenotypes after a cross to compare against those predicted by probabilities (or a Punnett Square). In order to use the table, one must determine the stringency of the test. The lower the p-value, the more stringent the statistics. Degrees of Freedom (DF) are also calculated to determine which value on the table to use. Degrees of Freedom is the number of classes or categories there are in the observations minus 1. DF=n-1 In the example of corn kernel color and texture, there are 4 classes: Purple & Smooth, Purple & Wrinkled, Yellow & Smooth, Yellow & Wrinkled. Therefore, DF = 4 – 1 = 3 and choosing p < 0.05 to be the threshold for significance (rejection of the null hypothesis), the X2 must be greater than 7.82 in order to be significantly deviating from what is expected. With this dihybrid cross example, we expect a ratio of 9:3:3:1 in phenotypes where 1/16th of the population are recessive for both texture and color while $\frac{9}{16}$ of the population display both color and texture as the dominant. $\frac{3}{16}$ will be dominant for one phenotype while recessive for the other and the remaining $\frac{3}{16}$ will be the opposite combination. With this in mind, we can predict or have expected outcomes using these ratios. Taking a total count of 200 events in a population, 9/16(200)=112.5 and so forth. Formally, the χ2 value is generated by summing all combinations of: $\frac{(Observed-Expected)^2}{Expected}$ Chi-Square Test: Is This Coin Fair or Weighted? (Activity) 1. Everyone in the class should flip a coin 2x and record the result (assumes class is 24). 2. Fair coins are expected to land 50% heads and 50% tails. • 50% of 48 results should be 24. • 24 heads and 24 tails are already written in the “Expected” column. 3. As a class, compile the results in the “Observed” column (total of 48 coin flips). 4. In the last column, subtract the expected heads from the observed heads and square it, then divide by the number of expected heads. 5. In the last column, subtract the expected tails from the observed tails and square it, then divide by the number of expected tails. 6. Add the values together from the last column to generate the X2 value. 7. Compare the value with the value at 0.05 with DF=1. • There are 2 classes or categories (head or tail), so DF = 2 – 1 = 1. • Were the coin flips fair (not significantly deviating from 50:50)? Let’s say that the coin tosses yielded 26 Heads and 22 Tails. Can we assume that the coin was unfair? If we toss a coin an odd number of times (eg. 51), then we would expect that the results would yield 25.5 (50%) Heads and 25.5 (50%) Tails. But this isn’t a possibility. This is when the X2 test is important as it delineates whether 26:25 or 30:21 etc. are within the probability for a fair coin. Chi-Square Test of Kernel Coloration and Texture in an F2 Population (Activity) 1. From the counts, one can assume which phenotypes are dominant and recessive. 2. Fill in the “Observed” category with the appropriate counts. 3. Fill in the “Expected Ratio” with either 9/16, 3/16 or 1/16. 4. The total number of the counted event was 200, so multiply the “Expected Ratio” x 200 to generate the “Expected Number” fields. 5. Calculate the $\frac{(Observed-Expected)^2}{Expected}$ for each phenotype combination 6. Add all $\frac{(Observed-Expected)^2}{Expected}$ values together to generate the X2 value and compare with the value on the table where DF=3. 7. Do we reject the Null Hypothesis or were the observed numbers as we expected as roughly 9:3:3:1? • What would it mean if the Null Hypothesis was rejected? Can you explain a case in which we have observed values that are significantly altered from what is expected?

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/09%3A_Genetics/9.04%3A_Probability_and_Chi-Square_Analysis.txt

Co-Dominance and Multiple Alleles Co-dominance is said to occur when there is an expression of two dominant alleles. The prototypical case for this is the human ABO blood grouping. Three alleles exist in the ABO system: A, B and O. This results in four blood types: A, B, O and the blended AB. Incomplete Dominance During Mendel’s time, people believed in a concept of blending inheritance whereby offspring demonstrated intermediate phenotypes between those of the parental generation. This was refuted by Mendel’s pea experiments that illustrated a Law of Dominance. Despite this, non-Mendelian inheritance can be observed in sex-linkage and co-dominance where the expected ratios of phenotypes are not observed clearly. Incomplete dominance superficially resembles the idea of blending inheritance, but can still be explained using Mendel’s laws with modification. In this case, alleles do not exert full dominance and the offspring resemble a mixture of the two phenotypes. Incomplete dominance in snapdragon flowers superficially appears like blending inheritance. Credit: Jeremy Seto (CC-BY-NC-SA) The most obvious case of a two allele system that exhibits incomplete dominance is in the snapdragon flower. The alleles that give rise to flower coloration (Red or White) both express and the heterozygous genotype yields pink flowers. There are different ways to denote this. In this case, the superscripts of R or W refer to the red or white alleles, respectively. Since no clear dominance is in effect, using a shared letter to denote the common trait with the superscripts (or subscripts) permit for a clearer denotation of the ultimate genotype to phenotype translations. Problem: Incomplete Dominance If pink flowers arose from blending inheritance, then subsequent crosses of pink flowers with either parental strain would continue to dilute the phenotype. Using a Punnet Square, perform a test cross between a heterozygous plant and a parental to predict the phenotypes of the offspring. Epistasis and Modifier Genes: The interplay of multiple enzymes in a biochemical pathway will alter the phenotype. Some genes will modify the actions of another gene. Credit: Jeremy Seto (CC0) Genes do not exist in isolation and the gene products often interact in some way. Epistasis refers to the event where a gene at one locus is dependent on the expression of a gene at another genomic locus. Stated another way, one genetic locus acts as a modifier to another. This can be visualized easily in the case of labrador retriever coloration where three primary coat coloration schemes exist: black lab, chocolate lab, and yellow lab. Chocolate lab (top), Black lab (middle), Yellow lab (bottom) coat colorations arise from the interaction of 2 gene loci, each with 2 alleles. Credit: Erikeltic [ CC-BY-SA 3.0] Two genes are involved in the coloration of labradors. The first is a gene for a protein called TYRP1, which is localized to the melanosomes (pigment storing organelles). Three mutant alleles of this gene have been identified that reduce the function of the protein and yield lighter coloration. These three alleles can be noted as “b” while the functioning allele is called “B“. A heterozygous (Bb) or a homozygous dominant individual will be black coated while a homozygous recessive (bb) individual will be brown. Black lab (BB or Bb) and Chocolate lab (bb). Credit: dmealiffe[CC BY-SA 2.0] The second gene is tied to the gene for Melanocortin 1 Receptor (MC1R) and influences if the eumelanin pigment is expressed in the fur. This gene has the alleles denoted “E” or “e“. A yellow labrador will have a genotype of either Bbee or bbee. Black lab (EE or Ee) and Yellow lab (ee) [CC0] The interplay between these genes can be described by the following diagram: Black lab (B_E_, Chocolate lab (bbE_), Yellow lab with dark skin where exposed (B _ee) and Yellow lab with light skin where exposed. Credit: Jeremy Seto (CC-BY-SA 3.0)

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/09%3A_Genetics/9.05%3A_Non-Mendelian_Genetics.txt

Hardy-Weinberg Principle The Hardy-Weinberg principle is a mathematical model used to describe the equilibrium of two alleles in a population in the absence of evolutionary forces. This model was derived independently by G.H. Hardy and Wilhelm Weinberg. It states that the allele and genotype frequencies across a population will remain constant across generations in the absence of evolutionary forces. This equilibrium makes several assumptions in order to be true: 1. An infinitely large population size 2. The organism involved is diploid. 3. The organism only reproduces sexually. 4. There are no overlapping generations. 5. Mating is random. 6. Allele frequencies equal in both genders 7. Absence of migration, mutation, or selection As we can see, many items in the list above can not be controlled for but it allows for us to make a comparison in situations where expected evolutionary forces come into play (selection etc.). Hardy-Weinberg Equilibrium The alleles in the equation are defined as the following: • Genotype frequency is calculated by the following:$\text { genotype frequency }=\frac{\# \text { individuals of given genotype }}{\text { total } \# \text { individuals in population }}$ • Allele frequency is calculated by the following:$\text { allele frequency }=\frac{\# \text { of copies of an allele in a population }}{\text { total } \# \text { of alleles in population }}$ • In a two allele system with dominant/recessive, we designate the frequency of one as p and the other as q and standardize to: • $p=\text { Dominant allele frequency }$ • $q=\text { recessive allele frequency }$ • Therefore the total frequency of all alleles in this system equal 100% (or 1) $p+q=1$ • Likewise, the total frequency of all genotypes is expressed by the following quadratic where it also equals 1:$p^{2}+2 p q+q^{2}=1$ This equation is the Hardy-Weinberg theorem that states that there are no evolutionary forces at play that are altering the gene frequencies. Calculating Hardy-Weinberg Equilibrium (Activity) This exercise refers to the PTC tasting exercise. One can test for selection for one allele within the population using this example. Though the class size is small, pooling results from multiple sections can enhance the exercise. Remember to surmise the dominant/recessive traits from the class counts. 1. What is the recessive phenotype and how can we represent the genotype? 2. What is the dominant phenotype and how can we represent the genotypes? 3. What is the frequency of recessive genotype? (q2) 4. What is the frequency of the recessive allele? (q) 5. What is the frequency of the dominant allele? (p=1-q) 6. Use Hardy-Weinberg to calculate the frequency of heterozygotes in the class. (2pq) 7. Use Hardy-Weinberg to calculate the frequency of homozygotes in the class. (p2) 8. Using an aggregate of multiple sections, compare the local allelic and genotypic frequencies with what the Hardy-Weinberg would predict. 9. With this small number in mind, we can see that there are problems with the assumptions required for this principle. The instructor will perform the following simulation in class to illustrate the effects on multiple populations with the effects of selection and /or population limitations. A coefficient of fitness can be applied to illustrate a selective pressure against an allele. • Population Genetics Simulation of Alleles 10. In the case of selective pressure, a fitness coefficient (w) can be introduced. A research article http://www.jci.org/articles/view/64240 has shown that the Tas2R38 receptor aids in the immune response against Pseudomonas. Imagine a situation where there is an epidemic of antibiotic-resistant Pseudomonas. This would show that the dominant allele will have a selective advantage. • Modify the fitness coefficient in the Population Genetics Simulator and describe the effects this would have over many successive generations.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/09%3A_Genetics/9.06%3A_Hardy-Weinberg_and_Population_Genetics.txt

• 10.1: Introduction Any uptake of genetic information from the external environment into cells that results in the expression of new traits is called genetic transformation. This process can occur naturally. Some bacteria are referred to as being “competent” to indicate that they are capable of taking DNA into the cell from the environment. This is referred to as natural competence. Bacteria are also capable of conjugation where plasmids from one bacteria are sent to another through the conjugation pilus. • 10.2: Bacterial Transformation (Activity) Escherichia coli are commensal gram-negative bacteria found in the guts of humans. They have the capacity to double every twenty minutes and make a favorable carrier of recombinant DNA. Plasmid DNA can be introduced into E. coli easily after making them competent. One method to achieve this is through chemical competence with heat shock. In this process, the bacteria are incubated in CaCl2 solution on ice. 10: DNA as the Genetic Material History of Genetic Transformation Any uptake of genetic information from the external environment into cells that results in the expression of new traits is called genetic transformation. This process can occur naturally. Some bacteria are referred to as being “competent” to indicate that they are capable of taking DNA into the cell from the environment. This is referred to as natural competence. Bacteria are also capable of receiving DNA through the process of conjugation where plasmids from one bacteria are sent to another through the conjugation pilus. Other methods of introduction of foreign DNA include direct injection into the cytosol or through the use of viruses in a process called transduction. In eukaryotic cells, we refer to the introduction of DNA as transfection. Frederick Griffith and the Transforming Agent At the beginning of modern biology, the source of genetic material was not known to be DNA. In fact, many scientists thought DNA was too simple to perform this job. Scientists believed that proteins, with their 20 varied amino acids, were the carriers of genetic information. In an attempt to develop a vaccine for bacterial-induced pneumonia, Frederick Griffith was the first to describe the process of genetic transformation by accident in 1928. Griffith took a virulent strain of bacteria (smooth in appearance) that caused pneumonia and injected them into mice. This would result in the death of the mice. He also observed that injection of a rough bacteria did not cause any disease. After heat-killing the smooth bacteria, he discovered that living bacteria of the virulent strain was required for the disease to progress. Finally, he observed that injecting the heat-killed virulent bacteria with living bacteria of the non-virulent strain resulted in pneumonia and death in the mice. From this experiment, a transforming agent with the capacity to pass on a trait was found to be within the contents of those dead cells. But no one knew this agent to be DNA at that point. Hershey and Chase Hershey and Chase studied bacteriophage (phage=eater). Phages are bacterial viruses that infect bacteria and cause lysis of the cells. They have a very simple structure of a proteinaceous head/collar/tail and a DNA core. It was known that bacteria infected with phage were resistant to additional infection. In 1952 Hershey and Chase grew bacteriophage in conditions that would specifically label either the DNA or the protein with radioactivity. They subsequently took phage with radiolabeled DNA and infected bacteria. In parallel, they took phage with radiolabeled protein and infected another set of bacteria. After just enough time for infection, the bacterial cultures were placed into a blender to separate the bacteriophage from the bacteria. Solutions were centrifuged to isolate bacteria from the phage. Bacteria were radioactive only when the phage grown in conditions to radiolabel DNA infected the bacteria to indicate that DNA might be the transforming agent. Questions to Think About 1. What isotope would be used to label protein? 2. What isotope would be used to label just DNA? Avery, McCarty, and MacCleod In 1944, Oswald Avery, Colin MacCleod and Maclyn McCarty repeated Griffith’s experiment. Instead of using heat-killed bacteria, these scientists isolated protein, carbohydrates, lipids and nucleic acids from the virulent strain and co-injected with the non-virulent bacteria. Carbohydrate extracts were ineffective at transforming bacteria. Protein extracts were incapable of causing transformation. Lipid injections were unable to result in virulence. Only nucleic acid samples treated with RNase were capable of transforming bacteria. When co-injecting with DNase, bacteria were not transformed. Along with Hershey-Chase, this definitively illustrated that DNA was the transforming agent capable of transferring genetic information.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/10%3A_DNA_as_the_Genetic_Material/10.01%3A_Introduction.txt

Bacterial Transformation Escherichia coli are commensal gram-negative bacteria found in the guts of humans. They have the capacity to double every twenty minutes and make a favorable carrier of recombinant DNA. Plasmid DNA can be introduced into E. coli easily after making them competent. One method to achieve this is through chemical competence with heat shock. In this process, the bacteria are incubated in CaCl2 solution on ice. The cold serves to slow down the molecular motion of the plasma membrane while the Ca2+ ions remove the charge-charge repulsion between the phospholipids and the negatively charged DNA seeking to gain entry into the cell. Cells are placed for a short period of time at 42°C to induce heat shock. This heat shock results in the cell taking up the DNA. This method is very low efficiency so many bacteria do not take in any DNA. Cells are allowed to recover from heat shock at 37°C in rich nutrient broth to allow for the production of the antibiotic resistance proteins encoded on the vector as a selection marker. Transformed cells are then spread across an agar plate containing the antibiotic which will then kill all non-transformed cells. Only the bacteria containing the vector with the antibiotic resistance gene will survive and replicate to form small colonies on the surface of the agar. Exercise: Transformation of Bacteria with RE Identified Plasmids 1. Each group retrieves the 2 mini-prepped plasmids from the previous week in the freezer and allow to thaw on ice. 2. Bring 2 agar plates to room temperature • 2 plates will contain antibiotic, X-Gal, and arabinose 1. For each plasmid, obtain 250μl of transformation buffer (50mM CaCl2) in microfuge tubes and place on ice for 10 minutes. 2. Take an inoculating loop and remove a single colony of bacteria from a freshly streaked plate grown overnight. 3. Swirl bacteria in each tube containing transforming solution to distribute bacteria throughout the solution. 4. Pipette 5 μl of the plasmid into the tube and incubate on ice for 10 minutes. 5. During this incubation, flip the warmed plates and label them with your group names. 6. Place transformation tubes into 42°C heat block for 1 minute to heat shock the cells. 7. Add 500μl fresh SOC media (or LB) and incubate at 37°C for 15 minutes. 8. Pipette 150μl of transformation solution onto each plate and spread across the plate. 9. Turn plates agar side up and place them into 37°C incubator overnight. (your instructor will retrieve them and place them into the refrigerator). Hypothesize: What Will I Expect of My Transformed Cells? From the previous lab, we can identify our plasmids. The plasmids are either pGlo, pUC18/19 or pUC18/19 with a 6kb insert disrupting the LacZ gene. pGlo contains a gene that encodes the protein GFP that will fluoresce green under UV light and is 5.4kb. pUC is typically 2.7kb in size. LacZ is a gene encoding the protein β-Galactosidase, the enzyme that hydrolyzes lactose into the monosaccharides galactose and glucose. X-Gal is a chemical resembling lactose. However, upon hydrolysis, the molecule deposits a blue coloring into the cell. pUC19 genbank file pGlo genbank file pUC with insert file 1. If the previously mentioned plasmids were digested by EcoRI, label the lanes below with the appropriate plasmid (pGlo, pUC, and pUC-inserted) 2. Predict if your transformants will be green under UV, white in all conditions or blue. 3. For additional help on this problem, utilize the In silico digestion activity.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/10%3A_DNA_as_the_Genetic_Material/10.02%3A_Bacterial_Transformation_%28Activity%29.txt

• 11.1: Introduction DNA was described as a molecule consisting of 2 anti-parallel strands in a double helix by Francis Crick and James Watson. The elegant model illustrated the intrinsic redundancy that made DNA a suitable data storage vessel for genetic information. Francis Crick later posited a notion of how this information went from storage to an actual program that runs cells. Crick first posited it as a “sequence hypothesis”. This idea of information flow is called the Central Dogma of Molecular Biology. • 11.2: Prokaryotic Transcription Glucose is the preferred energy source of cells. François Jacob and Jacques Monod sought to understand how bacteria made decisions to switch between different sugars as sources of energy. Jacob and Monod found that if glucose and lactose were presented as food for bacteria, there would be a biphasic growth pattern. Monod found that when lactose was the sole sugar, the expression of the enzyme β-galactosidase was induced and displayed a monophasic growth with a delay. • 11.3: RNA Miniprep (Activity) RNA purification occurs similar to DNA preparations. A silica-based column is used where DNA is excluded from binding based on size and through an additional DNA digestion step using the enzyme DNase I. RNA is extremely fragile and prone to degradation. Thus, separate pipettes and plastics are usually used in labs to reduce the amount of exposure to environmental or experimental RNase. This page contains instructions on how to prepare RNA and perform a reverse transcription of eukaryotic mRNA • 11.4: Quantitative Nucleic Acid Measurement Measurements can be made of individual genes of interest through PCR of those specific genes. A process known as Real-Time PCR or quantitative PCR (qPCR) is used to measure individual genes using fluorescence measurements. An intercalating agent that binds only to double-stranded DNA called Sybr Green is used in a qPCR machine that is measuring fluorescence after each cycle of PCR indirectly indicates the amount of amplified product. • 11.5: Eukaryotic Transcription Unlike prokaryotic genes, the expression of genes in eukaryotic cells has complex systems of transcription factors that act on promoters to recruit RNA polymerases. Additionally, enhancer elements may reside many kilobases upstream of the promoter. These enhancers strengthen the transcription of the gene. In this case, transcription activator proteins or trans-activators augment the promoter activity. 11: Gene Expression The Central Dogma DNA was described as a molecule consisting of 2 anti-parallel strands in a double helix by Francis Crick and James Watson. The elegant model illustrated the intrinsic redundancy that made DNA a suitable data storage vessel for genetic information. Francis Crick later posited a notion of how this information went from storage to an actual program that runs cells. Crick first posited it as a “sequence hypothesis”. This idea of information flow is called the Central Dogma of Molecular Biology. DNA stores the information that is expressed as an intermediate message of RNA. This RNA is then translated into amino acids to yield proteins. The flow of information in cells. DNA serves as a template for copying itself (replication). DNA can also serve as a template for RNA (transcription). RNA is decoded into amino acids to generate proteins (translation). Credit Daniel Horspool (CC-BY-SA 3.0) Transcription DNA is simply a storage vessel of genetic information. It sits in the nucleus and must be called upon through a process of transcription where an enzyme called RNA Polymerase“reads aloud” the stored information into a molecule called messenger RNA (mRNA). Since DNA is double-stranded in an anti-parallel fashion, we automatically know the sequence of the second strand by knowing the first. The mRNA is made through complementary base-pairing to the template strand, which is the reverse complement of the coding strand. The coding strand is the strand that reads identically in sequence to the mRNA with the exceptions of T’s being replaced by U’s. Translation This coding strand is later decoded by the ribosomes with the help of transfer RNA’s tRNA‘s) that act as a decoder of the information and protein assembler in a process called translation. The ribosome scans along the mRNA and recognizes nucleotides in batches of 3 . These batches of 3 can be translated into an amino acid and are known as codons. Since there are 4 types of bases and they are read as groups of 3, there are 43 (or 64) combinations of these codons. However, there are only 20 amino acids used to build proteins. This indicates that there is room for redundancy. Three of these codons tell the ribosome to stop, like a period in a sentence. These are called stop codons. There is one special codon that performs double duty: ATG. The codon (ATG) that encodes the amino acid Methionine also acts as a start codon that tells the ribosome where to start reading from. Like nucleic acids, proteins have a polarity and are synthesized in an amino to carboxyl direction. We abbreviate this by terming the beginning of the protein sequence, N-terminal, and the ending of the sequence as the C-terminal. Ribosomes are large complexes of enzymes that coordinate the decoding of mRNA into amino acids to generate proteins. The standard genetic code. Decisions… decisions… What kinds of decisions are made for stem cells to differentiate into different cell types? What types of regulation occur during this process? A cluster of neuronal progenitor cells (neurosphere) dissociates and differentiates into neurons.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/11%3A_Gene_Expression/11.01%3A_Introduction.txt

The Lactose Intolerance of Bacteria The standard growth kinetics of E. coli are described by the curve.  Credit: Michał Komorniczak (CC-BY-SA 3.0) Glucose is the preferred energy source of cells. François Jacob and Jacques Monod sought to understand how bacteria made decisions to switch between different sugars as sources of energy. Jacob and Monod found that if glucose and lactose were presented as food for bacteria, there would be a biphasic growth pattern. Credit: CNX OpenStax (CC-BY 4.0) Jacob and Monod came to understand that the glucose would first be utilized (preferred source) and the lactose would be digested after the depletion of glucose. This occurred because under normal situations the bacteria would not have access to lactose and would waste energy by creating enzymes to digest it. The enzyme β-galactosidase, which is responsible for digesting lactose to the monomers galactose and glucose would only be induced under the conditions of low glucose and high lactose. Monod found that when lactose was the sole sugar, the expression of the enzyme β-galactosidase was induced and displayed a monophasic growth with a delay. The Lac Operon Jacob and Monod later found that the genes involved in utilizing lactose were clustered together in proximity under a coordinated control mechanism. This became known as the Lac operon. A schematic of the Lac Operon. LacZ, LacY, and LacA are transcribed as a single mRNA. The usage of lactose as a source of energy is preferred by bacteria when glucose is not present. In the presence of abundant glucose, it would be a waste of energy and cellular resources to commit to synthesizing the mRNA and the protein for β-galactosidase. Unless lactose is present, a protein binds to a portion of the Lac promoter referred to as the operator. This repressor protein is encoded by another gene (LacI) outside of the gene cluster. Occasionally, the repressor unbinds to the operator and RNA Polymerase is permitted to transcribe the LacZ gene (β-galactosidase), LacY gene (permease), and LacA gene (acetylase). This “leakiness” of expression is important since the permease protein is needed on the surface of the cell to allow lactose into the cell if it is present in the environment. The presence of lactose causes the repressor to fall off the operator to grant RNA pol access to the DNA. When glucose is low, a protein called CAP (Catabolite Activated Protein) binds to the Lac promoter and works as a recruiter of RNA pol. The coordinated effects of CAP activation and Lac Repressor inactivation yield high transcription of the operon. Credit: G3pro (CC-BY 2.0) LacI bound to 2 DNA operator sequences. Credit: SocratesJedi (CC-BY-SA 3.0) Lac Operon Simulation Launch the simulation below to explore the coordinated activation of the Lac Operon. LacZ as a Reporter Gene pUC19 contains LacZ DNA as a reporter gene to illustrate the presence of the functioning gene. Transcription of this gene is driven by the binding site for the RNA Polymerase subunit called σ factor. The σ factor binding site determines the directionality of the RNA polymerase since there is an option of transcribing in 2 directions. The standard σ factor binding site is often denoted as -35 TTGACA…TATAAT -10 from the transcription initiation. The multiple cloning site within the plasmid provides a convenient location to shuttle a foreign piece of DNA. When no foreign DNA is inserted to this space, the LacZ gene product β-galactosidase is functional. Disruption of the reading frame for this gene likewise disables the functional product from being translated. By using chemical reporters, the integrity of this gene can be confirmed through enzymatic activity. Hydrolysis of lactose to galactose and glucose Two chemical reporters used to reveal the presence of a functioning LacZ are X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside5-bromo-4-chloro-3-indolyl-β-D-galactoside) and ONPG (orthonitrophenol). X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) yields a blue color when cleaved by β-galactosidase ONPG (orthonitrophenol) yields a yellow color upon cleavage by β-galactosidase As in the case of the Lac operon, the LacI (repressor protein) will occupy the operator. This operator happens to be overlapping the -35 & -10 sequences. In order to fully activate these genes, the Lac repressor must be removed by binding to a lactose analog. In this case, the chemical IPTG (Isopropyl β-D-1-thiogalactopyranoside) is used since it is a non-cleavable analog that will perpetually bind to the Lac repressor. IPTG Blue-White Screening Blue-White Screening reveals a phenotype of transformed bacteria based on the ability of X-Gal conversion by β-lactamase  Credit: Stefan Walkowski (CC-BY-SA 4.0)

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/11%3A_Gene_Expression/11.02%3A_Prokaryotic_Transcription.txt

Exercise: RNA Miniprep RNA purification occurs similar to DNA preparations. A silica-based column is used where DNA is excluded from binding based on size and through an additional DNA digestion step using the enzyme DNase I. RNA is extremely fragile and prone to degradation. Because of this, separate pipettes and plastics are usually used in labs to reduce the amount of exposure to environmental or experimental RNase. When handling RNA, be extremely careful of contaminating the buffers or samples. Always wear gloves as skin carries RNase enzymes. Refrain from talking as to not contaminate the area with RNase found in saliva. RLT = RNA lysis buffer: contains guanidine, a harsh denaturant RW1 = RNA wash buffer RPE = Second RNA wash buffer with Ethanol RDD = DNase digestion buffer 1. Harvest a maximum of 1 x 107 cells, as a cell pellet or by direct lysis in the vessel. Add the appropriate volume of Buffer RLT and vortex vigorously. • If < 5 x 106 cells → 350 μl RLT (< 6cm plate) • If ≤ 1 x 107 cells → 600 μl RLT (6-10cm plate) 1. Add 1 volume of 70% ethanol to the lysate, and mix well by pipetting. Do not centrifuge. Proceed immediately to the next step. 2. Transfer up to 700 μl of the sample, including any precipitate, to a spin column placed in a 2 ml collection tube (supplied). 1. Close the lid, and centrifuge for 15 s at ≥8000 x g. 2. Discard the flow-through. 3. Wash: Add 350 μl Buffer RW1 to spin column, close lid, centrifuge for 15 s at ≥8000 x g (≥10,000 rpm). Discard flow-through. 4. Add 10 μl DNase I stock solution (see above) to 70 μl Buffer RDD. Mix by gently inverting the tube. 5. Remove DNA (optional): Add DNase I incubation mix (70 μl) directly to spin column membrane, and place on the benchtop (20–30°C) for 15 minutes. 6. Wash: Add 350 μl Buffer RW1 to spin column, close lid, centrifuge for 15 s at ≥8000 x g. Discard flow-through. 7. Add 700 μl Buffer RW1 to the spin column. Close the lid, and centrifuge for 15 s at ≥8000 x g. Discard the flow-through. 8. Add 500 μl Buffer RPE to the spin column. Close the lid, and centrifuge for 15 s at ≥8000 x g. Discard the flow-through. 9. Add 500 μl Buffer RPE to the spin column. Close the lid, and centrifuge for 2 min at ≥8000 x g. 10. Discard all flow-through and centrifuge at full speed for 1 min to dry the membrane. 11. Place the spin column in a new 1.5 ml collection tube. Add 30 μl RNase-free water directly to the spin column membrane. 12. Close the lid, and centrifuge for 1 min at ≥8000 x g to elute the RNA. 13. Add 30 μl RNase-free water directly to the spin column membrane. Close the lid, and centrifuge for 1 min at ≥8000 x g to elute the RNA. Reverse Transcription The Central Dogma of Molecular Biology was proposed by Francis Crick, the co-describer of the double-stranded helical structure of DNA. This “dogma” was a statement to describe the flow of genetic information to show that DNA houses or stores data that is transcribed into RNA that is subsequently translated from nucleotides into amino acids through the machinery of the ribosomes. Since DNA is relatively static in its ability to store genetic information, the expression of this stored data into the intermediate RNA or to the final protein product is of great significance. Imagine that the DNA in the nucleus of your cheek cells is identical to the DNA of the nucleus of cells in your liver. While the instructions are identical, these are clearly different cells that have a difference in the expression of proteins. Imagine a hard drive on a computer that stores information as 1’s and 0’s. These 1’s and 0’s do not have meaning until specific programs are called upon to act on this information. Likewise, different programs are called to use the instructions of your DNA to make a cheek cell different than a liver cell. Credit: Daniel Horspool (CC-BY-SA 3.0) In 1970, Howard Temin and David Baltimore independently isolated an enzyme from the Rous Sarcoma Virus and Murine Leukemia Virus, respectively. This enzyme was capable of violating the Central Dogma. The genomes of these viruses consist of RNA, not DNA. During the infection process, this enzyme is responsible for converting the RNA into DNA in a process called reverse transcription. This enzyme is logically called reverse transcriptase (RT). This discovery was rewarded with Nobel Prize in 1975. Later on, more viruses were discovered that were composed of RNA genomes that utilized this process, including HIV. Other enzymes within cells were also recognized to have reverse transcriptase activity, such as telomerase and retrotransposons. In molecular biology, these enzymes are used to convert mRNA into complementary copies of DNA called cDNA. The sum total of everything that is transcribed into RNA is referred to as the transcriptome. Synthesis of cDNA from any transcribed RNA can then be used for transcriptome analysis. Exercise: Reverse Transcription of Eukaryotic mRNA mRNA from eukaryotes are modified with 3′ polyadenylated tails. Oligo-dT primers can be used to prime the reverse transcription process of all mRNAs. All solutions should be kept on ice. 1. Determine the concentration of total RNA. 2. Adjust the concentration of RNA to 0.1mg/ml using Rnase free water. 3. Combine 10 ml RNA, 1 ml Oligo-dT (50μM), and 1 ml dNTP Mix (10 mM each). 4. Denature mixture at 65°C for 5 minutes and then place on ice. 5. Combine the following in a separate tube: 1. 4μl Buffer 5X → contains all salts and pH buffer 2. 2μl 0.1 M DTT → a reducing agent to mimic the cellular environment 3. 1μl RNaseOUT (40U/μl) → an RnaseA inhibitor 4. 1μl SuperScript III RT → the reverse transcriptase enzyme 6. After the denatured mixture has been sufficiently cooled, add 8μl enzyme mixture. 7. Incubate 45°C for 1 hour. 8. Deactivate enzyme by incubating 75°C for 10 minutes. 9. Store your cDNA in the freezer.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/11%3A_Gene_Expression/11.03%3A_RNA_Miniprep_%28Activity%29.txt

Quantitative PCR (qPCR) Measurements can be made of individual genes of interest through PCR of those specific genes. A process known as Real-Time PCR or quantitative PCR (qPCR) is used to measure individual genes using fluorescence measurements. An intercalating agent that binds only to double-stranded DNA called Sybr Green is used in a qPCR machine that is measuring fluorescence after each cycle of PCR indirectly indicates the amount of amplified product. However, non-specific products of amplification may also be measured and not discriminated from the authentic amplicon. An alternative to Sybr Green is exemplified by the TaqMan technology. With TaqMan, a third primer (TaqMan probe) is designed in the middle of the area to be amplified. This middle primer is designed with a hairpin self-complementarity so that the 5′ and 3′ ends are in close proximity. At one end, a fluorescent reporter is attached while the other terminus has a quencher that absorbs any fluorescence signal. Under normal circumstances, measurements of fluorescence will be very low. When PCR extension occurs, the Polymerase hydrolyzes this middle primer, thereby separating the quencher and reporter. The name TaqMan is a play on words since it is imagined that the polymerase is chewing up the probe like Pacman. With increased distance between quencher/reporter, the fluorescence signal from this probe can now be measured. This method is much more specific than Sybr Green. However, the use of specific probes increases the cost considerably. Threshold Cycles (Ct) Credit: Zuzanna K. Filutowska (CC-BY-SA 3.0) Fluorescence measurement early during the PCR process will be very low due to the small number of dsDNA molecules (Sybr Green) or most TaqMan primers being quenched. During this exponential DNA production, a threshold will be reached in which the fluorescence will linearly increase. A specific point where the fluorescence is clearly measurable is called the Threshold Cycle (Ct) is used as a reference point to compare expression values. Looking at the example of Sybr Green qPCR above, it can be observed that samples exponentially increasing at a lower cycle number (Ct) has a higher level of mRNA expression (towards the left) of that gene than samples with higher cycle number (towards the right). Notice that the fluorescence eventually plateaus and stops increasing. This is due to the depletion of raw materials for DNA production like dNTPs. Since the PCR reactions theoretically represent a doubling of DNA after each cycle, the Ct values can be interpreted on a base 2 system. If there is a difference in Ct between two samples (ΔCt) of 5 cycles, this corresponds to 25 or 32 fold difference. We can control for variations in the RNA preparation through comparing the fluorescence values of our gene of interest to a housekeeping gene like actin. The use of a house-keeping gene to normalize the initial input to the reactions and comparison between samples is referred to as Relative Quantification. Melt Curves for Sybr Green The top panel illustrates the decrease in fluorescence as the temperature increases due to the dissociation of double-stranded DNA. The bottom panel illustrates the first derivative plot. Each peak in this example illustrates a different allele. The double peaks represent the presence of the 2 distinct alleles in the amplification products. Credit: Seans Potato Business (CC-BY-SA 3.0) When using Sybr Green, we need to ensure that the PCR is specific so that the fluorescence measurement truly reflect amplification of our gene of interest. At the end of each qPCR run (~40 cycles), a melt curve is performed. A melting curve (or dissociation curve) comes from constant measurements as the temperature is increased. As temperature increases, the DNA strands start to denature and fluorescence will begin to decrease. After complete separation of DNA strands, the fluorescence will again remain constant. The way this curve is viewed is through a derivative plot where the inflection in fluorescence reading is reported as the melting temperature (Tm). This melt curve illustrates each sample contains the same specific product with a melting temperature of 83.51°C. Any peaks in this plot refer to a specific PCR product. If multiple peaks appear, the results will not be valid as they do not directly measure a single product. Expression Measurements Differential gene expression refers to transcriptional programs activated by the cell under various conditions. “Differential” refers to a comparison of two or more states or timepoints. Using mRNA as an indirect measurement of protein, one can ascertain which proteins are linked to these different states. In eukaryotes, this can be assessed by enriching total RNA for polyA-containing mature mRNA. Through the use of oligo-(dT) containing resin, mRNA can be separated from non-protein encoding RNA. Likewise, performing a reverse-transcription using an oligo-(dT) primer will create a stable complementary DNA (cDNA) molecule that can be used with PCR. Using qPCR in this way is called RT-PCR or reverse-transcription polymerase chain reaction where specific primer pairs are used to amplify a small portion of a known gene. Hybridization-Based Methods and Microarrays: Credit: FrozenMan (CC-BY-SA 4.0) Prior to RT-PCR, the expression of individual genes was assessed through a hybridization-based approach. This method called for running RNA on an agarose gel and transferring the size-fractionated RNAs onto a membrane through a method called “blotting”. This transferred RNA was then hybridized to a radioactively labeled probe for a specific gene (corresponding to the reverse complementary sequence) and visualized by exposure to X-ray film in a process called Northern Blotting. The intensity of the band would be proportional to the amount of mRNA corresponding to the gene of interest. Re-probing with a housekeeping gene like actin would be used as a loading control to illustrate that a similar amount of total RNA was loaded into each well. Differences in sizes of the mRNA on the Northern Blot also revealed differences in splice variants of mature mRNA in the different states. Credit: Jeremy Seto (CC-BY-NC-SA) This technique was later adapted using non-radioactive methods. Using these non-radioactive methods, the reverse protocol was developed to measure multiple gene targets. By systematically immobilizing gene-specific probes onto a membrane or a microscope slide, an array of targets can be produced. In the simplest paradigm of having 2 states (control or experimental), cDNA from each sample can be used to generate fluorescent RNA that can hybridize to immobilized probes. Using 2 different fluorescent markers allows for the competitive hybridization onto the array whereby the fluorescent signal in each channel can reveal the differential gene expression of the two states in a 2-color microarray. 11.05: Eukaryotic Transcription Eukaryotic Gene Expression The Central Dogma in Eukaryotes. Genomic DNA of genes often contain introns that are spliced out when an RNA matures to an mRNA. This excision of introns can result in splice variants of the same gene with variants of the same protein. Credit: Thomas Shafee (CC-BY 4.0) Unlike prokaryotic genes, the expression of genes in eukaryotic cells has complex systems of transcription factors that act on promoters to recruit RNA polymerases. Additionally, enhancer elements may reside many kilobases upstream of the promoter. These enhancers strengthen the transcription of the gene. In this case, transcription activator proteins or trans-activators augment the promoter activity. 1. DNA 2. Enhancer 3. Promoter 4. Gene 5. Transcription Activator Protein 6. Mediator Protein 7. RNA Polymerase Credit: Jon Cheff (CC-BY-SA 4.0) Mediator proteins (coactivators) form a multiprotein complex with the activators to recruit RNA polymerase to the promoter. Eukaryotic mRNA Credit: Kelvinsong (CC-BY-3.0) Eukaryotic genes may often contain introns (non-coding sequences) that are spliced out from the exons (coding sequences). This complexity permits for an increased variety of gene products. Mature eukaryotic mRNAs contain a 5′-methyl-Guanine followed by an untranslated leader sequence (5′-UTR), the coding sequences (cds), a 3′-untranslated region (3′-UTR) and a long stretch of Adenines (polyA tail). Expression is the most easily measured with RNA since nucleic acid manipulation is fairly simple with 4 different nucleotides. In eukaryotes, the messenger RNA (mRNA) intermediate that is transcribed from DNA contains a polyA tail that is used to separate these messages from other types of RNA that are abundant within cells (like ribosomal RNA). Through the use of an enzyme called reverse transcriptase (RT) and primers composed of deoxy-Thymidines (oligo-dT or dT18), mRNA can be converted into a single strand of DNA that is complementary to the mRNA. This complimentary DNA is called cDNA. cDNA is very stable compared to the highly labile mRNA and is used for subsequent processing. Advanced Video of Eukaryotic Transcription Regulation The first video describes the discovery of transcription factors that regulate the expression of eukaryotic genes. The second video describes the complexity of gene expression that involves chromatin remodeling and enhancers. This video explores the roles and outcomes of differential gene expression.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/11%3A_Gene_Expression/11.04%3A_Quantitative_Nucleic_Acid_Measurement.txt

• 12.1: Introduction What constitutes being human? Many will point at cultural identity and leaving long-standing remnants of that culture. Such prehistorical artifacts like cave drawings and tools provide an anthropological framework for identifying what it is to be human, but the biological identity remains locked in the history of our DNA. Homo sapiens represent a branch of primates in the line of Great Apes. The family of Great Apes consists of four extant genera: Homo, Pan, Gorilla, Pongo. • 12.2: Maternal Lineage Mitochondria are thought to have arisen in the eukaryotic line when bacteria capable of detoxifying the deadly effects of atmospheric oxygen were engulfed by a eukaryote that did not proceed to consume it. Over time, these formerly free-living bacteria became dependent on the eukaryotic cell environment while providing the benefit to the host cell of aerobic respiration. Mitochondria still replicate independently of the host cell but can not survive outside of this cellular environment. • 12.3: Maternal Lineage (Activity) There are 2 hypervariable regions within the control region of the mitochondria. This exercise amplifies just one of these. For more definitive results, both should be amplified and sequenced. This exercise will permit us to have a rough idea of the origins of our maternal line and we will be able to attribute ourselves to various tribes throughout the world. The human mitochondrial genome (genbank file). • 12.4: Alu Insertion (Activity) Alu’s are unique SINEs that appear in the primate lineage and reveal the lineage and diversification of primates. While retrotransposons can disrupt gene (as in some cases of hemophilia), they often land outside of genes or within introns without effect. One example of a non-disruptive Alu element in humans is found in the location called PV92 on chromosome 16. This element is of the youngest subfamily of Alu, called Ya5. • 12.5: Transposons Mobile genetic elements called transposable elements or transposons are located throughout the genome. These elements were first described in maize by Barbara McClintock at the Cold Spring Harbor Laboratory where she observed a disruption of coloring in corn kernels that did not follow simple Mendelian inheritance. Dr. McClintock noticed that some kernels contained spots. She described the phenomenon of this break in the Mendelian characteristics as a “genetic instability”. 12: Tracing Origins Being Human Drawings dating to approximately 30,000 years ago in the Chauvet Cave. What constitutes being human? Many will point at cultural identity and leaving long-standing remnants of that culture. Such prehistorical artifacts like cave drawings and tools provide an anthropological framework for identifying what it is to be human, but the biological identity remains locked in the history of our DNA. Spear points of the Clovis Culture in the Americas dating to approximately 13,000 years ago. Credit: Bill Whittaker [CC-BY-SA 3.0] The Great Apes Phylogenetic tree generated with Cytochrome Oxidase I (COI) genes. Homo sapiens represent a branch of primates in the line of Great Apes. The family of Great Apes consists of four extant genera: Homo, Pan, Gorilla, Pongo. Karyotype analysis (Yunis et al., 1982) reveals a shared genomic structure between the Great Apes. While humans have 46 chromosomes, the other Great Apes have 48. Molecular evidence at the DNA level indicates that Human Chromosome 2 is a fusion of 2 individual chromosomes. In the other Great Apes, these 2 Chromosomes are referred to as 2p and 2q to illustrate their synteny to the human counterpart. Synteny map of Human, Chimpanzee, Gorilla, Orangutan, and Marmoset (non-ape primate). Mapping of chromosome 2a and 2b in the apes compared to 6 and 14 in the marmoset illustrates the relatedness of the chromosomal structure of the apes. Minor inversions are apparent in the orangutan chromosome. Credit: Jeremy Seto [CC-BY-NC-SA] Chimpanzees (Pan) are the closest living relatives to modern humans. It is commonly cited that less than 2% differences in their nucleotide sequences exist with humans (Chimpanzee Sequencing and Analysis Consortium, 2005). More recent findings in comparing the complement of genes (including duplication and gene loss events) now describe the difference in genomes at about 6% (Demuth JP, et al., 2006). The Pan-Homo divergence. A display at the Cradle of Humankind illuminates the skulls of two extant Hominini with a series of model fossils from the Hominina subtribe of Austrolopithecina and Homo. Credit: Jeremy Seto [CC-BY-NC-SA] https://flic.kr/p/SmhHTd The Genus Homo An underground lake at inside the Sterkfontein Cave system at the Cradle of Humankind (South Africa) Credit: Jeremy Seto [CC-BY-NC-SA] https://flic.kr/p/RczrEg The rise of the human lineage is thought to arise in Africa. Fossils of Austroloptihs (southern apes) found in death traps, like those at the Cradle of Humankind, reveal a historical record of organisms inhabiting the landscape. The breaks in the ceiling of the caves provide opportunities for animals to fall inside these caves to their death. The limestone deposits of the caves serve as an environment for fossilization and mineralization of their remains. An abundance of fossilized hominids in these caves including Australopithecus africanus, Australopithecus prometheus, Paranthropus boisei, and the newly discovered Homo naledi continue to reveal the natural history of the genus Homo from 2.6 million to 200,000 years ago. The entrance to the archaeological site at Sterkfontein, Cradle of Humankind (South Africa). Credit: Jeremy Seto [CC-BY-NC-SA] https://flic.kr/p/ULs2Sv Ancient DNA of Humans In 2008, a piece of a finger bone and a molar from a Siberian Cave were found that differed slightly from that of modern humans and Neandertals. The cave, called Denisova Cave, maintains an average temperature of 0ºC year-round and the bones were suspected to contain viable soft tissue. An initial mitochondrial DNA analysis revealed that these hominids represented a distinct line of humans that overlapped with them in time (Krause et al., 2010). Analysis of the full nuclear genome followed and indicated that interbreeding existed between these Denisovans, Neandertals and modern humans (Reich et al., 2010). Furthermore, analysis of DNA from a 400,000-year-old femur in Spain revealed that these three lines diverged from the species Homo heidelbergensis with Denisovans closest in sequence similarity (Meyer et al., 2016). Between modern humans, markers found in the mtDNA can be used to trace the migrations and origins along the maternal line. Similarly, VNTRs found on the Y chromosome have revealed migration patterns along paternal lines within men. Other markers, like the insertion points of transposable elements, can be used to further describe the genetics and inheritance of modern humans while providing a snapshot into evolutionary history.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/12%3A_Tracing_Origins/12.01%3A_Introduction.txt

Mitochondrial and Maternal Inheritance In addition to the 23 chromosomes inherited from mother and 23 chromosomes inherited from father, humans have an additional genome that is only inherited from the mother. This genome comes from the endosymbiotic organelle, the mitochondrion. Mitochondria are thought to have arisen in the eukaryotic line when bacteria capable of detoxifying the deadly effects of atmospheric oxygen were engulfed by a eukaryote that did not proceed to consume it. Over the course of time, these formerly free-living bacteria became dependent on the eukaryotic cell environment while providing the benefit to the host cell of aerobic respiration. Hallmarks of this endosymbiotic event include the inner prokaryotic membrane surrounded by the outer eukaryotic membrane, the presence of prokaryotic ribosomes and most significantly, and the circular prokaryotic chromosome. Mitochondria still replicate independently of the host cell but can not survive outside of this cellular environment. Animal mitochondria have the simplest genomes of all mitochondrial genomes, ranging from 11-28kb. The human mitochondrial genome consists of 37 genes which are almost all devoted to processing ATP through oxidative phosphorylation. Human mitochondrial genome The human mitochondrial genome (genbank file) consists of 16,569 nucleotides (16.6kb). While most of this 16.6kb genome consists of protein-encoding genes, approximately 1.2kb non-coding DNA takes part in signals that control the expression of these genes and replication processes. It is the area of DNA where the double-strandedness is displaced and having the name D-loop (displacement loop). Mutations in this area generally have very little effect on the functioning of the mitochondria. Because of this reduced selection pressure on this area, this control region is also referred to as the hypervariable region. This hypervariable region actually has 10 times more SNPs than the nuclear genome. Due to this abundance of mutations, it is possible to track down the maternal line of an individual. Why just maternal? The human oocyte contains many mitochondria while sperm cells only contain mitochondria that power the flagellar motion. Upon fertilization, the flagellum and the associated mitochondria are lost, leaving the zygote with only maternal mitochondria. The cluster of SNPs found in the mitochondrial control region are linked and are always inherited together. Because of the lack of paternal contribution, this linkage is referred to as a haplotype, or “half-type”. Tracking these polymorphic haplotypes, a family tree of humans was developed in the 1980s which concluded that humans arose from a metaphorical “Mitochondrial Eve” 200,000 years ago. As a metaphor to the Biblical Eve, this alludes to an origin but unlike the Biblical event, this does not mean that it was a single woman that gave rise to all of modern humanity. On the contrary, the metaphor merely indicates that a series of females; sisters and cousins, of this line gave rise to modern humans. Migration map of mitochondrial haplogroups. Numbers represent 1000 years ago. The use of mitochondria for this analysis provides great flexibility, especially from ancient sources. Unlike the nuclear genome which only has 2 copies of DNA per cell, the mitochondria are abundant in number and provide many copies of genome per cell. Ancient sources of DNA in fossils will most often have degradation of the DNA. The mitochondrial genome is just as likely to undergo degradation over time. However, the high copy number allows for gaps to be filled in easily. SNPs do not alter the overall size of the hypervariable region, therefore amplification by PCR can not resolve these differences based on agarose gel migration. However, amplicons (amplified copies) can be sent for sequencing whereby each nucleotide can be called out in succession and reveal the specific SNPs.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/12%3A_Tracing_Origins/12.02%3A_Maternal_Lineage.txt

The PCR Amplification of the Mitochondrial Control Region There are 2 hypervariable regions within the control region of the mitochondria. This exercise amplifies just one of these. For more definitive results, both should be amplified and sequenced. This exercise will permit us to have a rough idea of the origins of our maternal line and we will be able to attribute ourselves to various tribes throughout the world. The human mitochondrial genome (genbank file). Forward Primer 5’-TTAACTCCACCATTAGCACC-3’ Reverse Primer 5’-GAGGATGGTGGTCAAGGGAC-3’ 1. PCR the previously extract DNA samples. • Pour 2% agarose into casting apparatus in refrigerator. • 2 gels per class need to be made → 100ml of TBE with 2g agarose • Add 5μl SYBR safe solution into the molten agarose before casting. • Place 2 sets of combs into the gel → at one end and in the middle. 1. Load the gel with DNA ladder and PCR. 2. Run the gel at 120V for 20 minutes. 3. Visualize on the UV transilluminator. 4. Document with a camera to verify amplification. 5. The instructor will submit viable reactions for sequencing. 6. Analyze data during Bioinformatics Lab session. 1. Using NYCCT email address, register for an account at https://dnasubway.cyverse.org/. 2. Retrieve reference mitochondrial sequences. 3. Perform multiple sequence alignment using MUSCLE. 4. Draw phylogenetic trees using PHYLIP and visualize using a FigTree. 12.04: Alu Insertion (Activity) Alu’s are unique SINEs that appear in the primate lineage and reveal the lineage and diversification of primates. While retrotransposons can disrupt gene (as in some cases of hemophilia), they often land outside of genes or within introns without effect. One example of a non-disruptive Alu element in humans is found in the location called PV92 on chromosome 16. This element is of the youngest subfamily of Alu, called Ya5. Since PV92 does not cause any deleterious effects, it can be used as a non-selected marker to illustrate lineage. Some people have an Alu element int his location while others do not. The presence or absence of this marker is viewed as an allele. This lab uses a primer that flanks the location of the Alu insertion that span 416 bp. If an Alu is present, the amplified DNA will be 300bp larger (the size of an Alu) at 731bp. Exercise: In Silico PCR of PV92 Forward primer: 5′ GGATCTCAGGGTGGGTGGCAATGCT 3′ Reverse primer: 5′ GAAAGGCAAGCTACCAGAAGCCCCAA 3′ 1. Perform Virtual PCR Informatics Exercise/Discussion. 2. Visit BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch 3. Paste both primers: GGATCTCAGGGTGGGTGGCAATGCT GAAAGGCAAGCTACCAGAAGCCCCAA 4. Choose “Somewhat Similar” 1. Locate the locus of the product and the size. 5. Find the PCR fragments in Ugene 1. Download the sample FASTA file: PV92 sample 2. Open the file in Ugene and select option “As Separate Sequences in Viewer” 3. Select the “In Silico PCR” button on the far right (double helix button) and insert the primers 4. A PCR product should be noted for one of the sequences after pressing “Find Products anyway” 5. Click on the second sequence in the viewer and Press “Find Products anyway” Exercise: PCR Genotype PV92 Locus 1. PCR the individual samples. 2. Pour 2% agarose into casting apparatus in the refrigerator. • 2 gels per class need to be made → 100ml of TBE with 2g agarose. • Add 5μl SYBR safe solution into the molten agarose before casting. • Place 2 sets of combs into the gel → at one end and in the middle. 1. Load DNA ladder and PCR samples. 2. Run gel at 120V for 30 minutes. 3. Visualize on UV transilluminator. 4. Score gels for the presence/absence of the alleles to determine genotype frequency in the class.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/12%3A_Tracing_Origins/12.03%3A_Maternal_Lineage_%28Activity%29.txt

Transposable Elements Mobile genetic elements called transposable elements or transposons are located throughout the genome. These elements were first described in maize by Barbara McClintock at the Cold Spring Harbor Laboratory where she observed a disruption of coloring in corn kernels that did not follow simple Mendelian inheritance. McClintock’s Corn Kernels Each kernel represents a distinct new individual organism. Kernel color is described through simple Mendelian inheritance where purple is dominant over yellow. Dr. McClintock noticed that some kernels contained spots. She noticed that the coloration disruption could later reverse in subsequent generations. She described the phenomenon of this break in the Mendelian characteristics as a “genetic instability”. Over time, she would come to realize that the spots in these kernels arose from the insertion of DNA into the area of genes that were involved in controlling kernel coloration. Dr. McClintock’s description of this phenomenon and the underlying mechanisms was extremely unpopular as it violated what was already known about the fixity of genetics. Though initially skeptical, biology has found that these “jumping genes” are found in every taxa including prokaryotes (where they are often associated with genes conferring antibiotic resistance) and she was later awarded the Nobel Prize. Approximately half of the human genome consists of transposons, making up the bulk of what was previously referred to as “junk DNA”. (See Animation: http://www.dnaftb.org/32/animation.html) Classes of Transposons Transposons can be autonomous or non-autonomous. Autonomous transposons encode their own transposase enzyme that facilitates the jumping of the gene while non-autonomous transposons require the transposase activity of another transposable element. Functional DNA transposons are autonomous and work through a “cut and paste” mechanism. DNA transposons are delineated by flanking terminal repeats that mark the location that the transposase excises the DNA. These DNA elements then re-integrate at a different location within the genome. The excision from DNA leaves marks of these flanking repeats that can be used to study the rate and level of DNA transposition events within a genome. The insertion of these transposons can affect the expression of nearby genes and can completely disrupt genes they land into as evidenced in the speckled corn kernels that McClintock described. RNA transposons are called retrotransposons because they are transcribed into an mRNA and require a reverse transcription to integrate into the genome. The most common mobile element in the human genome is the Long Interspersed Nuclear Elements (LINEs) and the Short Interspersed Nuclear Elements (SINEs). These retrotransposons are most abundantly represented by the autonomous LINE1 (L1) and non-autonomous Alu elements, respectively. Alu elements rely on the expression of the L1 in order to be reverse-transcribed and integrated into the genome. These retrotransposons work in a “copy and paste” mechanism and are responsible for genomic expansion. As their classifications signify, LINEs are longer than SINEs. This is due to the presence of a second reading frame that encodes the transposase. The Human Genome is littered with “junk” DNA. Green coloration corresponds to Alu sequences in this karyogram of the human genome. Credit: Andreas Bolzer, Gregor Kreth, Irina Solovei, Daniela Koehler, Kaan Saracoglu, Christine Fauth, Stefan Müller, Roland Eils, Christoph Cremer, Michael R. Speicher, Thomas Cremer (CC-BY 2.5) • Human L1 sequence (fasta) • Human Ya5 Alu sequence (fasta)

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/12%3A_Tracing_Origins/12.05%3A_Transposons.txt

• 13.1: Introduction Cryptozoology is a pseudoscience centered around the description of animals that have little or no evidence of existing. These mythical beasts include Bigfoot, Yeti, Sasquatch, jackalope, Loch Ness Monster, and chupacabra. Little evidence exists to illustrate their existence other than folklore. Sometimes, physical evidence is left behind like hair or feces. With DNA evidence, we can help to confirm the existence of these unknown creatures. • 13.2: Barcoding (Activity) This page contains detailed instructions on how to DNA barcode the samples. 13: DNA Barcoding Cryptozoology Cryptozoology is a pseudoscience centered around the description of animals that have little or no evidence of existing. These mythical beasts include Bigfoot, Yeti, Sasquatch, jackalope, Loch Ness Monster, and chupacabra. Little evidence exists to illustrate their existence other than folklore. Sightings of Bigfoot in North America. Credit: Elia Machado (CC-BY-NC-SA) Sometimes, physical evidence is left behind like hair or feces. With DNA evidence, we can help to confirm the existence of these unknown creatures. Below features a table from Sykes et al. displaying results on supposed cryptic Apes (Bigfoot/Yeti) and what DNA evidence has revealed them to be. Cryptozoological samples of hair believed to arise from legendary animals like Bigfoot, Sasquatch, Yeti, etc. The Need for Barcoding Taxonomy of living things was created by Carl von Linné, who formalized it by using a binomial classification system to differentiate organisms. Binomial nomenclature was used to describe a genus and a species name to each organism to provide an identity. These days, classifications of organisms is becoming increasingly important as a measurement of diversity in the face of habitat destruction and global climate change. There is no consensus on how many life forms exist on this planet, but the estimation of extinction rates is about 1 species per 100-1000 million species. Classification in Linné’s day was mostly performed by morphological differences. This was carried on in fossils. However, morphology has many drawbacks, especially in sexually dimorphic species or species with multiple developmental morphologies. Larva (top) of the Green Lacewing and the adult (bottom) Molecular biology and DNA technologies have revolutionized the classification system of living things especially in providing the ability to match relatedness of these species. DNA barcoding, like the name implies, seeks to utilize DNA markers to differentially identify organisms. But what DNA markers should be used? What criteria do we use to develop barcodes? Discrimination, Universality, and Robustness are the criteria used to define the usefulness of barcodes. Since the goal of barcoding is to define specific organisms, discrimination is the primary objective. Discrimination refers to the difference of sequences that occur between species. However, science is easier when there is some universality in the locus used for discrimination. As it sounds, universality is an attempt to use the same locus in disparate genomes. While discrimination is about the uniqueness of sequences, universality seeks to use a single set of PCR primers that will be able to amplify that same distinct region with variable sequence similarity. If some region of DNA has absolutely no sequence deviation between species, this has great universality but poor discrimination. But if a sequence has very low sequence similarity, this is great for discrimination but has absolutely no universality and can not be amplified with the same set of primers. Robustness refers to the reliability of PCR amplification of a region. Some regions of DNA just don’t amplify well or it is too difficult to design appropriate and unique primers for that locus. A case where there is universality for designing primers, but not an area where discrimination can occur. While discrimination of different organisms can occur in this situation, the lack of similarity in sequence would make it difficult to design primers. That is, the lack of universality in sequence would also make this PCR not robust. Enough variability in these sequences gives us the ability to discriminate between species. The high similarity provides us the universality required to design primers that may be robust enough to amplify by PCR. Sometimes, species are so similar for one sequence that a second marker is required. Just as the standard UPC barcode has a series of vertical lines of different spacing and width, a 2-dimensional barcode adds that second dimension of information into a square of dots like in a QR code (Quick Response code). We can also utilize the second, the third, or the fourth set of loci that will aid in increased discrimination just as CoDIS utilizes multiple STR sites to define individual people. In animals, the most commonly used barcode is the mitochondrial gene, Cytochrome Oxidase I (COI). Since all animals have mitochondria and have this mitochondrial gene, it offers high universality. It is a robust locus that is easy to amplify and has high copy number with enough sequence deviation between species to discriminate between them. Animal mitochondrial genomes vary from 16kb-22kb. However, plants, fungi, and protists have wildly different and larger mitochondrial genomes. For plants, we use a chloroplast gene, ribulose-bisphosphate carboxylase large subunit (rbcL) or maturase K (matK) (Hollingsworth et al. 2011). Prokaryotes are often discriminated by their 16s rRNA gene while eukaryotes can be identified by 18s rRNA. COI (a maternally transmitted gene) will not create a clear picture of species identity in the case of hybrid animals (mules, ligers, coydogs, etc.). Sometimes, closely related species are also indistinguishable by a single barcode, so the inclusion of 18s with COI may be necessary to define the identity of the species. Since it is so difficult to meet the three criteria (robustness, universality, and discrimination) for all species, having these multiple barcodes is important. Fungi prove to be difficult in identification by COI, so another marker called the internal transcribed spacer (ITS) is used to aid in their identification. We must also remember that not everything with chloroplasts are plants and, therefore, additional markers are used to identify protists. Mixtures of Organisms Lichens are composite organisms composed of cyanobacteria or other algae with fungi. In this case, a single barcode would incorrectly identify the species. Kefir granules represent colonies of mixed microbes that are used to generate kefir. Credit: A. Kniesel (CC-BY-SA 3.0) A symbiotic colony of bacteria and yeast is used to ferment kombucha. As the name implies, this is a complex composite colony of multiple species that contribute to the qualities of the kombucha. Credit: Lukas Chin (CC-BY-SA 4.0) Metabarcoding and Microbiomes Class Results Students wanted to check some food items. These included breakfast sausage from a Halal cart, “beef jerky” from the vending machine, roast beef from the cafeteria, and Chinese sausage (lopcheng). For more class results, please visit https://openlab.citytech.cuny.edu/dna-barcodes/ 13.02: Barcoding (Activity) DNA Barcoding of Samples 1. Place sample in a clean 1.5 mL tube. 2. Add 100 μl of nuclear lysis solution to tube. • Twist a clean plastic pestle against the inner surface. 1. Add 500 μl more nuclear lysis solution to tube. 2. Incubate the tube in a water bath or heat block at 65°C for 5-15 minutes. 3. [Optional] Add 200 μl of protein precipitation solution to each tube incubate on ice for 5 minutes. 4. Centrifuge for 4 minutes at maximum speed to pellet protein and cell debris. 5. Transfer 600 μl of supernatant to a clean labeled tube. 6. Add 600 μl of isopropanol. 7. Centrifuge for 2 minutes at maximum speed to pellet the DNA. 8. Pour off the supernatant and add 600 μl of 70% ethanol to wash the pellet. 9. Centrifuge the tube for 2 minutes at maximum speed and carefully remove the solution. 10. Air-dry the pellet for 10 minutes and add 100 μl of the DNA rehydration solution (TE). 11. Incubate the DNA at 65°C for 5-10 minutes to dissolve. 12. Obtain a PCR tube containing Ready-To-Go PCR Bead. Label the tube with your identification number. 13. Use a micropipette with a fresh tip to add 23 μL of one of the following primer/loading dye mixes to each tube. Allow the beads to dissolve for 1 minute. • Plants: rbcL primers (rbcLaF / rbcLa rev) • Fish: COI primers (VF2_t1/ FishF2_t1/ FishR2_t1/ FR1d_t1) • Insects: (LepF1_t1/ LepR1_t1) 1. Add 2 μl of your DNA directly into the appropriate primer/loading dye mix. 2. Place tubes in a Thermal cycler. 3. Pour 2% agarose into casting apparatus in the refrigerator. 1. 2 gels per class needed to be made → 100ml of TBE with 2g agarose 2. Add 5 μl SYBR safe solution into the molten agarose before casting. 3. Place 2 sets of combs into the gel → at one end and in the middle. 4. Load DNA ladder and PCR samples. 5. Run the gel at 120V for 30 minutes. 6. Visualize on the UV transilluminator. 7. Document with a camera. 8. Send amplicons of verified samples for sequencing. • Plant rbcL gene • rbcLaf 5’- ATGTCACCACAAACAGAGACTAAAGC-3’ (forward primer) • rbcLar 5’- GTAAAATCAAGTCCACCRCG-3’ (reverse primer) • Animal coi gene • lepF1 5’- ATTCAACCAATCATAAAGATATTGG -3’ (forward primer) • lepR1 5’- TAAACTTCTGGATGTCCAAAAAATCA-3’(reverse primer) • vf1f 5’- TCTCAACCAACCACAAAGACATTGG-3’ (forward primer) • vf1r 5’- TAGACTTCTGGGTGGCCAAAGAATCA-3’ (reverse primer)

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/13%3A_DNA_Barcoding/13.01%3A_Introduction.txt

• 14.1: Introduction Genetic modification of organisms has been occurring through human manipulation since the beginning of agriculture. Humans selectively bred crops and livestock to propagate desirable traits in a process termed artificial selection. The original grass that gave rise to domesticated corn called teosinte hardly resembles what we think of when imagining modern maize. • 14.2: GMO Food (Activity) This page contains instructions on how to perform a PCR detection of GM food. Briefly, genomic DNA will be isolated from food items derived from vegetation. Genetic modification will then be identified by PCR of the plant promoter used in genetic engineering, CaMV 35S. As a positive control for the appropriate extraction of DNA, PCR for plant-specific tubulin will be used. 14: Genetic Modification Genetic Manipulation (Selection) Genetic modification of organisms has been occurring through human manipulation since the beginning of agriculture. Humans selectively bred crops and livestock to propagate desirable traits in a process termed artificial selection. The original grass that gave rise to domesticated corn called teosinte hardly resembles what we think of when imagining modern maize. Teosinte, the progenitor of maize. Corn came about due to selective breeding. Credit: John Doebley (CC-BY) Variation: Crop Domestication Selective breeding can yield a variety of features even within the same species. Below is a selection of vegetables of the species Brassica oleracea that have been developed into different varieties over the course of agricultural history. Cabbage: Brassica oleracea var. capitata Credit: Forest & Kim Starr (CC-BY 3.0) Broccoli: Brassica oleracea var. italica Credit: Coyau (CC-BY-SA 3.0) Kohlrabi: Brassica oleracea var. gongylodes Coyau (CC-BY-SA 3.0) Romanesco: Brassica oleracea var. botrytis Credit: Richard Bartz (CC-BY-SA 2.5) Variation: Animal Domestication Credit: Mary Bloom, American Kennel Club (CC-BY-SA 4.0) Companion animals like dogs underwent thousands of years of domestication and selection for traits that were desirable for different circumstances. A high degree of morphological diversity exists between dog breeds and their ancestral grey wolf progenitor. Genetic Manipulation (Engineered) Artificial selection takes multiple generations over a long period of time. With the advent of recombinant DNA and biotechnology, scientists can now genetically modify organisms through the introduction of foreign genes to provide desirable characteristics within one generation. This process does not require traits to naturally arise in a species. GloFish are transgenic zebrafish (Danio rerio) expressing variants of GFP. Bottom features a wild-type fish. Credit: Azul (CC-BY) GloFish® are novelty pets that have the insertion of various cnidarian fluorescent protein genes into the genome. These fish were released in the United States in 2003 and have subsequently been developed in red, orange, and blue varieties. Black tetras and tiger barbs are also now available. Black tetra (Gymnocorymbus ternetzi) GloFish Credit: https://www.flickr.com/photos/fergy08/ (CC-BY 2.0) Wild-type Black Tetra Credit: Fernandograu (CC-BY-SA 3.0) Genetic Engineering in Plants With the advent of agribusiness, agriculture has become a profit-driven venture independent of food production. In this case, high production is paramount. Whereas traditional agriculture or artificial selection was slow and methodical, genetic modification in the context of agribusiness is instantaneous through genetic engineering. The objective of genetic engineering is to transfer the DNA encoding a useful or favorable gene from an organism that carries that gene to one that does not. Simply inserting DNA into an organism does not result in expression. An appropriate promoter for the transgenic organism must be upstream of the gene of interest in order to drive transcription. In mammals, a strong promoter that will result in expression in every cell is the CMV promoter that is derived from cytomegalovirus. Likewise in plants, a strong promoter that works in every cell is derived from viral promoters like the CaMV promoter from cauliflower mosaic virus from the 35S gene (a ribosomal RNA). (CaMV 35S sequence on NCBI) Examples of useful traits include: • Degrade herbicides • Kill agricultural pests • Synthesize critical nutrients • To improve color and taste • Resist damage during transit or prolonged storage. • Increase in size • Reduce time to market (more rapid growth or maturation) Genetically Modified foods have become a hot topic of contention in recent times. These crops are generated through the infection of plant cells by a bacterium called Agrobacterium tumefaciens. Agrobacterium is a gram-negative alphaproteobacterium of the family Rhizobiaceae which includes symbiotic nitrogen fixers found in legumes. Unlike those symbionts, Agrobacterium is a pathogenic soil bacterium known as a causative agent of crown galls (tumors). Crown gall on a Kalanchoë infected with Agrobacterium tumefaciens Credit: Bhai (CC-BY-SA 3.0) The tumors are caused by the infection of plant cells by the bacterium and the subsequent insertion of the T-DNA (“Transfer DNA”) that has a tumor inducing capability (Ti). Through the engineering of the T-DNA in a plasmid, selected genes can be delivered to plant cells through infection of transformed bacteria. Ti plasmid has the T-DNA region replaced by the transgene. Ti is transformed into Agrobacterium which transduces the DNA into plant cells. A modified Ti plasmid called pGreen was engineered to provide an MCS and selection marker for insertion of foreign genes of interest. In order for these genes to be expressed, they are driven by strong plant promoters like those from the CaMV 35S gene. The plant to be engineered is cultured and infected with the transformed Agrobacteria that will then induce cysts that eventually root. The strong promoter of the CaMV 35S will constitutively express the gene in all cells of the plant. Transformation of wild potato in culture using agrobacterium Credit: Seb951 (CC-BY-SA 3.0) Growth of GMO Crops Land area used in millions of hectares. Damage Resistance The first genetically modified crop FDA approved for sale was known as the Flavr Savr tomato. Tomatoes are prone to damage during shipping and are therefore picked before ripening. However, vine-ripened tomatoes have a richer flavor. Calgene developed the Flavr Savr and sold it to market between 1994-1997 in the United States. Flavr Savr was modified by inserting antisense into the genome that knocked-down the expression of polygalacturonase. Polygalacturonase degrades pectin in the cell walls of the fruit that results in softening, proclivity to damage, and eventual rotting. Herbicide Resistance Roundup is the trade-name of the herbicide glyphosate used in agriculture to control weed populations developed and patented by Monsanto. Glyphosate is absorbed through the foliage of plants and interferes with the enzymes that aid in the production of tyrosine, phenylalanine, and tryptophan. Plants and lower organisms generate aromatic amino acids through an enzyme 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase which is the target of this compound. A series of Roundup Ready crops were designed by the insertion of the Agrobacterium EPSP gene driven by the CaMV 35S promoter. This version of the gene is inherently resistant to glyphosate poisoning. The Emergence of Superweeds Palmer amaranth (Amaranthus palmeri), commonly referred to as pigweed, is a pest species in cotton and soy fields that have become glyphosate-resistant. Credit: Pompilid (CC-BY-SA 3.0) Pest Resistance Credit: Cyndy Sims Parr (CC-BY-SA) Crystals from the Bacillus thuringiensis (Bt), called Cry protein, are toxic to various insects: moths & butterflies, beetles, ants, wasps, flies & mosquitoes, bees, nematodes. The insertion of this gene into plants like corn (Bt-Corn) was designed to be resistant to pests. Disease Resistance Papayas in the United States primarily come from Hawaii. A virus known as Papaya Ringspot Disease threatened the papaya crop in Hawaii. To combat this, papayas were genetically engineered to block viral entry into the papaya cells. Papayas purchased in Latin markets are most likely unmodified and usually come from Mexico where the ringspot disease is not yet a problem. Plum Pox Virus is a threat to the genus Prunus. A genetically modified plum plant has been developed called C5. The cells in these plants silence the expression of plum pox coat protein if infected to block propagation of the virus. An apricot infected with plum pox. C5 resistant plums Nutritional Engineering Credit: en:user: Petaholmes, (CC-BY-SA 3.0) Golden rice is a genetically engineered rice that is meant to address Vitamin A deficiency. It introduces enzyme genes from other species involved in the biosynthetic pathways for β-carotene production, a vitamin A precursor. It is estimated that millions of deaths and irreversible blindness occur in the third world each year due to Vitamin A deficiency and creating this rice was meant to address the problem. Rice is a staple in many cultures, therefore it is a good delivery system. Many controversies exist surrounding Golden Rice due to anti-GMO sentiment (from patenting systems), cultural sensitivities (white rice revered in certain cultures), and Vitamin A content/conversion doubts. Heterologous Expression in Tissue Culture Human Embryonic Kidney cells (HEK293T) expressing the green fluorescent protein. Higher magnification of HEK293T expressing the green fluorescent protein. Plasmid Structure pTarget mammalian expression vector. The MCS is inside the LacZ gene which permits for blue/white screening of the bacteria after cloning. The LacZ runs in the opposite orientation as the CMV promoter which will drive the gene transcription when inside a mammalian cell. SV40 origin servers as a plasmid replication origin if the cell line also expresses SV40 large T antigen, such as HEK293T cells. Mammalian expression vectors contain the same hallmark features as bacterial plasmids: bacterial replication of origin and bacterial antibiotic resistance gene (β-lactamase or AmpR). General bacterial plasmid features allow for the carrying and the propagation of the plasmid in a bacterial cell. Mammalian expression vectors additionally include a strong mammalian promoter (like CMV from the cytomegalovirus immediate early promoter) upstream of a multiple cloning site (MCS). Plasmids transfected into cells are transient in nature unless the DNA is selected for. The inclusion of a mammalian antibiotic resistance gene, like neomycin phosphotransferase (NeoR), allows for the integration of the plasmid into the genome of the cell by using high concentrations of Neomycin or the analog G418. Lipofection Cationic lipids can encapsulate plasmid DNA in liposomes. The cationic portions interact with the negatively charged plasma membrane to deliver the DNA into cells. Calcium Phosphate Transfection Calcium chloride solution can be used to incubate with plasmid DNA. When this solution is mixed with a HEPES-buffered saline solution (HeBS) containing phosphate ions, the solution precipitates onto the surface of mammalian cells where they are taken up with the DNA. Knock-Out & Transgenesis In the laboratory, model organisms are modified in order to understand the basic mechanisms of genes. The transformation of recombinant DNA into bacteria is an example of a genetic modification. Other model organisms, like mice, are used to study genes. Through recombinant DNA scientists can selectively ablate a gene, or create a knock-out (KO). Embryonic stem (ES) cells are pluripotent cells with the capacity to differentiate into other cell types. Cultured ES cells can be transfected with plasmid DNA in order to genetically alter them. Linearized vectors containing a disrupted gene can homologously recombine with the native gene to replace it. Selection of cells with the disrupted gene by an antibiotic (like G418) enables the isolation and propagation of engineered ES cells. Credit: Kjaergaard (CC-BY- 3.0) Credit: Kjaergaard (CC-BY- 3.0) ES cells can be injected into mouse blastocysts and partially contribute to the subsequent mouse upon implantation into a mouse. These first mice are referred to as chimeras because they arise from mixtures of cells from 2 genetic sources. Germ-line transmission of the modified cells is desired and breeding of the chimera reveals heterozygous offspring of the engineered background. Full knock-out mice can be generated in the subsequent generation of breeding. Credit: Smartse (CC-BY-SA 3.0) Scientists can also overexpress or heterologously express foreign genes in what is termed transgenic organisms. As the name sounds, transgene refers to a gene from one place brought across into another. Transgenic and KO models permit scientists to study the roles of genes inside the organism and understand basic functioning. Through mutagenesis, derivatives of the green fluorescent protein (GFP) have been produced to provide a palette of colors. Additionally, the subsequent discovery of similar genes from other cnidarian species have aided biotechnology by providing tracer molecules within developing organisms or within cells. Bacteria expressing various GFP derivatives on agar from the lab of Nobel Laureate Roger Tsien. While commercial organisms like GloFish are a novelty, directed insertion of GFP and the variants into the genome under different promoter systems allow scientists to understand the cell-specific functioning or contribution to the organism. An example of this can be found in developmental neurobiology where individual axons can be traced. A “brainbow” is a system where a cassette of GFP variant genes are placed downstream of a neuronal promoter to permit the tracing of individual neurons and their axons in mice. Credit: Jeff W. Lichtman and Joshua R. Sanes (CC-BY 3.0) Brain of a 10-day old double-transgenic zebrafish. Blood vessels are shown in magenta (Kdrl:mcherry) and a novel population of perivascular endothelial cells are shown in green (MRC1a:eGFP). 14.02: GMO Food (Activity) PCR Detection of GM Food Briefly, genomic DNA will be isolated from food items derived from vegetation. Genetic modification will then be identified by PCR of the plant promoter used in genetic engineering, CaMV 35S. As a positive control for the appropriate extraction of DNA, PCR for plant-specific tubulin will be used. 1. Add 100 μL of lysis buffer to each tube containing the plant or food material. 2. Twist a clean plastic pestle against the inner surface of the 1.5-mL tube to forcefully grind the plant tissue or food product for 1 minute. 3. Add 900 μL of lysis buffer to each tube containing 4. Boil the samples for 5 minutes in a water bath 5. Spin for 2 minutes to pellet cell and food debris. 6. Transfer 350 μL of each supernatant to a fresh tube 7. Add 400 μL of isopropanol to each tube 8. Mix and leave at room temperature for 3 minutes. 9. Spin for 5 minutes. 10. Carefully pour off and discard the supernatant from each tube. Air-dry pellet. 11. Add 100 μL of TE buffer to each tube. 5 min at room temperature then keeps on ice. PCR for 35S Promoter 1. Label one tube “35S FP” for food product. 2. Label one tube “35S WT” for wild-type soy: Negative control. 3. Label “35S RR” for Roundup Ready® soy plant: Positive control. 4. Different groups will only do one control. 5. Add 22.5 μL of the 35S primer/loading dye mix to each tube containing PCR bead. • 5′-CCGACAGTGGTCCCAAAGATGGAC-3′ (Forward Primer) • 5′-ATATAGAGGAAGGGTCTTGCGAAGG-3′ (Reverse Primer) 6. Add 2.5 μL of food product DNA to the reaction tube marked “35S FP.” 7. Add 2.5 μL of wild-type or Roundup Ready® soybean DNA to the appropriate reaction tube marked “35S WT” or “35S RR.” PCR for Tubulin: (Positive Control for DNA Quality and PCR Conditions) 1. Label one tube “T FP” for food product. 2. Label one tube “T WT” for wild-type soy. 3. Label “T RR” for Roundup Ready® soy plant. 4. Different groups will only do one control. 5. Add 22.5 μL of the Tubulin primer/loading dye mix to each tube containing PCR bead. • 5′-GGGATCCACTTCATGCTTTCGTCC-3′ (Forward Primer) • 5′-GGGAACCACATCACCACGGTACAT-3′ (Reverse Primer) 6. Add 2.5 μL of food product DNA to the reaction tube marked “T FP.” 7. Add 2.5 μL of wild-type or Roundup Ready® soybean DNA to the appropriate reaction tube marked “T WT” or “T RR.”

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/14%3A_Genetic_Modification/14.01%3A_Introduction.txt

• 15.1: Introduction Recombinant DNA technology has many uses in basic scientific research to better understand the nature of living things. As a tool, recombinant DNA technology can be used to express proteins towards medical applications. Prior to biotechnology, type I diabetes (insulin-dependent) was treated by injection of insulin isolated from the pancreas of pigs. With the ability to express human proteins inside bacteria, yeast, and other cells, sacrificing pigs for porcine insulin is no longer necessary. • 15.2: Protein Purification (Activity) This exercise seeks to purify Green Fluorescent Protein (GFP) or Blue Fluorescent Protein (BFP) from the bacterial lysate. These proteins have a specific size of 238 amino acids and are 40,000 daltons (40kD). Based on their specific size, they will have a specific rate of migration through the size-exclusion resin. Remember that the bacterial lysate is full of additional proteins that are not your protein of interest that we are attempting to isolate. 15: Protein Production Protein Expression Recombinant DNA technology has many uses in basic scientific research to better understand the nature of living things. As a tool, recombinant DNA technology can be used to express proteins towards medical applications. Prior to biotechnology, type I diabetes (insulin-dependent) was treated by injection of insulin isolated from the pancreas of pigs. With the ability to express human proteins inside bacteria, yeast, and other cells, sacrificing pigs for porcine insulin is no longer necessary. Bacterial expression vector pGEX-3X contains the AmpR gene, the origin of replication, MCS downstream of the hybrid lac/trp promoter (tac) and the coding sequence for glutathione-S-transferase (GST). GST acts as a tag that is fused directly with the protein from the gene of interest and used to purify the protein with a glutathione resin. Bacteria or other cells can be engineered to express proteins through the process of cloning and transformation. Bacteria are advantageous because of their rapid life cycle and ease of growth. A bacterial expression vector contains the basic plasmid features: the origin of replication as well as antibiotic resistance gene. Often, an affinity tag will be used to aid in the purification of the protein. An example in the vector above shows the GST (glutathione-s-transferase) tag that can be purified with glutathione resin. Expression is only the first problem since bacteria are also synthesizing proteins that are required for the bacteria to grow and divide. Injecting these proteins in addition to insulin would cause an immune reaction that could be deadly. Therefore, it is required that overexpressed proteins be purified and isolated from other undesirable proteins. Credit: Stewart EJ, Madden R, Paul G, Taddei F (CC-SA 3.0). Criteria for Choosing an Expression System Protein expression systems have inherent advantages and disadvantages. The table above summarizes the comparison of the various cellular systems of production (Fernandez & Hoeffler, 1999). Purification Different methods of isolation can be applied depending on the properties of the protein. Ion exchange chromatography is useful if the protein of interest has a specific charge that will interact with a resin packed with the opposite charge. Immunoprecipitation Immunoprecipitation: Column is packed with Protein-A agarose which binds to antibodies. Cell lysates are then loaded onto the columns where they flow through and are allowed to interact with the antibody. Washes are performed to remove the non-specifically bound proteins. An elution buffer is used to disrupt the interaction of the antibody to the protein target. Affinity Purification Affinity purification employs the use of specific antibodies that bind to the protein of interest very tightly to retain it on a column. With these techniques, the protein retained on the resin is washed numerous times to remove other proteins that are non-specifically sticking. A change in pH or ionic conditions then is used to disrupt the interaction with the resin and elute the proteins from the column. Proteins that are engineered to contain tags can be purified by antibodies specific to those tags. Also, the addition of 6 or more consecutive Histidine residues to the end of a protein makes them susceptible to purification with Nickel-NTA resin or Cobalt purification. In these cases, the 6XHis tag associates with these metal ions on the resin are selectively adhered. Nickel NTA resin coordinating the capture of a 6His tagged protein. Size Exclusion Credit: Mydriatic (CC-BY-SA 3.0) Credit: Takometer(CC-BY 2.5) Most of you are familiar with water purification filters. Before using these filters, you soak them in water and dark residue leaks out. This dark residue is activated charcoal. The activated charcoal has tiny microscopic pores that trap small items like ions and other particles. The primary goal of these filters is to remove metals and chlorine that are found in tap water. The porous nature of activated charcoal renders it useful for trapping molecules in water purification systems. The process used to trap these small particles is called size exclusion. Unlike agarose gel electrophoresis where the smaller particles navigate through the matrix faster, size exclusion resins trap the smaller molecules. The smaller the molecule, the longer they spend within the pores as they traverse through the matrix. Significance of Purification Credit: Hans Hillewaert (CC-BY) All injectable drugs must be clean of endotoxins from bacteria. Purification of the protein of interest from bacterial lysates removes the dangerous pathogenic materials from that would otherwise activate host immune reactivity. The horseshoe crab (Limulus polyphemus) performs a special function in the ecosystem by providing eggs for migratory birds to feed on. This organism also houses a special cell type in its hemolymph. The Limulus amoebocyte lysate (LAL) test is the most sensitive assay of detecting endotoxins from bacteria. Amoebocytes are collected from these organisms for use on testing batches of injectable drugs to ensure proper purification and safety. 15.02: Protein Purification (Activity) Size-Exclusion of Dye Molecules As a demonstration, the instructor may illustrate the concept of size exclusion on a set of mixed food coloring. Size exclusion chromatography of food coloring. 1. Let the column empty over a beaker. 2. Carefully load 0.2 ml of food coloring mixture onto the column. 3. Place 10 tubes on a rack under the column. 4. Place a 1 ml buffer on the column and collect 0.5 ml fractions. 5. Continue to add buffer 1 ml at a time until all fractions have been collected. Size-Exclusion of Proteins This exercise seeks to purify Green Fluorescent Protein (GFP) or Blue Fluorescent Protein (BFP) from the bacterial lysate. These proteins have a specific size of 238 amino acids and are 40,000 daltons (40kD). Based on their specific size, they will have a specific rate of migration through the size-exclusion resin. Remember that the bacterial lysate is full of additional proteins that are not your protein of interest that we are attempting to isolate. 3D model of GFP (Top Left), BFP (Top Right), structural alignment of GFP and BFP (Center) and the sequence alignment (Bottom) illustrating the 3 amino acid changes to produce the alternative protein. Red asterisks indicate the location of mutations. Drops of fluid will be collected in fractions. The fractions containing the fluorescent proteins will be found only in specific fractions that will be visible under UV illumination. 1. Vertically mount the column on a ring stand. Make sure it is straight. 2. Slide the cap onto the spout at the bottom of the column. 3. Mix the slurry (molecular sieve) thoroughly by swirling or gently stirring. 4. Carefully pipet 2 ml of the mixed slurry into the column by letting it stream down the inside walls of the column. 5. Place an empty beaker under the column to collect wash buffer. 6. Remove the cap from the bottom of the column and allow the matrix to pack into the column. 7. Label eight microcentrifuge tubes #1-8. 8. Slowly load the column with 0.2ml of the GFP extract. Allow the extract to completely enter the column. 9. Add 1ml of the elution buffer on top of resin without disturbing the resin. • Add buffer slowly (several drops at a time) to avoid diluting the protein sample. • Using the graduated marks on the sides of the tubes, collect 0.5ml fractions in the labeled microcentrifuge tubes. • Continue to add 1ml buffer and collect fractions until all tubes are full. 1. Check all fractions by using long wave U.V. light to identify tubes that contain the fluorescent GFP or BFP proteins. 2. Further purification may be performed with a different resin with the few fractions containing the protein of interest. 3. Protein samples should be run on an acrylamide gel and stained against all proteins to check the purity of the sample or fluorescence measurements taken.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/15%3A_Protein_Production/15.01%3A_Introduction.txt

• 16.1: Introduction Biological sequences are passed to software in a standardized format referred to as FASTA. FASTA is a plain text format that can be read in any text editor (TextEdit, Notepad, VIM, etc). Nucleic acids (DNA and RNA) and Proteins are represented by single-letter nucleotides (A, T, C, G) or single letter amino acid (20 amino acids). FASTA sequences begin with a > character in the first line and can contain multiple sequence entries all demarcated by a new line and a title line beginning with >. • 16.2: Sequence Analysis This page contains instructions on how to perform a sequence analysis by counting the ORFs using a FASTA file and the UGENE software. • 16.3: In Silico Restriction Restriction enzymes act as molecular scissors. The ones we use in Molecular Biology are those that cut within known sequences that occur often enough, yet rare enough to cut our DNA into analyzable fragments. Molecular Biologists often use 6-cutters. This means that the site of digestion is “restricted” to a recognition sequence of 6 nucleotides. These nucleotides are usually palindromic as discussed before. • 16.4: In Silico PCR Using the primer sequences, one can determine the size and/or location of a PCR product. This can be done using BLAST or with a program like UGENE. This page contains instructions on how to use BLAST and UGENE to determine the size and/or location of a PCR product. • 16.5: Primer-BLAST Primer-BLAST is a combination of a program called Primer3 that aids in the design of primers with specific properties and BLAST. Primer-BLAST allows for the construction of primers for qPCR where the user can specify the melting temperature, reduce the amount of self-priming, and span exon-exon junctions in order to avoid amplification of contaminating genomic DNA. This process ensures that the primers designed fall within your design parameters and most likely only amplify your interested gene. • 16.6: Morphometic Analysis Morphometrics (morpho– shape; metrics– measurements) is the use of physical measurements to determine the relatedness of organisms. With extinct organisms that have died out long ago, DNA extraction proves to be difficult. Likewise, prior to DNA technologies to analyze species, Linnean taxonomy was ascribed to organisms based on similarities in features. • 16.7: Sequence Alignment and Tree Building This page contains an informative video on how to perform a tree-building process on UGENE using MUSCLE and PhyML as well as the command line for the example file. 16: Bioinformatics FASTA Format Biological sequences are passed to software in a standardized format referred to as FASTA. FASTA is a plain text format that can be read in any text editor (TextEdit, Notepad, VIM, TextWrangler, etc.). Nucleic acids (DNA and RNA) and Proteins are represented by single-letter nucleotides (A, T, C, G) or single letter amino acid (20 amino acids). FASTA sequences begin with a > character in the first line followed by some descriptive information about the sequence, like a sequence name. The next line consists of the sequence information. A FASTA file can contain multiple sequence entries all demarcated by a new line and a title line beginning with >. Example FASTA File > Made-up nucleic acid sequence ATATAGGGATTAGGATTAGAGGATAGAGGGGATTGCGCCG > Another nucleic acid sequence in the same file GGGTCGGGCTAGCGGAATCGGATTCGGCATTCGGATATTCGGATTCGGAT FASTA files are plain text but usually have an extension indicating it as a sequence file: .fasta, .fa, .fna or even .txt A list of single-letter codes for nucleic acids follows below: Nucleic Acid Code Meaning Mnemonic A A Adenine C C Cytosine G G Guanine T T Thymine U U Uracil R A or G puRine Y C, T, or U pYrimidines K G, T, or U bases which are Ketones M A or C bases with aMino groups S C or G Strong interaction W A, T, or U Weak interaction B not A (i.e. C, G, T, or U) B comes after A D not C (i.e. A, G, T, or U) D comes after C H not G (i.e., A, C, T, or U) H comes after G V neither T nor U (i.e. A, C, or G) V comes after U N A, C, G, T, U Nucleotide X masked Gap of indeterminate length Graphical Sequence Manipulation The exercises described here regarding bioinformatics will utilize a free and open-source software called Unipro UGENE.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/16%3A_Bioinformatics/16.01%3A_Introduction.txt

1. Download the file LacZ.gb and open in a text editor. • This is a Genbank format file that contains the sequence following the word ‘ORIGIN‘ and terminating with ‘//‘. • Prior to the sequence is a batch of descriptive information including references, organism, and database cross-reference identifiers. While these don’t mean much to you, the appropriate database within Genbank can be queried to reveal more information about the sequence. 2. Download the file LacZ.fasta and open in a text editor (NotePad). • Notice the simple structure of the fasta file beginning with the ‘>’ and description of the sequence. • This is a DNA sequence. But DNA is usually double-stranded! We can assume the sequence of the second strand because it will be complementary to this one. • By convention: we know that this sequence is 5′ → 3′. • This text contains a portion of the E. coli genome that includes a gene called LacZ. • This file does not contain any annotation to indicate where the gene sequence actually begins or ends. 3. Launch UGENE and open both files. They will appear on the left side “Objects” pane. • The default display automatically shows the reverse complement of the DNA strand and all 6 Open Reading Frames (ORFs). • To simplify the view, click on the ‘C‘ to remove the complementary strand (look at the cursor in the image). 4. Count the ORFs: • Find ORFs by right-clicking on the sequence and select “Analyze → Find ORFs • Default setting looks for ORFs on both strands with a minimum length of 100 nucleotides • The Open Reading Frame here is defined as something beginning with initiation or start codons from the Standard Genetic Code (ATG) and two additional alternative start codons (TTG & CTG) that is terminated by any one of the three standard stop codons (TAA, TAG, TGA) • Selecting Preview will provide the number of possible ORFs fitting these criteria. 5. Double click on the LacZ.gb in the Objects panel to activate the view. • This file now shows the same sequence with information about the DNA. • Expand the various features in the Annotations pane at the bottom to explore the sequence features. 16.03: In Silico Restriction Concept Restriction enzymes act like molecular scissors. The ones we use in Molecular Biology are those that cut within known sequences that occur often enough, yet rare enough to cut our DNA into analyzable fragments. Molecular Biologists often use 6-cutters. This means that the site of digestion is “restricted” to a recognition sequence of 6 nucleotides. These nucleotides are usually palindromic as discussed before. Imagine a linear piece of DNA as a piece of string. When cutting the string once, you result in 2 pieces. Now consider a plasmid. This was already discussed to be a circular piece of DNA. With a circle, there are no ends. cutting the plasmid once results in 1 piece of DNA as opposed to 2. Keep this in mind when digesting circular plasmids. In this case, nucleotide 1 is adjacent to and contiguous with the last nucleotide of the sequence. In Silico Digestion 1. This activity is meant to supplement Identification of DNA (activity) 2. Launch UGENE and open the following files: 3. In the Objects menu, right-click on the sequences and select “Mark as circular • The sequences will now be treated as circular DNA. • The first nucleotide and the last nucleotide become adjacent as a continuous sequence this way. 4. From the top menu, select ActionsAnalyzeFind restriction sites. • This will load a set of default restriction enzymes • If none are loaded, select them individually (found in alphabetical order) • Choose: BamHI, BglII, ClaI, DraI, EcoRI, EcoRV, HindIII, KpnI, PstI, SalI, SmaI, XbaI, XmaI, NotI 5. ActionsCloningDigest into fragments • Choose your enzyme. • Try Hind III for each plasmid. • Fragments will be added to the circular view and annotations for these fragments will be added. • You can use this information to calculate how many fragments come from enzymes based on how many times they cut and by the nucleotide coordinates found in the annotation of the fragment.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/16%3A_Bioinformatics/16.02%3A_Sequence_Analysis.txt

Using the primer sequences, one can determine the size and/or location of a PCR product. This can be done using BLAST or with a program like UGENE. Using BLAST 1. Primers for the PV92 insertion. • Forward primer: 5′ GGATCTCAGGGTGGGTGGCAATGCT 3′ • Reverse primer: 5′ GAAAGGCAAGCTACCAGAAGCCCCAA 3′ 2. Visit BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch. 3. Paste both primers: • GGATCTCAGGGTGGGTGGCAATGCTGAAAGGCAAGCTACCAGAAGCCCCAA • Remove the 5′ and 3′ numbers. 4. Choose “Somewhat Similar”. • Locate the locus of the product and the size. Using Ugene 1. Exercise using a human D-Loop Primers. • Forward Primer 5’-TTAACTCCACCATTAGCACC-3’ • Reverse Primer 5’-GAGGATGGTGGTCAAGGGAC-3’ 2. Download the sample Genbank file: Human Mitochondrial Genome. 3. Open the file in Ugene. 4. Select the “In Silico PCR” button on the far right (double helix button). • Insert forward and reverse primers in the appropriate spaces. 5. A PCR product should be noted for one of the sequences after pressing “Find Products anyway“. 16.05: Primer-BLAST Primer-BLAST is a combination of a program called Primer3 that aids in the design of primers with specific properties and BLAST. Primer-BLAST allows for the construction of primers for qPCR where the user can specify the melting temperature, reduce the amount of self-priming, and span exon-exon junctions in order to avoid amplification of contaminating genomic DNA. After the design of primers, each primer pair is sent into BLAST to identify if similar products within the genome of the model organism will also be primed and amplified. This process ensures that the primers designed fall within your design parameters and most likely only amplify your gene of interest. 1. Enter the sequence OR the NCBI accession number for the gene of interest. 2. Define the PCR product length. 1. Limiting the product between 100-500 permits for good efficiency in qPCR. 2. Longer products may not be efficiently replicated depending on your cycling protocol. 3. Define the desired melting temperature (Tm) of the primers (the minimum, optimal, maximum, difference between the set). 1. 60ºC is fairly high and will aid in the enhanced specificity of the primer with the target during amplification to avoid false priming. 2. Try to have the Tm as close as possible so that they are annealing about equally. 4. Choose the option “Primer must span an exon-exon junction”. 1. This aids in amplifying cDNA and not genomic DNA that may be contaminating. 2. Do not select this if it a single exon gene as this will fail. 5. Select Refseq mRNA as the database to search against. 1. Refseq provides sequences to naturally occurring sequences. 2. Things like plasmid sequences or vector constructs do not show up in Refseq. 6. Select the organism you are BLASTing against. 1. There are options for model organisms as well as cell lines. 2. If you are using something like PC12 cells, you may use Rattus norvegicus or PC12 genome since that is also an option in the database. 7. Evaluate the location of the primers and the other parameters. We generally choose primers at the 3′ end of the RNA since RT reactions often have a 3′ bias in eukaryotes by using oligo-dT priming in the reverse transcription.

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/16%3A_Bioinformatics/16.04%3A_In_Silico_PCR.txt

Morphometrics and Physical Markers Morphometrics (morpho– shape; metrics– measurements) is the use of physical measurements to determine the relatedness of organisms. With extinct organisms that have died out long ago, DNA extraction proves to be difficult. Likewise, prior to DNA technologies to analyze species, Linnean taxonomy was ascribed to organisms based on similarities in features. Describing Species and Variation of Morphologies Below are images of skull landmarks of the lizard family Varanidae. This family includes monitor lizards and Komodo Dragons. As can be seen below, the general morphology of the skulls is similar enough that they all retain the same landmarks. The figure below also illustrates the diversity in these lizards that illustrate a large variation between species. Skulls of the species involved in this analysis. McCurry et al. (2015) (CC-BY) Landmarks Standardize Measurements Having a set of shared landmarks provides the opportunity to make systematic measurements of morphometric features. Landmarks and measurement metrics for the morphometric analysis of skulls. McCurry et al. (2015) (CC-BY) Euclidean Distance to Measure Relatedness Euclidean distance is a measurement derived from Pythagorean geometry that describes the shortest distance ($d$) between 2 points ($A$ and $B$) as a straight line using triangulation. In a Cartesian space, the points can be defined: $A = \left( x _ { A } , y _ { A } \right)\nonumber$ and $B = \left( x _ { B } , y _ { B } \right)\nonumber$ Standard Pythagorean theorem can be expressed as: $x ^ { 2 } + y ^ { 2 } = d ^ { 2 }\nonumber$ To find the distance between the 2 points, we utilize algebra to calculate for . $d = \sqrt { x ^ { 2 } + y ^ { 2 } }\nonumber$ In this case, we expand to comparing the coordinates of the two points: $\Delta x = x _ { B } - x _ { A }\nonumber$ and $\Delta y = y _ { B } - y _ { A }\nonumber$ We can then expand this idea to include the differences in data points that describe the comparisons of multiple measurements. $d \left( \mathbf { X } _ { \mathbf { i } } , \mathbf { X } _ { \mathbf { j } } \right) = \sqrt { \sum _ { k = 1 } ^ { p } \left( X _ { i k } - X _ { j k } \right) ^ { 2 } }\nonumber$ Calculating Distance with R 1. Download the dataset (McCurry et al. 2015) associated with this activity (a Comma Separated Value .csv file). This can be used in a spreadsheet or in a text editor. This data can be imported into R to determine the Euclidean distances of landmarks. 2. The following code in R will download the data set into a variable called “varanoid”, measure Euclidean distance and save a plot into a PDF file in a directory called “/tmp”. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 ## install curl for fetching from internet if it isn't install.packages('curl') ## Load the curl library library(curl) ## read the data of measurements and assign it to a variable 'varanoid' varanoid = read.csv(curl('https://raw.githubusercontent.com/jeremyseto/bio-oer/master/data/varanoid.csv')) ## set the row names to the Species column row.names(varanoid) = varanoid\$Species ## remove the first column of the table to have purely numeric data varanoid_truncated = (varanoid[,2:14]) ## calculate distance using euclidean as the method dist_measure = dist(varanoid_truncated, method='euclidean') ## display dist_measure to look at the comparisons dist_measure varanoid_cluster = hclust(dist_measure) ## open PDF as a graphics device to save a file in the '/tmp' directory pdf(file='/tmp/varanoid_tree.pdf') plot(varanoid_cluster) dev.off() ## close the device to save the plot as pdf DNA Analysis Before starting this activity, review bioinformatics and sequence analysis. 1. Search NCBI for mitochondrial sequences from the species involved in McCurry 2015. The data has been submitted by Ast (2001). 2. Find the sequences and identify/extract elements that are common to all. 3. Assemble the shared sequences in a text editor as a single FASTA file where each species is separated by a header (“>Species A”). • Notepad on Windows (but it’s better to download notepad++) • Textedit on Mac (but probably better to download TextWrangler) • Gedit on Linux 4. Save the file as “something.fasta”. 5. Perform a multiple sequence analysis using UGENE. 6. Generate a phylogenetic tree using UGENE. For this exercise, use Maximum Likelihood (PhyML) as the algorithm. File the tutorial below. 7. Compare the DNA with the morphometric analyses. What problems could we imagine arise if we rely solely on morphometry? 16.07: Sequence Alignment and Tree Building UGENE The following video illustrates the tree-building process using MUSCLE and PhyML in UGENE. Command Line The following requires: • A UNIX-like environment like Linux or MacOS • MUSCLE to perform a multiple sequence alignment • PhyML to generate Maximum Likelihood • FigTree to manipulate the tree Download the example file oranges. In the download directory, perform the following: 1 2 3 4 5 6 7 8 9 `unzip orange.zip` `cd` `orange` `cat` `./*txt >> oranges.fasta ``## merges all files into a single fasta file` `muscle -``in` `oranges.fasta -phyiout oranges.phy` `## -phyiout tells muscle to use the interleaved phylip format for output` `phyml -i oranges.phy -m HKY85` `## -m is for method and HKY85 is the default nucleotide method we used in UGENE` `mv` `oranges.phy_phyml_tree.txt oranges.nwk` `## change the name of the output to reflect it is a nwk file`

textbooks/bio/Biotechnology/Bio-OER_(CUNY)/16%3A_Bioinformatics/16.06%3A_Morphometic_Analysis.txt

Learning Objectives Goals: • Understand the importance of a well-kept notebook. • Learn how to enter information and maintain a legal scientific notebook. • Familiarize students with basic safety rules. • Allow students to become familiar with the safety equipment in the laboratory. Student Learning Outcomes:: • Record information into a notebook in a legally acceptable format. • Format a table of contents. • Make appropriate corrections to their notebook. • Engage in good laboratory practices. • Properly use Personal Protective Equipment (PPE). • Identify the location and proper use of emergency equipment. • Recognize the meaning of common laboratory safety signs. • Interpret data on the safety diamond. Introduction Regardless if you work at a biotechnology company or in an academic research lab, keeping a lab notebook is a requirement. The Food and Drug Administration’s (FDA) handbook states, "if it isn't written down, it wasn't done." The lab notebook is considered a legal document and can be used in court to settle patent disputes or to report a specialist’s finding in paternity suits or criminal cases. Often times, the lab notebook is used as a starting point for other scientists who work in the lab. Lab notebooks are always maintained for the following reasons: • To record the steps an individual has carried out and to document their observations • To establish ownership in case of a patent dispute or other legal issues • To establish guidelines used to evaluate the process in which a product was made and to evaluate the product itself • To follow the production of a product through the manufacturing process • To create a contract between a company and consumers and/or between a company and regulatory agencies • To demonstrate a procedure was done correctly • To develop, follow, and evaluate standard operating procedures (SOP) Without documentation, even quality work is worthless. In the event of an experiment failing, the documentation allows for a scientist to review their protocol and make adjustments for future experiments. As stated above, in industry, lab notebooks are legal documents. They are used to determine product quality, patent rights, and liability. Notebooks are always treated as if they will be used in court because the consequences of not doing so could be devastating to a company. Part I: Setting Up a Legal Scientific Notebook A notebook should contain what equipment and materials were used and what steps were followed to show that the equipment and materials were validated before use. In case of an audit by government regulatory agencies, a company must be able to produce documentation that proves that they are following Good Manufacturing Practices (GMPs). If they find that a notebook was missing information or was not legible, then the company may be fined or held liable for damages in a product lawsuit. The importance of a well-kept notebook cannot be emphasized enough. Guidelines for Setting Up a Legal Scientific Notebook *For the purpose of this course, pages suitable for a lab notebook are included in the appendix. Your instructor may direct you to print a specific number of pages and bind them with staples along the long left edge to serve as a low-cost substitute for an official bound notebook. 1. Obtain a bound notebook, such as a composition book. Spiral notebooks are not acceptable. 2. Use only blue or black pen to make entries. NO PENCIL ALLOWED. 3. Label the outside of your notebook with the information: 4. Make pages 1-4 the Table of Contents. Write “Table of Contents” at the top of each of these pages. Record the title of each lab or entry and the page number for each. 5. Each page in the notebook must be numbered. Number each page of the notebook in the upper corner with the first page of the notebook being “page 1.” The back of the first page will be “page 2” and so on. 6. Record the date of each entry at the top of each page. 7. Sign and date the bottom of each page. 8. For each experiment (or activity) that you perform, you should include the purpose for the experiment, the materials and methods you use, any data tables, figures or graphs properly labeled with a title, and a conclusion. 9. Do not erase errors. Just draw a single line through an erroneous entry, then add your initials. Enter the correct entry nearby. 10. Never leave blank spaces. Draw a diagonal line through all open or blank space. 11. If an entry continues on a different page, include “go to page ____” on the bottom right hand of the page to let the reader know where the rest of the information is located. 12. Graphs and other small sheets of paper can be pasted into the notebook using a glue stick. 13. Always include enough details for someone else to successfully duplicate the work you have recorded. 14. Label all figures, tables and calculations. Figures should be labeled on the bottom left and tables are labeled on the top left. 15. Never remove pages from your notebook. Activity: Analysis of Sample Lab Notebook Entries 1. Using blue or black pen complete steps A-E of the “guidelines for setting up a legal scientific notebook.” 2. Enter a title in your lab notebook page (and in Table of Contents) as “Analysis of Sample Lab Notebook Entries.” 3. Label the top of page 5 Lab A: Analysis of Sample Lab Notebook Entries. 4. Each student should obtain a copy of the “Sample student notebook entries.” 5. Review each of the three samples by yourself. You may choose to use the notebook scoring rubric provided in the appendix of this manual. Once you have reviewed the entries you can discuss your opinions with your group members. Make a list of what the student did well and what the student could have improved upon. 6. Draw 3 tables into your notebook, one for each student entry you will be evaluating. Score: ____ / 10 pt Table 1. Review of Sample Lab Notebook: Entry #1 What did student do well? Improvements Needed? 1. If you were grading these lab entries, what categories/criteria would you use to assign points? If you were the grader, what overall score (out of 10 points) would you assign the samples? Part II: Lab Safety Introduction Laboratory safety involves all the measures taken by the laboratory worker, laboratory owner, institution and regulatory agencies to eliminate potential harm to human health and well-being. Although steps are taken to reduce risks in the workplace, safety is a matter of personal responsibility. A biotechnology lab may have several safety hazards that must be known and understood by all students or employees working in the lab. It is the responsibility of each person in the lab to know and follow basic laboratory safety rules, to understand how to safely operate equipment, understand the hazards of materials they are working with and to work to reduce potential risks. In the event of an accident, it is critical to know the location and use of emergency equipment. Having this knowledge should help to prevent accidents and minimize damage that might occur in the event of an accident. A. Laboratory Safety Equipment Draw Table 2 in your lab notebook. Fill in the location of the following lab safety items: Table 2. Laboratory Safety Equipment and Location Safety Equipment Location Telephone and Campus Emergency Number Fire Alarm Fire Extinguisher Eye Wash Shower Glass Waste Container Biohazard Waste Container Lab Coats Goggles Gloves Disinfectant First Aid Kit Broom and Dust Pan Emergency Class Evacuation site Laboratory Safety Guidelines and Contract General Rules • No guests are allowed in the lab. • Know emergency procedures, use and location of emergency equipment (emergency exits, fire extinguishers, fire blanket, eye wash station, first aid kit, and broken glass container). • In case of fire, evacuate the room and assemble outside the building. • Report all accidents, no matter how insignificant they appear, to a laboratory supervisor • Be aware of your surroundings and potential dangers created by others. Personal Protection • Do not smoke, eat, drink, chew gum, or apply cosmetics in a laboratory. • Wear protective clothing such as long pants, closed-toe shoes, a lab coat, and goggles. • Tie long hair up or behind the shoulders. Do not wear long, dangling jewelry or scarfs. • Dispose of gloves in the laboratory trash. Do not wear lab coats and gloves into public areas. You will need to dispose of gloves and take off your lab coat before leaving the lab. • Cover cuts or scrapes with a sterile, waterproof bandage before entering a lab. • Wash skin immediately and thoroughly if contaminated by chemicals or microorganisms. • Wash your hands regularly, with soap and water, especially after working with bacteria. • If you are pregnant or ill, please let your lab instructor know immediately. • Let your lab instructor know before leaving the classroom. Handling Chemicals • Keep all containers capped with the appropriate lid. Clearly label items produced in the lab. • If a chemical is splashed into the eyes or skin, flush for 15 minutes. • Clean up spills and broken glass immediately. Use broom and dustpan to pick up broken glass. • Keep chemicals away from direct heat or sunlight. Keep containers of alcohol, acetone, and other flammable liquids away from flames. • Read labels carefully. Be aware of hazardous chemicals and precautions for safe use. • Follow instructions about proper disposal of lab reagents. Handling Equipment • Keep your work area clean and clutter-free. • Be aware of your potential impact on others. • Notify lab supervisor of malfunctioning equipment. • If you do not know how to use an instrument or equipment, then do not touch it. • Do not use laboratory equipment without first receiving instruction in its use. • Keep balances clean and dry, always use weigh paper/boats. • Never leave heat sources unattended. Be careful when using hot plates or burners. Note that there is often no visible flame, glow or sign that objects are hot. I have read the lab safety guidelines, found all lab safety equipment, and understand the procedure about emergency class evacuation. I will conduct myself in a safe and conscientious manner and take proper care in the use of all lab equipment. Signature _______________________________________________ Date ______________________ B. Lab Safety Video 1. While watching the lab safety video, take notes on as many safety hazards as you notice. 2. When the video is over, discuss the hazards you observed with your group and what can be done to work safely using good laboratory practices. 3. Make Table 3 in your notebook and organize your observations. Table 3. Laboratory Hazards and Corrections Laboratory Hazard Observed Correction/Good Laboratory Practices (GLP) C. Chemical Hazards Labeling Activity Hazard Communication Standard (HCS) A quick assessment of a chemical’s hazards is visible on its container on a Hazard Communication Standard (HCS) label. HCS labeling does not replace the more detailed Safety Data Sheet (SDS) but rather gives the following information in brief: • Name, Address, and Phone Number of Responsible Party (i.e., the manufacturer or distributor) • Chemical Identification - chemical name and code or batch number that matches the information found in Section 1 of the chemical's SDS • Signal Word - "DANGER" for more severe hazards or "WARNING" for less severe hazards • Hazard Statements - a brief description of the hazard(s) • Precautionary Statements (optional) - prevention, response, storage, and disposal • Hazard Category Numbers 1-4 (optional) - "1" for the most severe hazard to "4" for the least severe • Pictograms Pictograms are red-bordered, diamond shapes that frame a black graphic on a white background, and these symbols depict the type of hazard(s). HCS labels are required by the Occupation Safety and Health Administration (OSHA) and are standardized, having been adopted from the Globally Harmonized System of Classification and Labeling of Chemicals (GHS) set by the United Nations. HCS Pictogram Guide Pictogram Hazard Class Hazard Type Example Signal Word & Hazard Statement Flammables Self-Reactives Self-Heating Pyrophorics Emits Flammable Gas Organic Peroxides Physical DANGER Heating may cause a fire Explosives Self-Reactives Organic Peroxides Physical WARNING Fire or projection hazard Gases Under Pressure Physical WARNING Contains gas under pressure; may explode if heated Corrosive to Metals Corrosive Skin Corrosion/Burns Eye Damage Physical Health DANGER Causes severe skin burns and eye damage Oxidizer (gases) Oxidizers (solid or liquid) Physical Health WARNING May intensify fire; oxidizer Acute Toxicity (fatal or toxic) Health DANGER Fatal if swallowed Carcinogen Mutagenicity Respiratory Sensitizer Reproductive Toxicity Target Organ Toxicity Aspiration Toxicity Health DANGER May cause cancer Irritant (skin and eyes) Dermal Sensitizer Acute Toxicity (harmful) Narcotic Effects Respiratory Tract Irritation Hazardous to Ozone Layer (optional) Health Other WARNING Causes skin irritation (optional label) Environmental Toxicity Aquatic Toxicity Environment. WARNING Toxic to aquatic life Procedure 1. Walk around the room and locate two items that display the Hazard Communication Standard label. 2. Draw a sketch of the pictogram in your lab notebook and carefully copy the chemical identification information of the reagent that it is describing. 3. Write down the label's signal word and any hazard statements, and comment on the characteristics and hazards of the two items. Chemical Hazards and Waste Disposal Laboratory waste must be disposed of safely and appropriately. Labs must be aware of the school, state and federal guidelines for waste disposal. Many chemicals can NOT be poured down the sink. Be sure you know which chemicals are hazardous, require special storage and must be placed into properly labeled waste containers kept in fume hoods until sent to the proper hazardous waste disposal. Know which materials are considered biohazards and the proper area or container to place them so they can be autoclaved. Table 4. Medical and Biohazardous Waste Treatment and Disposal Chart, U. California Type of Waste Definition Required Treatment Chemical Waste Any solid, liquid, or gaseous material generated in the laboratory that poses a danger to human health or the environment. This will vary depending on the chemical. The institution you are in will have specific requirements to meet regulatory code. The aim is to reduce hazards and minimize environmental impact. Follow your instructor’s directions. Solid Biohazardous Waste Materials such as pipettes, petri dishes, or other culture flasks disposable or glass that do not contain liquid but were in contact with cultures of cells or human or animal-derived materials. Disposable waste is placed in red biohazard bags. Treat and replace bags when they are halfway full. Reusable glass materials must be placed in autoclavable trays. To treat waste, the autoclave must be properly loaded and set for a minimum temperature of 121°C (250°F) for 60 minutes at 15 psi. Autoclave tape must be placed on the bag or tray to indicate it has passed through the cycle. Material should be autoclaved as soon as possible, but at a maximum of 7 days after it is generated Liquid Biohazardous Waste Broth cultures or cell culture media or contaminated liquid media. Decontaminate using 10% bleach solution for a minimum 2 hours contact time. Dispose down the drain with water. Alternatively, racks of used culture tubes can be autoclaved using the same temperature and time indicated above but set for a slow exhaust liquid setting. Use autoclave tape as above. Treat waste as soon as possible but not longer than 7 days post generation. Sharps Waste Any object that is capable of piercing or damaging human skin that is contaminated with chemical, or biohazardous waste e.g., scalpels, blades, needles, broken glass, etc. Place in the marked sharps container. Remember that broken glass that is not contaminated will have a separate disposal container within the laboratory. D. National Fire Protection Association (NFPA) Hazard Rating System The National Fire Protection Association (NFPA) Hazard Rating System was designed for emergency workers such as fire responders to be able to swiftly get basic information about the hazards of a chemical from a simple label. The diamond-shaped label is divided into four color-coded squares, and inside each square is printed a ratings code or number from 0-4, with "0" as the least severe hazard to "4" as the most severe. Inside the red square, the number indicates the flammability rating; blue indicates the health hazard rating; yellow indicates the chemical's instability; and the white square indicates any special hazards. PROCEDURE 1. Walk around the room and find a label with the NFPA safety diamond. Read the explanations in the table above. Write down the chemical name and draw its NFPA diamond. 2. Think of a chemical used in a lab or find a second container without an NFPA label already affixed and then write down its name. Use an internet or in-class resource to draw that chemical's NFPA ratings. 3. Compare the NFPA 704 label with OSHA's Hazard Communication label from the previous activity. How are they the same? How do they differ? What are the pros and cons of each type of label? E. Safety Data Sheets (SDS) A Safety Data Sheet (previously called Material Safety Data Sheet) for each chemical is required by the Occupational Safety and Health Administration (OSHA). Sections 1-8 contain information about the identification, hazards, composition, safe handling practices, and emergency control measures. Sections 9 through 11 and 16 contain technical and scientific information, such as physical and chemical properties, stability and reactivity, toxicology, and exposure control. Draw table 1.3 in your lab notebook and answer the following. Using the SDS for sodium hydroxide provided to your group, determine what should be done in the event that the reagent: a) got on your skin b) splashed into your eyes c) was inhaled Table 5. Safety Procedures for Sodium Hydroxide (NaOH) Adverse Event Response a) NaOH in eyes b) NaOH on skin c) NaOH inhaled Study Questions 1. Review lab safety signs and know their meanings. 2. What are the types of PPE required in a laboratory? 3. How should you dispose of glass waste? 4. How should you dispose of biohazard waste? 5. What should you do if a chemical gets in eyes? 6. Given a laboratory hazard, be able to describe the correction of GLP needed in the lab. 7. What do the 4 diamonds in the NFPA represent? 8. Why must a scientist keep a lab notebook? 9. In industry, a lab notebook is a legal document. What can it be used to determine? 10. What is GMP? 11. What are the Do’s and Don’ts of keeping a legal notebook? Puzzle: Lab Safety and Lab Notebooks Terms Alkaline, Biohazardous, Broom, Contents, Corrosive, Diamond, Flammability, Four, Glass, Health, Instability, Laboratory, Legal, Manufacturing, OSHA, Oxidizing, PPE, Sharps, Special ACROSS DOWN 1. broken test tubes and beakers should be placed in the ___ waste container 7. hazard that the yellow color on the NFPA sign indicates 8. governmental agency that regulates chemical safety data sheets 9. broken test tubes/beakers should be swept with a ___ and dust pan 10. COR on the NFPA sign 12. instrument used to write in a scientific lab notebook 13. used razors, scalpels and needles should be placed in the ___ waste container 14. SOP stands for Standard _____ Procedures 15. rating number for the most dangerous hazards in the NFPA sign 16. ALK on the NFPA sign 17. GLP stands for Good ____ Practices 18. GMP stands for Good ____ Practices 19. hazard that the blue color on the NFPA sign indicates 2. the lab notebook is considered a ___ document and can be used in court 3. abbreviation for Personal Protective Equipment 4. shape of sign that lists the chemical ratings from the National Fire Protection Association 5. hazard that the white color on the NFPA sign indicates 6. table found at the front of a scientific lab notebook 9. type of waste containing recombinant DNA and tissue culture dishes 11. OX on the NFPA sign 15. hazard that the red color on the NFPA sign indicates Image Attributions: • Flammable substances sign via Wikimedia Commons; public domain • Explosive substances sign via Wikimedia Commons; public domain • Gas pressure hazards sign via Wikimedia Commons; public domain • Corrosive substances sign via Wikimedia Commons; public domain • Oxidizing substances sign via Wikimedia Commons; public domain • Toxic substances sign via Wikimedia Commons; public domain • Health hazard sign via Wikimedia Commons; public domain • Hazardous substances sign via Wikimedia Commons; public domain • Environmental hazard sign via Wikimedia Commons; public domain • Eyewash sign via Wikimedia Commons; public domain • Emergency shower sign via Wikimedia Commons; public domain • Fire blanket sign via Wikimedia Commons; public domain • Fire extinguisher sign via Wikimedia Commons; public domain • Ionizing Radiation sign via Wikimedia Commons; public domain • Laser Radiation sign via Wikimedia Commons; public domain • Explosive substances sign via Wikimedia Commons; public domain • High Voltage sign via Wikimedia Commons; public domain • No eating or drinking sign via Wikimedia Commons; public domain • Nonpotable water sign via Wikimedia Commons; public domain • Do not enter sign via Wikimedia Commons; public domain • No smoking sign via Wikimedia Commons; public domain • Corrosive Substances sign via Wikimedia Commons; public domain • Poisonous substances sign via Wikimedia Commons; public domain • Oxidizing material sign via Wikimedia Commons; public domain • Highly flammable substances sign via Wikimedia Commons; public domain • Emergency call button sign via Wikimedia Commons; public domain • First Aid sign via Wikimedia Commons; public domain • Automated heart defibrillator sign via Wikimedia Commons; public domain • Ionizing radiation sign via Wikimedia Commons; public domain • Use protective eyewear sign via Wikimedia Commons; public domain • Use protective handwear sign via Wikimedia Commons; public domain • NFPA 704 warning sign sign via Wikimedia Commons; public domain • Health Hazard sign via Wikimedia Commons; public domain

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.01%3A_Lab_Safety_and_Laboratory_Notebook.txt

Learning Objectives Goals: • Review the metric system. • Learn to convert between metric units. • Use various instruments found in the biotechnology lab. • Measure mass and volume with precision and accuracy. • Pipet with precision and accuracy. • Learn how to use a micropipette to measure very small volumes. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Convert between metric units for mass, volume and size. • Use a gram balance to obtain the mass of an object. • Make accurate and precise measurements with a graduated cylinder and serological pipette. • Calculate percent error for a given measurement. • Read, set, and operate a micropipette. • Determine which pipette should be used to measure a specific volume. • Determine how accurately you can measure with each micropipette. Part 1: Metrics Introduction to Metrics Working in a biotechnology lab requires knowledge of the metric system. The metric system uses standardized units of measurement for length, mass, and volume, ensuring measurements are reproducible and easily made. Appropriate instruments are used to make these measurements. For example, balances measure mass in grams and graduated cylinders measure volume in milliliters. The metric system has base measurements. The meter is used to measure distances; the liter measures volume; and the gram measures mass. A measurement must always consist of a number and a unit, for example, 2 m, conveys the length is twice that of the base unit of length, the meter. The abbreviations are permitted when expressing measurements. The metric system allows for easy conversion between units as everything is base 10. This means you will either multiply or divide by ten as you convert from one unit to another. For example, one decameter is 10 times larger than a meter. Therefore, you need 10 meters to equal a decameter. A kilometer is 1000 times larger than a meter. Therefore, you need 1000 m to equal one kilometer. Base Units of Measure • Length: meter (m) • Mass: gram (g) • Volume: liter (L) • Time: seconds (s) • Temperature: Celsius (C) Metric Prefixes Prefix Unit Multiplier Scientific Notation Kilo- k 1,000 $10^3$ Hecto- h 100 $10^2$ Deca- da 10 $10^1$ One base (m, L, g) 1 10 Deci- d 0.1 = $1/10$ $10^{-1}$ Centi- c 0.01 = $1/100$ $10^{-2}$ Milli- m 0.001 = $1/1,000$ $10^{-3}$ Micro- µ 0.000001 = $1/1,000,000$ $10^{-6}$ Converting Metric Units Memorize the table above and know how to use metric prefixes. You can use the helpful mnemonic below. Mnemonic for remembering metric conversions Mnemonic King Henry Does Usually Drink Chocolate Milk Prefix Kilo- Hecto- Deca- Base units Deci- Centi- Milli- Micro unit k h da m, L, g d c m µ When you are converting a smaller unit to a larger unit, you move the decimal point to the left the appropriate number of steps. Keep in mind each time you move the decimal point you are dividing by 10. When you are converting from a larger unit to a smaller, you will move the decimal point to the right. This means each time you move the decimal point you are multiplying by 10. Steps for Converting Metric Units 1. Write down the number you are converting for example (100 cm). Then right in the decimal point. It is always right after the ones place to the right of the number. 100 = 100 2. If you want to convert 100 cm to meters (m) you would now look at your chart and determine how many “steps” you have to move the decimal to the right or left. From centimeter to meter you have to take 2 steps to the left. That means you must move your decimal 2 places to the left. 100. cm = 1.00 meters Metric Conversion Practice Using the steps above, complete the following problems in your lab notebook. 1. 50 mm = X cm 2. 50 cm = X km 3. 700 mL = X L 4. 30 m = X µm 5. 3 dm = X m 6. 15 kg = X cg 7. 55 L = X mL 8. 52 mg = X µg Part 2: Measuring Using the Metric System A. Taking Linear Measurements with a Ruler Linear measurements in science are in metric units. The basic unit is the meter (m). The rulers you will be using today are centimeter (cm) rulers. There are 100 cm in a meter. If you look at the ruler, you will see 10 hatch marks between each centimeter marking. Each hatch mark represents a millimeter (mm). There are 10 millimeters in a centimeter. Materials • 5-6 washers of various sizes • Centimeter ruler Procedure 1. Obtain 5 washers from your instructor. 2. Order the washers on a piece of paper from the smallest diameter to the largest, labeling them #1-5. 3. Using a centimeter ruler, record the diameter of each washer in centimeters. See Figure 2 for and image on how to measure the diameter. 4. Record your results in Table 1. 5. Convert all your washer diameter measurements to millimeters and meters. Record in Table 1. 6. Keep your washers in order as you will be using them later. Results Draw the following table in your lab notebook including the title of the table. Table 1. Diameter Measurements of Washers with Unit Conversions Washer # Diameter of Washer (cm) Diameter of Washer (m) Diameter of Washer (mm) 1 2 3 4 5 B. Taking Mass Measurements with an Electronic Balance Weight measurements in science are also in metric units. The basic unit is the gram (g). The electronic balances you will be using today are gram balances. The model you will be using will accurately measure to 0.01 gram. There are 1000 grams in a kilogram. One of the most common units used is the milligram (mg). There are 1000 milligrams in a gram. If you need a very small amount of something, you measure it in micrograms (µg). There are $10^6$ µg in a gram. Some conversions are indicated below: • 1000 g = 1 kg • 1 g = 1000 mg • 1 g = 1,000,000 µg (106 µg) • 1 mg= 1000 µg Materials • 5 washers of various sizes that were previously measured. • Gram balance Procedure 1. Press the on button and wait for the balance to display zeros on screen. 2. If the screen doesn’t display zeros, press the “zero” or “tare” button. 3. Once the machine displays zeros (0.00 g), place your washer on the center of the platform. 4. Wait for the scale to achieve a stable reading (numbers are not fluctuating). 5. Record your mass in grams in Table 2 for each washer starting from smallest to largest. Results 1. Draw the following table in your lab manual including the title. 2. Record your results in grams (g) and then convert those masses to kg and mgs. Table 2. Weight Measurements of Washers with Unit Conversions Washer # Diameter of Washer (cm) Diameter of Washer (m) Diameter of Washer (mm) 1 2 3 4 5 C. Volumetric Measurements The metric unit for volume is the LITER (L). There are 1000 milliliters (mL) in one liter. Another common unit in volume is the microliter (µL). There are 106 µL in one liter and 1000 µL in one milliliter. Some common conversions are shown below: • 1 L = 1000 mL • 1 L = 1,000,000 µL (106 µL) • 1 ml= 1000 µL You will need to become familiar with the different types of instrumentation and glassware that you will be using throughout this semester. Today, we will focus on glassware and devices that measure larger volumes of liquid. You will also determine when a particular device is appropriate to use based on the volume that you are dispensing. The types of measuring devices are very different if you want to measure and dispense a liter vs. a milliliter! Graduated Cylinder You will use this to dispense large volumes that are more than 10 mL. You will be using various size graduated cylinders, ranging from 20mL – 2000 mL (2L), in this class. Serological Pipet These pipettes accurately dispense volumes of 1mL to 10mL and can be used for volumes up to 50 mL. You will be using mostly 5mL and 10mL serological pipettes in this class. Materials • 1 - 50 ml beaker • Squirt bottle with diH20 • 1 - 50 ml graduated cylinder • 1 - gram scale • 1 - 5 ml serological pipette • 1 pipette pump or electronic pipet aide Procedure Graduated Cylinder Measurements 1. Draw a table 3 in your lab manual as shown on the following page. 2. Obtain a 50 mL beaker. Weigh and record the weight in grams on Table 3 under “Weight of container”. This is the container you will use to weigh your water. It is not what you will use to measure in this experiment. 3. The target amount of water you will be measuring using a graduated cylinder is 42 mL. This has been recorded in Table 3. 4. Using a squirt bottle, squirt 42 mL of water into a graduated cylinder. Be sure to read from the bottom of the meniscus. 5. Pour the 42 mL from the graduated cylinder into the weighed beaker. 6. Weigh the beaker with the water and record on Table 3 under “weight of container and water.” 7. Determine the weight of the water and record as “weight of water only”. 8. Convert this weight to mL. Water has a density of 1g/mL. Because water has a density of 1g/mL, then the number g=mLs (50ml=50g) Record this number as “actual volume dispensed”. 9. Determine the % error for each of your measurements as follows: &#x2216;[" id="MathJax-Element-5-Frame" role="presentation" style="position:relative;" tabindex="0">

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.02%3A_Metrics_and_Measurements.txt

Learning Objectives Goals: • Use various instruments found in the biotechnology lab. • Measure volume with precision and accuracy. • Pipet with precision and accuracy. • Learn how to use a micropipette to measure very small volumes. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Make accurate and precise measurements with micropipettes and serological pipettes. • Calculate percent error for a given measurement. • Read, set, and operate a micropipette. • Determine which pipette should be used to measure a specific volume. • Determine how accurately you can measure with each micropipette. Introduction to Micropipetting: The ability to measure very small amounts, microliters (µl), of liquid chemicals or reagents is a fundamental skill needed in the biotechnology or research lab. Scientists use a device called a micropipette to measure these very small volumes with accuracy. This activity introduces the technique of micropipetting. Remember, as with all fine motor skills, this new skill will require practice and determination. Be sure to operate the micropipette slowly and carefully. Part I: Choosing and Setting the Micropipette There are several sizes of micropipettes used in the biotechnology lab. Today, you will be using the P-1000, P-200, and P-20. The P-1000 measures volumes between 100-1000 µl, the P-200 measures volumes between 20-200 µl, and the P-20 measures volumes in the 2-20 µl range. It is important to always pick the correct micropipette for the volume to be measured. Looking at Figure 3.1, you can see that each micropipette has a similar but different display window. For the P1000, the red number indicates the thousands place, followed by the hundreds, tens, and the ones displayed as small vertical lines. Each line represents 2 µl. The P-200 is reads differently. The display from the top down reads, hundreds, tens, ones, and the vertical lines are considered 0.2 µl. Finally, the P-20 can be read from the top down tens, ones, and the red tenths. A. Choosing your Micropipette For each amount listed below, indicate the correct micropipette needed to measure the volume accurately then set the pipette to the indicated amount and show your partner. Table 1. Pipette Size Choice Amount Pipette Needed Partner Observation 1. 567 µl: 2. 160 µl: 3. 700 µl: 4. 25 µl: 5. 15 µl: B. Setting your Micropipette Materials • P-20 micropipette • P-20 tips • Waste container • Tube of red dye in tube rack • Laminated sheet for pipetting Procedure 1. Each student will load 5, 10, 15, and 20 µl of red dye onto the laminated sheet. 2. Locate the p-20 and set the dial to 5 µl. 3. Hold the micropipette in your dominant hand, and gently but securely place the end of the micropipette into the proper size tip. Once the tip is on, be careful not to touch the tip on anything! If your tip touches the bench, lab coat etc. eject the tip into the waste container and get a new clean pipet tip. 4. With your other hand, open the cap of the tube of red dye and bring the tube of red dye to eye level, 5. Push the micropipette plunger down to the first stop and hold your thumb in this position. 6. Place the pipet tip into the red dye solution. 7. Gently release your thumb from the plunger to draw fluid into the tip. 8. Confirm that the tip has liquid and that no bubbles are present within the tip. 9. Close the tube of red dye and place back in tube rack. 10. Gently touch the tip to the center of the circle labeled 5 µL and slowly push all the way down (to second stop) on the plunger to dispense the liquid. 11. Repeat this process for the remaining volumes. 12. Be sure to watch your groupmates to provide feedback and help with their technique. Results Take a picture or draw a picture of your spots and include this in your lab notebook as Figure 1. Make sure the figure has a title. Conclusion 1. Observe if your spots were similar in size to your groupmates. 2. Which volume had the most variability? 3. What could have contributed to your spot being too large or small? Part II: Pipetting Practice A. Microplate Art Materials • p20 pipette (1) • p200 micropipette (1) • P-20/P-200 tips • Microplate art set (design cards, colored dyes, and 96-well microplate) (1) • Analytical or electronic balance Procedure 1. Obtain a 96-well microplate, a design card, and tubes of colored dyes. 2. Write the Microplate Art Design number in your lab notebook. 3. Using the gram balance, obtain the weight of your 96 well microplate and record in your notebook. 4. Using the p200 micropipette with tip, dispense 50 µl of dye into the wells written on the design card. 5. Once you have finished pipetting, weigh your completed microplate, and record in your lab notebook. Results 1. Be sure to record your weight in grams of your microplate pre/post pipetting in your lab notebook. 2. Using these values, calculate your percent error of the microplate you just created. Include the calculation in your lab notebook. 3. Take a picture of your microplate design and include this in your lab notebook. CONCLUSION 1. Was your percent error below +/- 5%? If your percent error was above this range, elaborate on the potential causes. 2. Did your pattern look correct? How could you avoid errors in the future? B. Micropipette Practice Matrix Materials • p20 pipette (1) • p200 micropipette (1) • 1.5ml microfuge tubes (3) • Permanent marker • Analytical or electronic balance Procedure 1. Label three microfuge tubes: 1, 2, 3, 2. Weigh each tube before placing any liquid inside. 3. Draw table 2 in your lab notebook and use it to record your data. Results Table 2. Calculating Accuracy for Micropipetting Tube # Weight of tube (g) Weight of tube + dye (g) Theoretical weight of dye Actual weight of dye % Error 1 2 3 1. Deliver the volumes indicated in Table 3 into each of the 3 labeled tubes. Table 3. Volumes to be Pipetted into each Tube Tube # Micropipette Red Dye (µl) Blue Dye (µl) Green Dye (µl) 1 P1000 210 435 332 2 P200 110 153 67 3 P20 15 17 10 1. Weigh each tube after pipetting. 2. Determine the theoretical weight of the dye using the information about the weight of a mL of the dye solution at room temperature provided by your instructor. 3. Determine the % error for each tube. Conclusion Based on your data comment on the following in your lab notebook: 1. Which micropipette gave the most precise measurement? 2. Which micropipette gave the most accurate measurement? 3. What may have contributed to higher percent errors? Study Questions 1. Convert the following: • 345 mL = __________________ µl • 0.54 mL = _________________ µl • 5.2 L = ________________ mL 2. Which micropipette would you choose to measure 550µl? 17µl? 167µl? 3. Make 3 suggestions that other biotechnologists can use to improve micropipetting accuracy. 4. Assuming that the density of water is 1 gram per milliliter, how much should 550 µL of water weigh? • 17 µL of water? • 167 µL of water? 5. What is the formula to calculate percent error? 6. What is the maximum volume you can set for each micropipette (P-1000, P-200, P-20)?

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.03%3A_Micropipetting.txt

Learning Objectives Goals: • Utilize the steps in the scientific method to design, collect and interpret scientific data. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Formulate a hypothesis based on an observation. • Design their own experimental method including proper controls. • Collect results and describe colony growth (morphology) present. • Determine if data collected supports their hypothesis INTRODUCTION Microbes are all around us. In this lab, you will be introduced to this as well as to the scientific method. Throughout the semester, you will learn how to aseptically work with bacteria; meaning learning how to culture bacteria without contaminating yourself and keeping a pure sample of bacteria free from other unwanted bacteria. During this lab exercise, you are going to swab an area of your choice to see what bacteria and/or fungi are present there. You will also test the effect of some disinfectants on the bacterium Escherichia coli (E. coli) Using the scientific method, you will design an experiment, collect data, and interpret your results. The scientific method is a generalized tool used to aid in asking and answering a scientific question by making observations and performing experiments. There are steps that are generally followed when conducting and designing an experiment. First, an initial observation is made. An observation can involve noting any event (a pattern, an action, a behavior, or a reaction). After making an observation, a question can be asked about the event. Once a question is asked, then research regarding what is already known relating to this question (finding background material) can be discovered to better understand the observation. This background information typically comes from publications in scientific literature, such as journal articles and reviews. Once the background information is understood, a hypothesis can be formed. This gathering of information and its application to a solution is an example of inductive reasoning. The hypothesis is then either supported or rejected depending on the analysis of the results of well-designed experiments. Each experiment needs dependent and independent variables. The value of the dependent variable is determined and is a function of the independent variable. In an ideal experimental setup, the independent variable is something over which we have some control and changes in some predetermined way, while changes in the dependent variable are observed and measured. A hypothesis must include both of these variables. A hypothesis can be generated by creating an “if-then” statement. For example, “If I treat cancer cells with drug x then they will die. “ Part I: Disk Diffusion Method to Evaluate Disinfectants For this portion of the lab, you will be provided the protocol/instructions but you will choose the substances to test. You will develop and test your hypothesis. Materials • 1 culture of E. coli • sterile swabs (1 swab needed per plate) • sterile absorbent paper disks • sterile water (negative control) • 10% bleach (positive control) • 30% hydrogen peroxide (positive control) • 4 test disinfectant solutions • 1 petri plate (containing sterile nutrient agar) Method 1. Plan your experiment. In addition to the controls, which solutions would you like to test? 2. Answer parts A, B, and C below to help with your planning. 3. Dip the sterile swab into the E. coli solution then spread it over the entire surface of the NA plate by rubbing the swab over the entire surface. You want to coat the entire surface with the bacteria so do not leave spaces that have not been in contact with the swab. Be careful to only open the lid of the plate enough to work (like a clamshell). If you open the lid all the way, you risk contaminating the surface with unwanted bacteria/fungi from the environment. 4. Dispose of the swab in the appropriate waste container. 5. Using sterile forceps (tweezers) dedicated to the solution to be tested, dip sterile disks one at a time into the following solutions and place them onto the agar surface that has been inoculated with E. coli. Be sure not to allow the tweezers themselves to come in contact with the agar because that will cause them to become contaminated with bacteria. 6. Include all answers to your questions in your lab notebook along with your procedure for testing the disinfectants. Observation • Based on your experience and observations, which solutions do you think will inhibit the growth (or kill) E. coli the most? Which solutions are you interested in testing? Hypothesis • Based on your observations, write the hypothesis you wish to test. Experimental Design Work with your group to write a protocol for your experiment based on the questions below. Start with the instructions and insert the necessary details such that a person with no knowledge of your project would be able to read your protocol and fully understand what to do. 1. Based on your hypothesis, which solutions will have the largest zone of inhibition around the disks? 2. What will you include as your experimental controls? (Which solutions WILL or will NOT inhibit the bacteria)? 3. How will you set up your experiment? (I recommend writing a map on your plate on the agar side where you will place the disks and then making a key to the map in your lab notebook). Example Protocol 1. On the bottom of your NA agar plate (the side with the agar, NOT the lid!!), label the plate using a permanent marker with your initials, “Biotech Lab”, the date, E. coli test, and where you are placing each disk. 2. Take the sterile swab and dip it in the E. coli culture. (Don’t place the lid for the E. coli on the desk or it will now be contaminated!) Place the labeled plate on the desk in front of you with the lid side of the plate up. With one hand, open the lid (only open it a little bit so that you can have access to the agar; think of a clam shell) and use the swab to spread the bacteria all over the plate. Make sure to move the swab around to cover the entire plate. 3. Cover the plate with the lid and discard the swab in the appropriate waste container 4. Using dedicated forceps, dip a sterile paper disk into a solution to be tested and then place the disk onto the E.coli-inoculated surface. Open the plate like a clamshell each time you place a disk then close the lid immediately when finished. 5. Place plate in a 37⁰C incubator, with the agar side up. (note: you can place it into the same 32⁰C incubator as the next experiment) 6. The plate will grow in the incubator for 48 hours. 7. When incubation is complete, measure the diameter of any zones of inhibition using a millimeter (mm) scale. Report data in the table below. Results 1. Remove your plates from the incubator. DO NOT OPEN THE PLATES! 2. Take a picture of your plates and include them in your lab notebook. Be sure to clearly label each portion of the plate. 3. Make the following table in your notebook and record your data. Table 1. Comparison of Zones of Inhibition for Tested Solutions Conclusion 1. Which solution did you use as a negative control? Did this control provide the expected result? 2. Based on your observations, which solution had the greatest effect on the E. coli? Which has little or no effect? Part II: Environmental Sampling For this portion of the lab, you will develop and test your hypothesis as well as design the method to test it. Materials • 1 tube of sterile water • sterile swabs (1 swab for each sample to be collected) • Luria broth (LB) or nutrient agar (NA) plates (1 plate for each sample to be collected) Method 1. Working with your group, determine your experimental design for this lab. 2. Complete parts A, B, and C below to help with your planning. 3. Include all answers to your questions in your lab notebook along with your procedure for collecting your samples. Observation • Based on your observations of the world around you what surfaces do you think are most “dirty” or “clean”? Which surfaces are you interested in testing? Hypothesis • Based on your observations write the hypothesis you wish to test in your lab notebook. Experimental Design 1. Based on your hypothesis, how many surfaces/samples will you test? 2. What will you include as your experimental control? 3. How will you perform your experiment? (I recommend dipping your sterile swab into the sterile water and then swabbing your sample). 4. How long and in which pattern will you swab your samples? (roll, zigzag, etc.) 5. How many plates will you need and how will you section them? (you can use a sharpie to label the bottom of the plate and draw sections if needed). Based on these questions: Work with your group to write a protocol for your experiment. Include enough detail that a person with no knowledge of your project would be able to read your protocol and fully understand what to do. Below is a general protocol for this lab to help you get started. Example Protocol 1. On the bottom of your NA agar plate (the side with the agar, NOT the lid!!), label the plate using a permanent marker with your initials, “Biotech Lab”, the date, and where you are choosing to swab. 2. Take the sterile swab and dip it in the sterile water (don’t place the lid for the sterile water on the desk or it will now be contaminated!). Then touch the wet swab to whatever surface you would like to test in order to pick up the bacteria. Place the labeled plate on the desk in front of you with the lid side up. With one hand, open the lid (only open it a little bit so that you can have access to the agar; think of a clam shell) and use the swab to spread the bacteria all over the plate. Make sure to move the swab around to cover the entire plate. 3. Cover the plate with the lid and discard the swab. 4. Place plate in a 32⁰C incubator, with the agar side up. (Some organisms in the environment do not grow well at 37⁰C.) 5. The plate will grow in the incubator for 48 hours. Results 1. Remove your plates from the incubator. DO NOT OPEN THE PLATES! 2. Take a picture of your plates and include them in your lab notebook. Be sure to clearly label each portion of the plate. 3. Make tables 2 and 3 in your notebook; record your data. Table 2. Comparison of Bacterial Colony Growth on Open Surfaces Number of Colonies Present Table 3 Morphology of Colony Growth on Open Surfaces Morphology of Colonies Present Use the image below to help you describe the morphology of the colonies present on your plates. Conclusion 1. Based on your experimental data, which surfaces had the most bacterial/fungal growth? 2. Which surface had the most diverse number of bacteria/fungi? 3. Based on your observations, what types of bacteria/fungus do you think were present on your plate? Study Questions 1. What are the steps of the scientific method? 2. Be able to write a hypothesis based on a given observation. 3. What is the purpose of an experimental control? 4. What is the definition of an independent variable? A dependent variable? 5. Why do we incubate plates upside down? 6. Why do we label the agar side of the plate? 7. What is the purpose of incubating the plates? 8. What is the purpose of the LB or NA in the plate? 9. Given a set of data, be able to formulate a conclusion based on the results given.

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.04%3A_The_Scientific_Method.txt

Learning Objectives Goals: • Properly use and care for a sensitive scientific instrument. • Learn the techniques required to prepare cells for viewing with a microscope. • Gain a sense of the size of cells. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Identify the parts of a microscope and their functions. • Properly carry, use, and store a microscope. • Prepare a wet mount slide. • View and focus specimens under a microscope. • Determine total magnification of a specimen. • Locate a specimen if given a slide. Introduction In Biology, the compound light microscope is a useful tool for studying small specimens that are not visible to the naked eye. The microscope uses bright light to illuminate through the specimen and provides an inverted image at high magnification and resolution. There are two lenses that magnify the image of the specimen – the objective lens on the nosepiece and the ocular lens (or eyepiece). To determine the total magnification of the specimen, you must multiply the objective lens magnification with the ocular lens magnification. Scientists and technicians often use light microscopes to study cells. Prokaryotic cells are very simple and lack a nucleus or membrane bound organelles and are small in size. On the other hand, eukaryotic cells are more complicated in that they contain a nucleus and many specialized organelles. A cell’s structure dictates its function; thus, each eukaryotic cell looks very different from the next. This is why a cardiac cell looks completely different from a neuron (brain cell). It is very important to learn how to handle and use a microscope properly. Review the following rules and tips for using and handling your microscope. General Rules • Always START and END with the low power lens when putting on OR taking away a slide. • Never turn the nose piece by the objective lens. • Do not get any portion of the microscope wet - especially the stage and objective lenses. • Use only lens paper to clean microscope lenses. Cleaning the Microscope If needed, obtain a small square of lens paper (and ONLY lens paper) and gently wipe the microscope lenses directly across, in this order: 1. the lower surface of all the objective lenses 2. the ocular lens 3. the condenser lens and the light housing Part I: Finding the Letter Materials • Microscope • Lens paper • Letter “E” slide • Stage Micrometer Slide Procedure 1. Always use one hand around the microscope arm and one hand under the microscope base. 2. Carry it in a vertical position without swinging, tipping, dropping or bumping the microscope. 3. Place the microscope gently on the lab bench with the arm toward you. Never place the microscope near the edge, and never slide it across the table. Identify the following microscope parts with a partner. Check off each part as you go. If you are unsure about a component, consult your instructor. • Eyepiece (ocular lens) • Nosepiece Ring (turret) • Objective Lenses (low, medium, high power) • Stage • Stage Controls • Iris Diaphragm Condenser Lens • Light Source • Light intensity knob (rheostat) • Coarse Focus Adjustment Knob • Fine Focus Adjustment Knob 1. Carefully plug in and position electric cord to avoid tripping or having the microscope pulled off the table. 2. Turn on the microscope and rotate the nosepiece ring (turret) to snap the 10x objective lens in place. Do not use the objective lens to rotate! 3. Turn the light control (rheostat) halfway to adjust the amount of light. 4. The total magnification you observe when looking through a microscope is the magnification of the ocular lens multiplied by the magnification of the objective lens. Fill out Table 5.1 to indicate the total magnification achieved by each lens. Table 1. Total Magnification Achieved Using Various Objectives Lenses of a Compound Light Microscope Lens Name Objective Lens Ocular Lens Total Magnification 1. On the side of the microscope are two knobs, one on top of the other. The larger of the two knobs is the coarse focus adjustment knob. Turn the knob so that the stage goes down as far as it can. 2. Clean all lenses with lens paper. Never use paper towels or kimwipes or shirt! 3. Obtain a letter “e” slide from your instructor. Draw the “e” in Table 5.2 as you view it with your eyes (not through the microscope). Table 2. The letter “e” viewed at different magnifications using a light microscope Letter “e” as seen… Drawing with the naked eye 100X total magnification 400X total magnification 1000X total magnification 1000X total magnification In what direction does the “e” move (as you look into the microscope), when you move the stage to the right? 1. Place the slide on the stage and secure it with the stage clip. 2. Use the coarse focus knob to move the stage as high as it can go. 3. Use stage adjustment knobs to center the “e” so that the light from the light source can pass through it. 4. Looking through the ocular lenses, lower the stage with the coarse focus adjustment knob until the “e” comes into view. 5. Use the fine focus adjustment knob to make the image as clear as you can. 6. At this point there are different adjustments you can make to improve the quality of the image: 7. The rheostat on the side of the microscope controls the intensity of the light. If it is too bright or dim at any time, use this knob to adjust the light. 8. The condenser will also adjust the light intensity. The condenser gathers and focuses the light to illuminate the specimen. Only use this if the rheostat failed to improve your image. Move the condenser with the condenser adjustment knob so that it touches the stage. Slowly lower it to improve lighting on your sample. Usually it should be about ½ inch below the stage. 9. The iris diaphragm adjusts the aperture of the opening and controls the amount of light that exits the condenser (or illuminates the specimen). You can open and close this aperture, for most purposes it should be fully open, but sometimes partially closing it will increase contrast in the image. 10. Draw the letter “e” as it appears through the microscope in Table 4-2. Note the change in orientation. Notice that the LEFT eyepiece can be rotated, but the ocular scale (known as a reticle) stays in the middle of the ocular lens. Note that the RIGHT eyepiece can be rotated, to move the position of the pointer. 11. Move the stage slowly to the right. Note what direction the “e” moves as you look through the microscope and record in Table 4-2. 12. Move the slide back to the left to re-center the “e”. 13. Once the “e” is re-centered and in focus, turn the nosepiece to the 40x objective lens and snap it into place. Use the fine focus to make the image clear. Only if needed, make light adjustments with the rheostat, condenser, or diaphragm. Draw everything you see through the microscope in Table 4-2. 14. Once the “e” is re-centered and in focus turn the nosepiece to the 40x objective lens and snap it into place. Use the fine focus to make the image clear (NEVER use the coarse focus at this or any higher magnification or you risk snapping the slide or worse, snapping the lens!!!) Only if needed, make any light adjustments with the rheostat, condenser, or diaphragm. Draw everything you see in the microscope in Table 4-2. Answer the questions below. 15. To use the oil immersion lens, rotate the nosepiece BETWEEN the 40x and the 100x lenses so that the wand containing the oil can reach the slide. Place a generous drop of oil on the slide and snap the 100x objective lens into place. The lens will slide into the drop of oil. 16. Use the fine focus to make the image clear. Only if needed, make light adjustments with the rheostat, condenser, or diaphragm. Draw what you see in Table 4-2. 17. NEVER return to the 40X objective lens after there is oil on the slide. If you are having trouble focusing using the oil immersion lens, you must go back and use the 10x lens to re-center (turn the nosepiece so that the 40x objective lens is NOT dragged through the oil on the slide). Then go directly back to the 100x lens. If this doesn’t work, the slide must be wiped clean and you should start over. When finished with the slide, lower the stage and remove the slide. (Do not lower the stage if you are going to view a different slide). Clean the oil off the slide and return it to your instructor. Part II: Diameter of the Field Microscopes are for magnification of images too small to be seen with the naked eye. However, they can be used as a tool to estimate the size of the object being viewed. In order to do this, you must know the diameter of each viewing field with each objective lens. You can then estimate how much of the field your object takes in the field and compare this to the measured diameter. For example, let’s say the diameter of field using the 40x objective lens is 0.10 mm. You then view an object using that lens that takes up ¼ of the field of view. You can then estimate that object is ¼ (0.10mm) long or 0.025mm. To determine the field diameter, you will use a stage micrometer slide, which is basically a very fine ruler (usually 2 mm) that is etched onto a microscope slide. Procedure 1. Obtain a stage micrometer slide. BE VERY CAREFUL. A stage micrometer slide is costly, so please treat it with respect! Place the stage micrometer slide on the stage and focus on the millimeter markings using the 10x objective lens. Record the field diameter in mm when you use this lens in Table 3. 2. Switch to the 40x objective lens and focus. Determine the field diameter in mm with the micrometer and record in table 3. Repeat the same steps for the other objective lenses. 3. Convert the diameters to micrometers (μM). All cell and organelle measurements will be done in μM. Clean the slide carefully and place it back in its tray on the demo table. Table 3. Determining the Field of View Using a Stage Micrometer Lens Used Total Magnification Diameter of Field (mm) Diameter of Field in (µm) Part III: Making Wet Mounts Procedure Human Cheek Cells The human cheek is lined with epithelial cells. They will be used today for you to observe a eukaryotic animal cells and its nucleus. You will scrape and stain a sample of your cheek cells with the dye methylene blue. The dye will allow you to clearly stain the nuclei of the cells. Be careful with the dyes used for the wet mounts as they will stain your skin and clothes. Also, the slides and coverslips you will use are stored in alcohol. Make sure to dry off the slides and coverslips with paper towels (not the expensive lens paper) before preparing your wet mount slides. 1. Get a dry microscope slide and cover slip. 2. Put a drop of methylene blue on the slide. 3. Gently scrape the inside of your cheek with a toothpick and swirl it in the dye on the slide. 4. Place a cover slip on the suspension and view at 1000X total magnification 5. Draw 1-3 cells large enough to show the detail that you see in your lab manual. Label its cell membrane, cytoplasm and nucleus. Be sure to indicate the magnification used and specimen name. Also indicate the estimated cell size in micrometers under your drawing. See the example (which is missing the labels). Elodea Leaf Wet Mount The cell membrane is not visible on the Elodea leaf because of its proximity to the much thicker cell wall. In order to view the membrane, you will add salt to the Elodea. Water will flow out of the Elodea cells by osmosis, shrinking the cell membrane away from the stiff cell wall (plasmolysis). 1. Get a microscope slide. Place 2 drops of dI water on the left and 2 drops 20% salt on the right. 2. Obtain a leaf from a stalk of Elodea and cut the leaf in half. Place a half leaf in each solution. 3. Wait 3-5 minutes and then place a cover slip over each leaf (dab off excess water). 4. View at between 400X total magnification. 5. Look for cells that have undergone plasmolysis. If none are found, prepare the slide again. 6. Draw 2-3 connected cells large enough to show the detail that you see. Label the cell wall, cell membrane, cytoplasm, and chloroplasts in your lab manual. Be sure to indicate the magnification used and specimen name. Also indicate the estimated cell size in micrometers under your drawing. Onion Membrane Wet Mount Onion bulbs are actually swollen leaves that form an underground structure. Although not a good source for viewing chloroplasts, they are an excellent source for viewing eukaryotic plant nuclei. 1. Get a dry microscope slide and cover slip. 2. Cut a tiny square of one layer of the onion. Use forceps to peel the thin, white, transparent membrane from the inner concave side of an onion section (you only need a small piece, about the size of a pencil eraser) and place on slide. Try to smooth out the transparent onion membrane as flat as possible. 3. Add a drop of iodine to the membrane and wait 30 seconds. Cover the membrane with a coverslip. Place the slide inside folded paper towel and pat gently for 1 second to remove excess dye. 4. View at either 100X or 400X total magnification, so that you can see 2-3 cells. 5. Draw 2-3 connected cells large enough to show the detail you see. Label the cell wall, nucleus, and cytoplasm. Be sure to indicate the magnification used and specimen name. Also indicate the estimated cell size in micrometers under your drawing. Pond Water Wet Mount You will prepare a wet mount of one of the following protists that can be found in pond water: Euglena, Spirogyra, Paramecium, and/or Amoeba. 1. Get a depression slide and dry it off. The depression slide has a curved indent in the middle of the slide, which allows the living creatures to move around and not get squished. 2. Put a drop of methyl cellulose and a drop from the pond water or cultures. 3. Carefully put on a coverslip. If you have too much liquid on the slide, then gently use a corner of a paper towel to absorb the excess liquid. 4. View at 100X or 400X total magnification. 1. Draw the organisms that you see. Be sure to indicate the magnification used and specimen name. Also indicate the estimated cell size in micrometers under your drawing. Prepared Slides You will look at various prepared slides including Paramecium, Spirogyra, Human Blood Smears, Human Sickle Cell Red Blood Smears, Frog Blood Smears, and possibly others. View under the microscope using the highest magnification for the best cellular details and draw what you see. Be sure to indicate the magnification used and specimen name. Also, indicate the estimated cell size in micrometers under your drawing. Part IV: Lab Check-out Check off each task when complete. The instructor must sign before storing your microscope. Returning Compound Microscope • Rotate low power objective lens in position • Use coarse focus to raise nosepiece to the top • Remove slide from stage • Be sure that the bar from stage clips does not stick out • Turn rheostat to lowest before turning off the light • Unplug and wrap power cord according to instructor’s instructions • Carry microscope properly to cabinet and return to the correct shelf Cleaning Wet Mounts • Rinse slide in a beaker of water, remove and return cover slip and slide into the correct jars • Put prepared slides back onto the correct tray on the demo table • Tighten all reagent bottle caps. • Clean up the demo table • Wipe off all tables with wet sponge Instructor Signature Study Questions 1. On the next page, label the parts of the microscope and list their function. 2. How is a microscope properly carried? 3. How is the microscope properly put away? 4. What is the magnification power of: • High-power objective lens? • Medium-power objective lens? • Low-power objective lens? • Ocular lens? 5. How is the total magnification of a specimen determined? 6. When the magnification increases, how does the size of the field of view change? 7. Why is it important to place the medium on a slide before selecting the specimen to be mounted? 8. Name one way to be sure the specimen will be found in the field of view when you change magnification. 9. What are the distinguishing characteristics of a plant cell versus an animal cell? 10. Knowing the size of the field of view using one of the three magnification lenses, be able to determine the size of a specimen being observed.

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.05%3A_Microscopy.txt

Learning Objectives Goals: • Identify the main features on the spectrophotometer and define their functions. • Use a spectrophotometer to obtain an absorbance spectrum. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Identify the parts of a spectrophotometer and their related functions. • “Blank” a spectrophotometer. • Obtain an absorbance spectrum for a molecule. • Use the wavelength absorption scans to determine the dyes in colored skittles. Introduction Spectrophotometers are one of the most frequently used tools by scientists to determine both the presence and concentration of dissolved chemicals. As radiant energy (visible light) strikes matter, molecules will absorb certain wavelengths of light and transmit or reflect others based on the nature of their chemical bonds. For example, proteins and nucleic acids absorb wavelengths in the visible light range of 240-300 nanometers (nm), pigments and dyes absorb light in the 400-770-nm range, and other organic molecules absorb wavelengths above 770-nm. Each chemical has a distinctive atomic arrangement and bonding pattern, and thus absorbs or transmits different wavelengths of visible light in a pattern that is unique for that chemical. This unique pattern of light absorption and transmittance creates a “fingerprint” for that chemical. In this exercise you will determine the unique “fingerprint” for a colored molecule and use a spectrophotometer to measure the concentration of a chemical in a given sample. Spectrophotometers are instruments designed to detect the amount of light energy that is absorbed or transmitted by molecules dissolved in a solution. Since molecules have wavelengths unique to their structure, different chemicals and their concentrations can be identified based on their absorbance or transmittance. A spectrophotometer is an instrument used for detecting the presence of any light-absorbing particles dissolved in a solution and for measuring the concentration of those particles. A light source inside the spectrophotometer emits a full spectrum of white light towards a compartment where a sample liquid is placed. The samples are prepared in cuvettes that are made using specialized plastics or quartz so that they do not absorb any light and will not affect our measurements. Before the light passes through the sample in the cuvette, an adjustable prism and diffraction grating filters the light so that only a single wavelength of light can be selected and allowed to pass through the sample. All molecules differ in how strongly they absorb each wavelength of light in the visible spectrum because of differences in their molecular structure and composition. This allows us to use a specific wavelength of light to detect the presence of, and quantify, one molecular compound in a simple or complex liquid mixture. Spectrophotometers are also calibrated by using a “blank” solution that we prepare containing all of the components of the solution to be analyzed except for the one compound we are testing for so that the instrument can zero out these background readings and only report values for the compound of interest. Light passing through a sample solution will partially be absorbed by molecules present in the sample. The amount of light unable to pass through a sample is measured as the absorbance value. Absorbance is directly proportional to the concentration of the molecules and is measured on a logarithmic scale from 0 to infinity. The amount of light that is not absorbed is transmitted or passed through the sample. Compared to the amount of light entering the sample, the amount that exits is measured as a percentage of the light transmitted. Percent transmittance is inversely proportional to the concentration of the molecules in the sample and is measured on a linear scale from 0% to 100%. A photodetector on the other side of the sample compartment converts the intensity of the light it receives into an electrical signal. The instrument can then calculate and display the absorbance and % transmittance values by measuring the difference between the intensity of light of the selected wavelength entering and exiting the sample. The absorbance scale reflects the measurement of the amount of light absorbed and converted into absorbance ($A$) units by the spectrophotometer. Absorbance units are calculated by using the following equation: Equation 1 $\text{Absorbance} (A) = \log_{10} \left(\dfrac{1}{T}\right) \nonumber$ where “$T$” is the decimal form of “$\%T$” $T = \dfrac{\%T}{100} \nonumber$ Example If a solution containing a given dye is found to transmit 10% of the light when placed in a spectrophotometer, its absorbance then would be calculated as follows: Transmittance (T) = 10% = 10%/100 = 0.10 Absorbance (A) = log10 (1 / 0.10) = 1.0 Part I: Identifying Food Dyes in Candies Many foods, drugs and cosmetics are artificially colored with federally approved food dyes (FD & C dyes). These dyes include Red 40, Red 3, Yellow 5, Yellow 6, Blue 1, and Blue 2. Since each dye has an identifiable absorption spectrum and peak, a spectrophotometer may be used to identify the types of FD & C dye used in a product. Pigments may be extracted from foods and drinks that contain one or more of these dyes. An absorption spectrum of that extract can then determine what dyes are in that food or drink by comparing the peaks of maximum absorbance with information in the table below. If the absorption spectrum of a food extract has a peak at 630 nm and one at 428 nm, you can assume the food contains both Blue #1 and Yellow #5. The following table gives the wavelength of peak absorbance for each of these dyes. Table 1. Wavelength of Maximum Absorbance of Commonly Used FD & C Dyes FD & C Dye Name Wavelength (nm) of Maximum Absorbance Blue #1 Brilliant Blue FCF 630 Green #3 Solid Green FCF 625 Blue #2 Indigo Carmine 610 Red #3 Erythrosine 527 Red #40 Allura Red AC 502 Yellow #6 Sunset Yellow FCF 484 Yellow #5 Tartrazine 428 Materials • Spectrophotometer • Cuvette • Skittles • KimWipes • Test tubes Procedure A. Extracting Dye from Candy (Your Instructor will do this for you) You will need one test tube and one cuvette for each color to be tested. Measure 4 mL water into one tube. Place 2-4 candies of the same color in a test tube with the water. Gently swirl, and wait one minute. After, pour approximately 1 mL of liquid into a microcentrifuge tube. Spin the microcentrifuge tube at max speed for 60 seconds. Make sure the centrifuge is balanced before spinning. Transfer the clear liquid (supernatant) into a cuvette. Make sure to leave behind the particulates (pellet). B. Measuring Absorbance with Spectrophotometer 1. Turn on the spectrophotometer. Let it warm up for 15 minutes. 2. Select wavelength scan. 3. Fill a cuvette 2/3 full with DI water to serve as the “BLANK” cuvette. 4. Calibrate the Spectrometer 1. Wipe the outside of the BLANK cuvette with a KimWipe 2. Place cuvette into the machine so that the clear portions of the cuvette are oriented left to right. (The light needs to pass through clear area on cuvette). 3. Press "Zero" 4. Remove the blank. 1. Determine optimum wavelength absorbance and set up data collection mode. 1. Place a cuvette with a sample into the spectrophotometer 2. Press "read" 3. Set cursor mode to peak and valley under "Options" > "More" > "Cursor Mode" 4. Press the left and right arrows to the right of the graph to select the highest peak. 5. Record the wavelength and absorbance in Table 6.2. 1. Decide which dyes were used to make each color. Enter the Wavelength of that dye in the last column of table 6.2. Explain your reasoning for each choice in your lab notebook. Results Table 2. Color skittle Maximum Absorbance Wavelength (nm) at Maximum Absorption Proposed Dye Wavelength (nm) of Maximum Absorption for Proposed Dye Red Orange Yellow Green Purple Instructions for Cleaning Cuvettes 1. Discard solutions to sink 2. Rinse with tap water once 3. Rinse with DI water two times 4. Place in tube rack, allow to air dry Study Questions 1. Name the parts of the spectrophotometer and identify their function. 2. What is the difference between % transmittance and absorbance? 3. How did you determine which wavelength was absorbed at the highest level? How is this process useful in determining the identity of a molecule? 4. How do you clean a cuvette?

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.06%3A_Spectrophotometry.txt

Learning Objectives Goals: • Accurately measure the pH of solutions using pH indicator strips and a pH meter. • Create buffer solutions and test the effects of adding acid and base to each. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Describe the pH scale. • Correctly use pH indicator strips and a pH meter. • Explain the function and composition of a buffer. Introduction The pH of solutions is an important characteristic. Cells must maintain a constant pH so that the enzymes and processes taking place inside the cells will continue as needed. Chemical and enzymatic reactions are typically dependent on a specific pH range. Thus, it is important to understand pH and be able to determine the pH of various solutions. The pH scale is a familiar concept for students who study science. The pH value of a solution reflects the relative concentration of hydrogen ions (H+) or protons to the concentration of hydroxide ions (OH-) in a solution. Solutions with a pH value less than 7 are acidic and those with a value greater than 7 are basic, or alkaline. The value 7 is neutral meaning the amount of H+ in a solution is equal to the amount of OH- in a solution. Pure water H2O, which can dissociate naturally into H+ and OH- ions, would have a value of 7. Equation 1 $\ce{H2O <=> H^{+} + OH^{-}} \nonumber$ Table 1. The pH Scale [H+] in mol/L pH [OH-] in mol/L pH Classification 1.0 0 10-14 Acidic 0.1 1 10-13 Acidic 0.01 2 10-12 Acidic 0.001 3 10-11 Acidic 10-4 4 10-10 Acidic 10-5 5 10-9 Acidic 10-6 6 10-8 Acidic 10-7 7 10-7 Neutral 10-8 8 10-6 Basic 10-9 9 10-5 Basic 10-10 10 10-4 Basic 10-11 11 0.001 Basic 10-12 12 0.01 Basic 10-13 13 0.1 Basic 10-14 14 1.0 Basic Pre-lab Reading Assignment: Chemistry Review In a chemical equation, variables that are surrounded by brackets “[“ and “]” are expressions of concentration, or the specific amount of a molecule in a given volume of solution. For example, if you see “[H+]” in an equation, this is read as “the concentration of hydrogen ion”. The concentration of a solution is often expressed in units of moles per liter (mol/L). Just as one “dozen” represents a quantity of 12 items, one “mole” represents a quantity of approximately 6.022 X 1023 items. one dozen molecules = 12 molecules one mole of molecules = 602,200,000,000,000,000,000,000 molecules! Note: “n” is used in equations to indicate a quantity measured in moles. For example if you see “nAcid” in an equation, this is read as “moles of acid”. The term “Molarity” indicates that a solution’s concentration is in units of moles per liter. A one molar solution (1 M) contains one mole of solute within each liter of that solution. Reagents used in the laboratory will often be labeled with their concentrations expressed in terms of molarity. The relative concentration of H+ or OH- may change very dramatically in solutions, so a logarithmic scale (called pH) instead of a linear scale is used to express concentration. Equations 2 and 3 can be used to calculate the pH based on hydrogen ion concentration or vice versa. Equation 2 To calculate pH based on hydrogen ion concentration [H+]: pH = -log [H+] Equation 3 To calculate hydrogen ion concentration [H+] based on pH: [H+] = 10-pH Buffers A buffer is a mixture of a weak acid (HA) and its salt (e.g., NaA), and is sometimes referred to as a conjugate acid-base pair. As mentioned above, buffers have a major role in stabilizing the pH of living systems. Vertebrate organisms maintain the pH of blood using a buffer composed of a mixture of carbonic acid (H2CO3) and sodium bicarbonate (Na+HCO3-). The weak acid in this buffer is carbonic acid and the salt is sodium bicarbonate. When dissolved in water, sodium bicarbonate disassociates completely into sodium ions (Na+) and bicarbonate ions (HCO3-). The H2CO3 is the conjugate acid of HCO3- and the HCO3- is the conjugate base of H2CO3 . Together, this conjugate acid-base pair functions as the bicarbonate buffer system. Buffer systems are also of particular importance to experimental cell biology. The pH of a buffer solution may be calculated as follows: Equation 4 The pH of a buffer solution may be calculated as follows: $pH=pK_a + log \frac{n_A}{n_{HA}}\nonumber$ Where pKa = dissociation constant of the acid, nA = initial number of moles of salt in the buffer, and nHA = initial number of moles of acid in the buffer. If you know these values, it is possible to accurately calculate the pH of a buffer system before you create it! The pKa of acetic acid (used in today’s experiment) is 4.75 Equation 5 To find the volume of the conjugate base or conjugate acid: nA = volume of conjugate base (mL) $\times \dfrac{1\: L}{100\: mL} \times$ concentration of conjugate base (mol/L) nHA = volume of conjugate acid (mL) $\times \dfrac{1\: L}{100\: mL} \times$ concentration of conjugate acid (mol/L) Use of pH Indicator Strips The pH of a solution can be roughly approximated using strips of paper treated with color changing indicator reagents. The strips are dipped into the solution to be tested for several seconds and then removed. The color of the indicator strip is then compared to a reference chart, often printed on the side of the strip’s container. The reference color on the chart that most closely matches the color of the reacted strip will have a pH value printed below it and that will be the approximate pH. One advantage to using pH indicator strips is that they are relatively inexpensive, easy to use, and are adequate for determining pH where an error of +/- 1 pH unit is acceptable. A more accurate method of determining pH is to use a calibrated pH meter, which can determine the exact pH to one or more decimal places depending on the quality of the device. Use of a pH Meter The pH meter measures the acidity of a solution. It is a scientific instrument that uses electrodes to measure the hydrogen ion (proton) concentration of water-based solutions. Essentially, the pH meter is a voltmeter that will measure the difference between two electrodes. The probe you place into the solution contains a reference electrode and a detector electrode. The reference electrode is not affected by the solution being measured and is in contact with a solution of potassium chloride. The detector electrode comes in contact with the test solution. The hydrogen ions in the test solution interact with the electrode and the difference in electrical potential between the two electrodes is detected and reported as millivolts or converted to a pH value. For accurate measurements, it is important to calibrate your pH meter before use with buffer solutions of known values. It is best to calibrate your meter with buffer solutions that are near the anticipated or desired pH of your test solution. You should also blot the probe with laboratory wipes in between solutions to avoid contamination but avoid rubbing. Rubbing the probe may cause a static electricity charge to build up on the electrode which will cause inaccurate readings to occur. Accidentally letting the probe dry out will also cause it to stop working so always keep the end of the probe immersed in a holding solution when not taking measurements. Remember to return it to the storage solution as soon you are finished with the experiment. Calibrate the pH meter for pH 4, 7, and 10 before taking measurements. If calibrated properly, your pH meter should produce measurements with an accuracy of +/- 0.06 pH units. Always test your meter after calibration using the standard buffers and recalibrate the meter if necessary before proceeding. Your instructor will demonstrate the proper calibration, care, and use of the meter. Be sure to take good notes! Activity 1: Measuring pH Materials Per group of 4: • 1 Set of 4 unknown solutions (in 30 mL tubes with screw top lids) • 1 container of pH indicator strips and color reference chart • 1 pair of forceps • 1 pH meter (calibrated – See instructor for directions) Procedure 1. Obtain a set of unknown solutions from instructor. 2. Measure the pH of each solution using the pH indicator strips first. Hold the strips with the forceps. Use a new strip for each solution! 3. Record your data in Table 1. 4. Measure the pH of each solution using the pH meter. Be sure to rinse the tip of the probe with DI water before putting the probe into each sample! (Ask the instructor for instructions if you are not sure how to properly calibrate and use the pH meter). 5. Record your data in Table 2. Table 2. Measured pH values of Known Test Solutions Unknown Solution pH value measured using indicator strips pH value measured using pH meter Expected pH value (Ask Instructor) A B C D Data Analysis • How do your pH indicator strip values compare to your pH meter values? • Check your measured pH values with those of the other teams. Are your values similar? • Check with your instructor to see what the actual pH values should be. How accurate were you? Activity 2: Preparation of an Acetate Buffer Materials Per Class: • 1 bottle stock solution of 0.1 M acetic acid (CH3COOH) • 1 bottle stock solution of 0.1 M sodium acetate (Na+CH3COO-) Per Group of 4: • 6 clean 30 mL plastic tubes • 2 clean 5 mL serological pipettes • 2 pipette pumps (10 mL capacity) • 1 Sharpie Marker Procedure 1. Using a sharpie marker, label the two 30 mL tubes - one as “Acetic Acid” and the other “Sodium Acetate”. Fill each tube up with the correct stock solution. 2. Using a sharpie marker, label each of the two 5 ml pipettes - one as “AA” and the other as “SA”. To avoid contamination, DO NOT dip pipettes into stock solution bottles and ONLY use the designated pipette to transfer either acetic acid or sodium acetate from your group’s labeled tubes. 3. Using a sharpie marker, label a clean 30 mL tube as “Buffer 1”, another as “Buffer 2”, the third as “Buffer 3”, and the fourth as “H2O”. Each student in your group will take one tube. If there are only 3 students, one of you can also take the “H2O” tube. Write your names into the first column of table 2 next to the tube(s) you will be working with. 4. Create the acetate buffers using your marked serological pipettes and the specified volumes of acetic acid and sodium acetate in Table 2. • Be sure to accurately pipet the volumes indicated to get good results! Review proper pipetting technique with your instructor if necessary. • For the “H2O” tube, simply fill the tube about a third full with pure deionized water 5. Close the lids and gently shake each tube for about 20 seconds or more to mix the contents. 6. Measure the pH of each solution with the pH meter using proper technique and enter your measurements in table 2. Activity 3: Effects of Adding Acid and Base to Acetate Buffer Materials Per Group of 4: • Everything From Activity (2 above) • 30 mL dropper bottle of 0.1 M HCl (Hydrochloric Acid) • 30 mL dropper bottle of 0.1 M NaOH (Sodium Hydroxide) Procedure 1. Add a single drop of HCl to each of your team’s 4 tubes. Close the lids and gently shake the tubes to thoroughly mix the contents. 2. Measure the pH of each solution and enter the pH values in table 4. 3. Continue adding drops of HCl according to the table, measuring pH, and recording values. 4. When you have completed Table 3, you will now start adding drops of NaOH (base) to your tubes according to table 5. 5. Be sure to shake the tubes to mix the contents thoroughly before measuring pH and entering the values in Table 5. 6. Look at your results and compare the pH changes in your 4 tubes. What do you notice about the pH changes when you compare them? 7. Compare your pH values to those of the other teams. Ask your instructor for the expected values. Table 3. Experimental Acetate Buffers Mixing Chart Student Tube Volume of Acetic Acid (mL) Volume of Sodium Acetate (mL) Measured pH Expected pH (Ask Instructor) Buffer 1 5.0 5.0 Buffer 2 7.0 3.0 Buffer 3 3.0 7.0 H2O None None Table 4. Effect of Adding 0.1 M HCl (acid) to Acetate Buffers and Water Tube pH after 1 drop HCl added pH after 2 drops HCl added pH after 3 drops HCl added Buffer 1 Buffer 2 Buffer 3 H2O Table 4. Effect of Adding 0.1 M NaOH (base) to Acetate Buffers and Water Tube pH after 1 drop NaOH added pH after 2 drops NaOH added pH after 3 drops NaOH added Buffer 1 Buffer 2 Buffer 3 H2O Study Questions 1. What range of pH values indicates that a solution is acidic? Basic? 2. In general, how does the relative concentration of hydrogen ions [H+] compare to that of hydroxide ions [OH-] in a neutral, acidic, and basic solution? 3. Based on your observations, how would you describe what a buffer does? 4. What factors determine the accuracy of a reading with a pH meter? 5. What is the pH of a solution that has a hydrogen ion concentration of 2.46 X 10-5 M? 6. What is the expected pH of a buffer made from 25.7 mL of 2.0 M Acetic acid and 0.0492 L of 0.90-M Sodium acetate?

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.07%3A_pH_and_Buffers.txt

Learning Objectives Goals: • Prepare solutions starting with a solid. • Perform a serial dilution. • Use the spectrophotometer to measure the absorbance of solutions. • Generate a standard curve and use the standard curve to determine the concentration of a solution. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Determine the mass of solute needed to make at %(w/v) solution. • Make a buffer of the appropriate concentration. • Make a stock solution of the appropriate concentration. • Create a series of solutions of decreasing concentrations via serial dilutions. • Use the spectrophotometer to measure the absorbance of a solution. • Use excel and make a standard curve and use the R2 value to evaluate the quality of the standard curve. • Use the standard curve to calculate the concentration of a solution. Introduction A Serial dilution is a series of dilutions, with the dilution factor staying the same for each step. The concentration factor is the initial volume divided by the final solution volume. The dilution factor is the inverse of the concentration factor. For example, if you take 1 part of a sample and add 9 parts of water (solvent), then you have made a 1:10 dilution; this has a concentration of 1/10th (0.1) of the original and a dilution factor of 10. These dilutions are often used to determine the approximate concentration of an enzyme (or molecule) to be quantified in an assay. Serial dilutions allow for small aliquots to be diluted instead of wasting large quantities of materials, are cost-effective, and are easy to prepare. Equation 1. $concentration factor= \frac{volume_{initial}}{volume_{final}}\nonumber$ $dilution factor= \frac{1}{concentration factor}\nonumber$ Key considerations when making solutions: • Make sure to always research the precautions to use when working with specific chemicals. • Be sure you are using the right form of the chemical for the calculations. Some chemicals come as hydrates, meaning that those compounds contain chemically bound water. Others come as “anhydrous” which means that there is no bound water. Be sure to pay attention to which one you are using. For example, anhydrous CaCl2 has a MW of 111.0 g, while the dehydrate form, CaCl2 ● 2 H2O has a MW of 147.0 grams (110.0 g + the weight of two waters, 18.0 grams each). • Always use a graduate cylinder to measure out the amount of water for a solution, use the smallest size of graduated cylinder that will accommodate the entire solution. For example, if you need to make 50 mL of a solution, it is preferable to use a 50 mL graduate cylinder, but a 100 mL cylinder can be used if necessary. • If using a magnetic stir bar, be sure that it is clean. Do not handle the magnetic stir bar with your bare hands. You may want to wash the stir bar with dishwashing detergent, followed by a complete rinse in deionized water to ensure that the stir bar is clean. • For a 500 mL solution, start by dissolving the solids in about 400 mL deionized water (usually about 75% of the final volume) in a beaker that has a magnetic stir bar. Then transfer the solution to a 500 mL graduated cylinder and bring the volume to 500 mL • The term “bring to volume” (btv) or “quantity sufficient” (qs) means adding water to a solution you are preparing until it reaches the desired total volume • If you need to pH the solution, do so BEFORE you bring up the volume to the final volume. If the pH of the solution is lower than the desired pH, then a strong base (often NaOH) is added to raise the pH. If the pH is above the desired pH, then a strong acid (often HCl) is added to lower the pH. If your pH is very far from the desired pH, use higher molarity acids or base. Conversely, if you are close to the desired pH, use low molarity acids or bases (like 0.5M HCl). A demonstration will be shown in class for how to use and calibrate the pH meter. • Label the bottle with the solution with the following information: • Your initials • The name of the solution (include concentrations) • The date of preparation • Storage temperature (if you know) • Label hazards (if there are any) Lab Math: Making Percent Solutions Equation 2. Formula for weight percent (w/v): $\dfrac{\text{Mass of solute (g)}}{\text{Volume of solution (mL)}} \times 100 \nonumber$ Example Make 500 mL of a 5% (w/v) sucrose solution, given dry sucrose. 1. Write a fraction for the concentration $5\:\%\: ( \frac{w}{v} )\: =\: \dfrac{5\: g\: sucrose}{100\: mL\: solution} \nonumber$ 2. Set up a proportion $\dfrac{5\: g\: sucrose}{100\: mL\: solution} \:=\: \dfrac{?\: g\: sucrose}{500\: mL\: solution} \nonumber$ 3. Solve for g sucrose $\dfrac{5\: g\: sucrose}{100\: mL\: solution} \: \times \: 500 \: mL \: solution \: = \: 25 \: g \: sucrose \nonumber$ 4. Add 25-g dry NaCl into a 500 ml graduated cylinder with enough DI water to dissolve the NaCl, then transfer to a graduated cylinder and fill up to 500 mL total solution. Activity 1: Calculating the Amount of Solute and Solvent Calculate the amount (include units) of solute and solvent needed to make each solution. A. Solutions with Soluble Solute and water as the solvent 1. How many grams of dry NaCl should be used to make 100 mL of 15% (W/V) NaCl solution? 2. How many grams of dry NaCl should be used to make 300 mL of 6% (W/V) NaCl solution? 3. How many grams of dry NaCl should be used to make 2L of 12% (W/V) NaCl solution? 4. How many grams of dry NaCl should be used to make 300 mL of 25% (W/V) NaCl solution? 5. How many grams of dry NaCl should be used to make 250 mL of 14% (W/V) NaCl solution? B. Solutions with Insoluble Solutes in Cold Water 1. Calculate how to prepare 200 mL 1.2% (w/v) agarose in 1X SB buffer, given dry agarose and SB buffer. 2. Calculate how to prepare 300 mL 2.5 % (w/v) agarose in 1X SB buffer, given dry agarose and SB buffer. 3. Calculate how to prepare 50 mL 1.5 % (w/v) agarose in 1X SB buffer, given dry agarose and SB buffer. 4. Calculate how to prepare 60 mL 0.8 % (w/v) agarose in 1X SB buffer, given dry agarose and SB buffer. 5. Calculate how to prepare 150 mL 1.8 % (w/v) agarose in 1X SB buffer, given dry agarose and SB buffer. Note For dry chemicals that cannot dissolve in cold water (such as agarose and gelatin), pour the dry solute directly into an Erlenmeyer flask, measure the total volume of solvent in a graduated cylinder, then add the total volume of solvent into flask. Microwave the solution as recommended until solute is dissolved. Part I: Solution Prep of 30-mLs of 13.6% Sodium Acetate Sodium Acetate Buffer solutions are inexpensive and ideal to practice your skills. Your accuracy can be verified by taking a pH reading. MATERIALS Reagents • Sodium Acetate (Trihydrate) solid • DI H2O • Stock bottle of verified 1 Molar Acetic Acid solution Equipment • pH meter • Stir plate • Electronic balance and weigh boats • 50-mL graduated cylinder • 50-mL conical tubes (Falcon tubes) • P-1000 Micropipettes with disposable tips (or 5 mL Serological pipettes with pumps) Calculations • Calculate the amount of sodium acetate needed to make 30 mL of 13.6% sodium acetate solution. Procedure 1. Make sure to wear goggles and gloves. 2. Measure _______ g of solid sodium acetate in a weigh boat on an electronic balance. 3. Transfer the sodium acetate into a 50 mL conical tube. 4. Add about 20 mL of DI water into the conical tube. 5. Secure the cap on the tube and invert to mix the contents until the solute is completely dissolved. 6. Pour out all of the solution into a 50 mL graduated cylinder. 7. Add DI water to bring the total volume to 30.0 mL. 8. Transfer all of the solution back into your 50 mL conical tube and secure the cap. 9. Invert the tube several times to thoroughly mix the contents. 10. Label the tube with contents (13.6% Sodium Acetate), initial, and date. Verify your work by creating a buffer solution 1. Pipette exactly 5.0 mL of your sodium acetate solution into a clean 15 mL conical tube (or 25 mL glass test tube). 2. Pipette exactly 5.0 mL of 1M acetic acid solution into your conical tube (or 25 mL glass test tube). 3. Secure the cap on the conical tube (or a piece of parafilm over the test tube opening). 4. Invert several times to thoroughly mix the 10 mL of solution into an acetate buffer. 5. Measure the pH of the test buffer solution using a calibrated pH meter. 6. If you were accurate in all of your work, the test buffer should have a pH of 4.75 (+/- 0.06). 7. Check in with your instructor and report the pH of your test buffer. 8. If your test buffer pH is within the expected range, then congratulations! You have verified that the sodium acetate solution you made earlier has a concentration of 13.6%. Give your 50 mL tube of remaining sodium acetate solution to your instructor to save for use in a future lab. 9. If your test buffer pH is far outside of the expected range then something went wrong during the preparation of your sodium acetate solution and you should mark the tube with an “X” and give it your instructor to set aside. Part II: Preparation of a Standard Curve In this part of the lab, we will be preparing solutions of known concentrations. These then will be used to create a standard curve. Standard curves (also known as calibration curves) represent the relationship between two quantities. The standard curve will be used in part 3 of the lab to determine the concentrations of unknown solutions of methylene blue. Materials Reagents • Stock 1% (w/v) methylene blue solution – (500 microliter (µL) aliquots in 1.5 mL microcentrifuge tubes) • DI H2O Equipment • P-20 Micropipettes and disposable tips • P-1000 Micropipettes and disposable tips • Spectrophotometer Glassware • 10 mL serological pipettes and pumps • 1.5 mL microcentrifuge tubes • 15 mL plastic conical tubes with screw-top caps • 50 mL plastic conical tubes with screw-top caps Calculations 1. Calculate the volume of stock 1% methylene blue solution needed to make 40 mL of 0.0005 % methylene blue solution. 2. This new percentage concentration is equivalent to 5.0 micrograms per milliliter (µg/mL) and will be the concentration of our working solution for the next 2 parts of the lab exercise. Procedure Prepare Stock Solution of Methylene Blue Prepare 40 mL of 5.0 µg/mL Methylene Blue Working Solution 1. Make sure to wear goggles and gloves. 2. Very accurately pipette 40.0 mL of DI water into a 50 mL conical tube. 3. Very accurately micropipette ________ µL of 1% stock methylene blue into the DI water in your tube. 4. Secure the cap on the tube and invert repeatedly to thoroughly mix the solution. 5. Label your tube as “5.0 µg/mL Methylene Blue”, your name, and date. Prepare Known Concentrations of Methylene Blue Working Solution via Dilution Prepare 80% Methylene Blue Working Solution 1. Pipette 8.0 mL of 5.0 µg/mL methylene blue working solution into a 15 mL conical tube. 2. Pipette 2.0 mL DI H2O into the tube to make 10.0 mL of total solution. 3. Seal the tube and invert repeatedly to mix. 4. What is the concentration of your new solution? Label the tube _______ µg/mL methylene blue. Prepare 60% Methylene Blue Working Solution 1. Pipette 6.0 mL of 5.0 µg/mL methylene blue working solution into a 15 mL conical tube. 2. Pipette 4.0 mL DI H2O into the tube to make 10.0 mL of total solution. 3. Seal the tube and invert repeatedly to mix. 4. What is the concentration of your new solution? Label the tube _______ µg/mL methylene blue. Prepare 40% Methylene Blue Working Solution 1. Pipette 4.0 mL of 5.0 µg/mL methylene blue working solution into a 15 mL conical tube. 2. Pipette 6.0 mL DI H2O into the tube to make 10.0 mL of total solution. 3. Seal the tube and invert repeatedly to mix. 4. What is the concentration of your new solution? Label the tube _______ µg/mL methylene blue. Prepare 20% Methylene Blue Working Solution 1. Pipette 2.0 mL of 5.0 µg/mL methylene blue working solution into a 15 mL conical tube. 2. Pipette 8.0 mL DI H2O into the tube to make 10.0 mL of total solution. 3. Seal the tube and invert repeatedly to mix. 4. What is the concentration of your new solution? Label the tube _______ µg/mL methylene blue. Measuring Absorbance of Methylene Blue Working Solutions 1. Turn on the spectrophotometer and let it warm up for at least 10 minutes. 2. Place 1 mL of DI water into a clean cuvette. This is your blank. 3. Place 1 mL of your methylene blue solutions into clean cuvettes. These are your samples. 4. Set the wavelength of the spectrophotometer to 664 nm. 5. Place the blank into the spectrophotometer. 6. Press the “Zero” button and wait for the Absorbance to read “0.00” 7. Take out the blank and set aside. 8. Place your first sample into spec and record the absorbance reading. Do not press any buttons. 9. Repeat with each sample and record into lab notebook Results Complete Data Table 1. based on your results. Put in your notebook Table 1. Absorbances of Methylene Blue at Various Concentrations Percentage of Working Solution Conc. Methylene Blue Concentration (µg/mL) Absorbance @ 664 nm 100% 5.0 80% 60% 40% 20% Making a Standard Curve 1. Enter the data into Excel in adjacent columns. 2. Select the data values with your mouse. On the Insert tab, click on the Scatter icon and select Scatter with Straight Lines and Markers from its drop-down menu to generate the standard curve. 1. To add a trendline to the graph, right-click on the standard curve line in the chart to display a pop-up menu of plot-related actions. Choose Add Trendline from this menu. Select “display equation on chart” and “display R-squared value on chart”. Ideally, the R2 value should be greater than 0.99. 2. Use the equation to determine the concentration of the sample solution by entering the absorbance for y and solving for x. 3. Print the standard curve and add to your notebook. Part III: Determining Concentrations Serial dilutions are quick way of making a set of solutions of decreasing concentrations. In this part of the lab we will make a series of dilutions starting with the Methylene Blue solution prepared in part 2 of this lab. Then, we will us the spectrophotometer to determine the absorbance of each solution. Once we know the absorbance, we will use the equation from your standard curve prepared in part 2, to determine the actual concentrations of each of your solutions. Materials Reagents • 5.0 µg/mL Methylene Blue Working Solution • DI H2O Equipment • P-20 Micropipettes and disposable tips • P-1000 Micropipettes and disposable tips • Spectrophotometer • 5 mL serological pipettes and pumps • 15 mL plastic conical tubes with screw-top caps Preparation ofMethylene Blue Solutions Using the remainder of your 5.0 µg/mL methylene blue working solution from part 2, perform a set of 1:2 serial dilutions to make the following concentrations of the solution (50.0 %, 25.0 %, 12.5 %, 6.25 %, 3.125 %, and 1.5625 %). Diagram of 1:2 Serial Dilutions In your notebook, draw a diagram showing the serial dilutions for the 6 methylene blue solutions you are preparing. In the diagram, indicate the volume being withdrawn from the concentrated solution, the volume of water added, the concentration of the new solution, and the total volume. Procedure Preparation of Methylene Blue Concentrations via Serial Dilutions Making 1:2 dilutions • Pipette 5.0 mL of the 5.0 µg/mL methylene blue working solution into a 15 mL conical tube. • Pipette 5.0 mL of DI water into the tube for a total of 10 mL of solution. • Cap and mix well. • Label this tube “50.0% MB” Making 1:4 dilution • Pipette 5.0 mL of the 50.0% MB solution into a new 15 mL conical tube. • Pipette 5.0 mL of DI water into the tube for a total of 10 mL of solution. • Cap and mix well. • Label this tube “25.0% MB” Making 1:8 dilution • Pipette 5.0 mL of the 25.0% MB solution into a new 15 mL conical tube. • Pipette 5.0 mL of DI water into the tube for a total of 10 mL of solution. • Cap and mix well. • Label this tube “12.5% MB” Continue with this process to make the 1:16, 1:32, and 1:64 serial dilutions. Write the procedures you used to make the solutions in your lab notebook. Measuring absorbance 1. Follow the procedures in part 2 to prepare the spectrophotometer 2. Measure the absorbance values of the diluted solutions 3. Record the absorbance values and concentrations in your lab notebook in a table as shown below. Data Table 2 Dilution Factor % of Working Solution Concentration Absorbance @ 664 nm Methylene Blue Conc. (µg/mL) 1:2 50.0% 1:4 25.0% 1:8 12.5% 1:16 6.25% 1:32 3.125% 1:64 1.5625 % Calculations Use the equation from your standard curve in part 2 and the absorbance values of your solutions from Part 3, to determine the actual concentration of your solutions. Study Questions 1. Describe how you would prepare 50.0-mL a 0.10% NaOH solution. In your description, include a calculation and step by step procedures including glassware. 1. It is common for solutions that are used often in a lab (or which are time consuming to prepare) to be intentionally prepared to be many times more concentrated than needed. For example, if a 1.36% sodium acetate is often used in the lab, then the 13.6% sodium acetate solution prepared in part 1 can be labeled as “10X” sodium acetate solution because the concentration is 10 times greater than needed. This way, you can save on storage space for the solution and you can quickly and easily dilute any desired amount of this to the correct concentration right before use. 2. Describe how you would prepare 100.0 mL of 10X sodium acetate solution. In your description, include a calculation and step by step procedures including glassware. Make sure to include steps to verify your solution by checking the pH. 3. Describe how you would prepare 100.0 mL of 1X sodium acetate solution from the 10x sodium acetate solution prepared in the questions above. In your description, include a calculation and step by step procedures including glassware. 4. Using a serial dilution, describe how you would prepare 10 mL of a 1%, 0.1% and 0.01% solution of NaOH. The stock solution of NaOH is 10%. Draw diagram as part of your description. 5. Using the standard curve below, calculate the concentration of an unknown solution if its absorbance is 0.55. 6. Evaluate the quality of the standard curve above by using the R2 value.

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.08%3A_Serial_Dilutions_and_Standard_Curve.txt

Learning Objectives Goals: • Employ indicators to discover characteristics of a solution. • Use indicators to determine contents of an unknown solution. • Employing positive and negative controls to validate a test. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Describe the properties of some important biomolecules. • Explain important characteristics of proteins and carbohydrates. • Perform tests to detect the presence of carbohydrates and proteins. • Explain the importance of a control in biochemical tests. • Use a biochemical test to identify the presence of a molecule in an unknown solution. INTRODUCTION The Macromolecules of Life: Proteins, Carbohydrates, and Lipids The cells of living organisms are composed of large molecules (macromolecules) sometimes also referred to as organic molecules because of the presence of the element carbon. Very many of the organic molecules found in living organisms are carbohydrates, proteins, lipids, and nucleic acids. Each of these macromolecules is made of smaller subunits. The different molecules have different chemical properties. For example, monosaccharides such as glucose will react with a chemical agent called Benedict’s solution but disaccharides, like sucrose, and polysaccharides, like starch will not. Similarly, proteins will react with a mix of potassium hydroxide and copper sulfate but free amino acids, carbohydrates, and lipids will not. Today, we will focus on three of these molecular types: lipids, proteins and carbohydrates. You will work with nucleic acids in another lab. You may want to review the properties of the biomolecules of life. Figure 1: The molecular and macro structures of sucrose, starch, lipids, and proteins. Molecular Type Molecular Structure Macro Structure Sucrose Common source: Table sugar Starch Common source: Rice Lipids Common source: Cooking oils Proteins Common sources: cell receptors, egg, hair, feathers Part I: Controlled Experiments to Identify Organic Compounds Indicators are chemicals that change color when chemical conditions change, such as pH, or when a chemical reaction takes place producing a colored molecule. There are many biochemical procedures that can be used to detect the presence of important molecules. In this exercise, you will test various solutions in order to detect the presence of these molecules. We will employ controls as we test the solutions. Controls provide results to compare to the solution being tested. Controls should give predictable results. By comparing the test solution result with the controls, you can determine the result of the test solution. A positive control contains the variable for which you are testing. When the positive control is tested, it reacts in an expected manner. If, for example, you are testing for a type of carbohydrate in unknown solutions, then an appropriate positive control is a solution known to contain that type of carbohydrate. The resulting reaction, when properly performed, will demonstrate that the reagents work as expected and shows what the result should look like if the test solution is positive. If the positive control does not react as expected, your test is not valid. Perhaps your test reagents are not working properly. A negative control does not contain the variable for which you are testing. Often a negative control contains only water. It will not react with the indicator reagents. Like the positive control, the negative control solution shows you what a negative result looks like and verifies that the detecting reagent is working properly. If the negative control does react, your test result is not valid. Perhaps the control solution or reaction tube was contaminated with the test variable. I. Carbohydrates Benedict’s Test for Monosaccharides Molecules made of the atoms carbon (C), hydrogen (H), and oxygen (O), in a ratio of 1:2:1 are carbohydrates. For example, glucose, one of the most important carbohydrates for living cells, has the chemical formula C6H12O6. Simple sugars also known as monosaccharides are carbohydrates. Paired monosaccharides form disaccharides. A common example of a disaccharide is the table sugar, sucrose. It is composed of the monosaccharides glucose and fructose linked to fructose. Similarly, linking three or more monosaccharides forms a polysaccharide. Starch, glycogen, or cellulose are polysaccharides important to cells and have many monomers of glucose linked together in different ways. Starch Benedict’s reagent is the indicator we use to detect monosaccharides. When monosaccharides are mixed with Benedict’s and heated, a color change occurs. If there is a small amount of monosaccharide in the solutions, a greenish solution is produced. If the solution contains a large amount of monosaccharide, an orangish precipitate results. A precipitating solution means small particles settle out of the solution. Reaction 1 Monosaccharides + Benedict’s reagent + Heat ⇒ Green to Orange II. Proteins The cell relies on proteins for very many functional reasons. Proteins may be enzyme catalysts, form channels for molecules to pass across membranes, form structures and more. The subunit of protein molecules are monomers of amino acids. The bond that forms between amino acids to form protein is called a peptide bond. Peptide bonds can be detected by using two chemical reagents, potassium hydroxide (KOH) and copper sulfate (CuSO4). Potassium hydroxide causes a protein to break apart so that copper sulfate can react with the peptide bonds. The resulting color is purple. The more protein, and hence more peptide bonds, in the solution, the darker the resulting purple will become. Testing for Monosaccharides with Benedict’s Reagent Reaction 2 Proteins + KOH + CuSO4Purple Materials 1. Test tubes labeled with the contents you will add to each tube 2. Beaker with water and hot plate (water heated to near boiling) 3. Metric ruler 4. Marker 5. Deionized water and carbohydrate solutions 6. Appropriate tool to remove hot tubes from water Procedure 1. Obtain 5 test tubes and number them 1 – 5. 2. Use a marker to indicate 2.5 cm from the bottom and another mark at 5cm from the bottom. 3. Fill each test tube to your 2.5 cm mark with the appropriate solution: 1. Distilled water 2. Concentrated glucose solution 3. Diluted glucose solution 4. Sucrose solution 5. Starch solution 4. Add Benedict’s solution to each tube to the 5 cm mark. 5. Place all of the tubes in a hot (90°C) water-bath for 2 min, and observe color-changes during this time. 6. After 2 min, remove the tubes from the water-bath and record the color of their contents in the table below. Also observe your classmate’s reactions. Observations Perform the Benedict’s test for monosaccharides. Reproduce this table in your lab book and complete it with your observations. Data Table 2. Tube Contents Color after reaction Presence of monosaccharide? 1. Water 2. Concentrated glucose 3. Diluted glucose 4. Sucrose solution 5. Starch solution Instructions to clean up * Clean tubes are very important. Contaminated tubes may influence results of future tests. 1. When your observations are complete, carefully wash and rinse the tubes following the instructions in part 2. You may leave the markings on them until the final clean up procedure of the day. Data Analysis 1. Which of the above solutions serve as your positive control? Negative control? 2. Examine your test and your classmates test solutions. Which solutions were positive for monosaccharides? 3. Which contains a higher concentration of monosaccharides, potato juice or onion juice? How do you know? 1. Which solutions did not react with the Benedict’s solution? Testing for Peptide Bonds (Protein) Materials • Four clean test tubes labeled with the contents you will add to each tube • deionized water, and test solutions • Indicator reagents potassium hydroxide (KOH) and copper sulfate (CuSO4) Procedure Perform the Peptide Bond test for Protein Caution! Do not spill the KOH – it is extremely caustic. Rinse your skin if it comes in contact with KOH. 1. Use your four clean test tubes from the previous procedure. They still need to be numbered and marked at 2.5 and 5 cm from the bottom. 2. Fill each test tube to the 2.5 cm mark with the appropriate solutions indicated below 1. Water 2. Protein Solution 3. Amino Acid Solution 4. Test Solution 3. Add potassium hydroxide (KOH) to the 5cm mark on each test tube. 4. Add five drops of copper sulfate (CuSO4) to tube and mix well. 5. Record the color of the tubes’ contents in the table below. Also observe your classmate’s reactions. 6. When finished dump the contents of the tubes and wash them. Rinse with distilled water. Observations Perform the Protein Test: Reproduce this table in your lab book and complete it with your observations. Data table 3. Tube Contents Color after reaction Presence of protein? Water Protein solution Amino acid solution Unknown solution Instructions to clean up *Clean tubes are very important. Contaminated tubes may influence results of future tests. When your observations are complete, carefully wash and rinse the tubes following the instructions in Part I. Data Analysis 1. Which of the solutions is a positive control? Which is a negative control? 1. Do individual amino acids have peptide bonds? How do you know this to be true? 1. What type of solution did you test as your unknown? Did it contain protein? 1. Observe your classmates reactions and describe which unknown solutions contain the most and the least protein. How can you tell? III. Lipids Lipids are a class of molecules that are not soluble (do not dissolve) in water. They are composed of the molecular building blocks of glycerol and three fatty acids. Fatty acids come in two major types, saturated and unsaturated. This difference is due to the presence of particular types of bonds within the fatty acid molecule (see figure) and affect the shape and characteristics of the overall lipid containing these fatty acids. You may want a review of lipids. Testing for Lipid with Sudan IV Caution! Use gloves and avoid contact with Sudan IV as it is considered a possible carcinogen. Immediately wash your skin with soap and plenty of water if you come in contact with the solution. Materials • Filter paper (small enough to fit in the petri dish) and pencil with areas labeled for test substances • clean empty petri dish • solution of 0.2% Sudan IV • Gloves (see safety warning) • Dedicated transfer pipettes or micropipettes with tips. • Solutions of deionized water, vegetable oil, and test solutions (cream, dairy milks, coconut milk, soy milk etc.) • optional- hairdryer Procedure 1. Obtain filter paper and on the far edge mark with pencil which solutions will be placed toward the interior of the mark. 2. Drop a small amount of solution near the appropriate mark. 1. Distilled water 2. Vegetable oil 3-6. Test solutions 3. Allow to dry. Use a hairdryer to speed up this process. 4. While the paper is drying, answer the Data Analysis questions below. 5. Soak the paper in the petri dish containing 0.2% Sudan IV. (handle with gloved hands) 6. Rinse the paper in distilled water and allow to dry. 7. Record the color of the spots in the table below. Also observe your classmate’s reactions. Observations Sudan IV test for lipid: Reproduce this table in your lab book and complete it with your observations. The darker the stain, the more lipid is present. Data table 4. Spot Contents Color after reaction Relative amount of lipid? 1. Water 2. Vegetable oil 3. 4. 5. 6. Instructions to clean up: When your observations are complete, carefully dispose of any remaining Sudan IV solution in the container provided by your instructor. Always use gloves and do not move the container if there is a danger of spilling. Data Analysis 1. Which of the above solutions serve as your positive control? Your negative control? 2. Hypothesize which solutions will contain the greatest amount of lipid. Why do you believe this to be true? 3. Which solutions contained the greatest amount of lipid? 4. Did your observations support your hypothesis? Were you surprised by some of the results? Explain. Part II. The Saga of the Soda Dispenser Enrique was a new employee. This was his first job and he had only been on the job for a couple of weeks and was still on “hiring probation.” He liked the crew he worked with and the paycheck that would come every few weeks. He wanted to stay. Today, there was a problem and he had to figure out something fast to solve it. He knew that if he did, the manager would be really pleased and his job was guaranteed. Someone was complaining that the soda dispenser was dispensing “regular” cola from the “diet cola” dispenser. The customer claimed to be on a reduced-calorie diet and was not happy about the extra calories consumed. There was more at stake than one unhappy customer, though. The manager told Enrique that many of their customers were diabetic and consuming sugar-laden soda could alter their blood-sugar chemistry in a dangerous way. They could not allow those customers to be harmed. Scope of the Problem If the diet soda dispenser did have regular soda, then did the regular soda dispenser have diet? What about the Dr. Pepper dispenser? That, at least, tasted like Dr. Pepper, so it was OK- or was it? What a mess! Should they throw all the soda in the dispenser out and start again? Or was there some way of determining if the soda was being dispensed correctly? If they could determine what the problem was, they could save the business money and not waste the soda products. Enrique’s Attempt to Solve the Mystery Enrique knew that most soda had high fructose corn syrup in it but diet soda had sugar substitutes in it: Substitutes that were not sugar but fooled your taste buds into believing it was. Questions for your lab book: 1. Does the regular soda have high fructose corn syrup in it? Look at the label determine if it does or doesn’t. Write your observation in your lab book. 2. Does the diet soda have high fructose corn syrup in it? Look at the label determine if it does or doesn’t. Write your observation in your lab book. 3. Determine whether fructose is a monosaccharide, disaccharide or polysaccharide. 4. Can we do a test? Just the other day, in science lab, Enrique had run some tests on solutions in order to determine their compositions. One of the tests was for detecting monosaccharides in solution! He knew his science teacher would still be in the classroom at this time and the school was barely a 5 minute walk from the restaurant. He could solve the mystery in under 30 minutes! Enrique quickly told his manager his plan and grabbed some cups of soda, which he labeled, so he could tell which dispenser they came from, then headed out. Enrique quickly ran to the school lab and got permission to run his experiment. Help Enrique set up an experiment to test the soda. More questions for your lab book: 1. Would it be a good idea to include controls? If so, which solutions? 2. Which detector reagent(s) will you use? 3. What colors will you look for to indicate the presence of the “regular” soda? 4. How many test tubes do you need? How will you label them? Testing Unknown Soda Solutions Materials 1. Clean test tubes labeled with the contents you will add to each tube 2. deionized water, and solutions to test 3. Indicator Procedure Perform the test for monosaccharides: 1. Obtain the needed number of clean test tubes and mark them at 2.5 and 5 cm as before. Code them as to the contents (numbers corresponding to your solutions- which you record below) 2. Obtain the unknown solutions from your instructor. 3. Fill the tubes to the 2.5 cm mark with the control and test substances. 4. Fill the tubes to the 5 cm mark with indicator and treat was needed. 5. Reproduce this table in your lab book and complete it with your observations, then answer the questions regarding the soda saga. Observations Perform the Appropriate Test: Reproduce this table in your lab book and complete it with your observations. Data table 5. Tube Contents Color after reaction Presence of fructose? Diet or regular? 1. 2. 3. 4. 5. 6. Caution! DO NOT allow ethanol to come in contact with the hotplate. Ethanol is very flammable. *Clean tubes are very important. Contaminated tubes may influence results of future tests. 1. When your observations are complete, carefully wash and rinse the tubes following the instructions in part 1. 2. At the end of the lab period be sure all labels are removed from the tubes using a small piece of paper towel and ethanol. Final Conclusion 1. What does Enrique tell his manager? Is the soda dispenser messed up or not? 2. What, if any, soda needs to be changed? Study Questions 1. Why should you always include controls in each procedure? 1. What serves as a good negative control and why? 1. Describe a positive control. 1. If you run a test for monosaccharide on what you believe is “regular” lemon lime-flavored soda, but the solution is sky-blue after heating with Benedict’s what does this tell you? 1. What if only AFTER running your test, you read the label of the lemon-lime soda and notice that the ingredients do not contain fructose but does contain sucrose. Is your test procedure faulty or is there another explanation for your result? Attributions 1. Sucrose Molecular Structure from LibreTexts 5.2 Carbohydrates. 2. Protein Structure diagram by Lady of Hats, Public Domain, via Wikimedia Commons. 3. Amino Acids forming a peptide bond (bottom image) by OpenLab at CitiTech CC-BY-NC-SA

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.09%3A_Biomolecule_Detection.txt

Learning Objectives Goals: • Carryout a colormetric assay to monitor amylase activity. STUDENT LEARNING OUTCOMES: Upon completion of this lab, students will be able to: • Describe how an enzyme works. • Explain the effect temperature has on the rate of chemical reactions. • Explain the effect of pH on enzyme activity. Introduction Living organisms sustain the activities of life by carrying out thousands of chemical reactions each minute. These reactions do not occur randomly, but are controlled by biological catalysts called enzymes. Enzymes accelerate the rate of chemical reactions by lowering the activation energy needed to trigger the reaction. Without enzymes, chemical reactions would not occur fast enough to support life. Enzymes are typically proteins and each is composed of a specific sequence of amino acids. Hydrogen bonds form between specific amino acids and help create the 3-dimensional shape that is unique to each enzyme. The shape of an enzyme, particularly its active site, dictates catalytic specificity of a particular enzyme. Each enzyme will only bind with specific molecules, as these molecules must fit with the active site on the enzyme like a lock and key. A molecule that binds with an enzyme and undergoes chemical rearrangement is called a substrate. The enzyme “E” combines with the substrate molecule(s) “S” at the active site and forms a temporary enzyme-substrate complex “ES”, where the specific reaction occurs. The modified substrate molecule is the product “P” of the reaction. The product separates from the enzyme and is then used by the cell or body. The enzyme is neither consumed nor altered by the reaction and can be used in other catalytic reactions as long as additional substrate molecules are available. Reaction 1 $\ce{E + S -> ES -> E + P}\nonumber$ An individual enzyme molecule may facilitate several thousand catalytic reactions per second, and therefore only a small amount of enzyme is needed to transform large amounts of substrate molecules into product. The amount of a particular enzyme found in a cell at any given time is relative to the rate at which the enzyme is being synthesized compared to the rate at which it is degraded. If no enzyme is present, the chemical reaction catalyzed by that enzyme will not occur at a functional rate. However, when the concentration of the enzyme increases, the rate of the catalytic reaction will increase as long as the substrate molecules are accessible. Various factors can inactivate or denature enzymes by altering their 3-dimensional shape and inhibiting their substrate binding efficiency. Many enzymes function best within a narrow temperature and pH range as substantial changes in temperature or pH disrupt their hydrogen bonds and alter their shape. Change in enzyme shape typically alters the shape of the active site, and affects its ability to bind with substrate molecules. It is the unique structural bonding pattern of an enzyme that determines its sensitivity to change in temperature and pH. In the following exercise you will explore the effects of pH and temperature on the activity of the enzyme amylase. Amylase is found in the saliva of humans and other animals that consume starch as part of their diet. Starch is a plant polysaccharide composed of many glucose molecules bonded together. Amylase controls the initial digestion of starch by breaking it down into disaccharide maltose molecules. Maltose is ultimately broken down into glucose molecules in the small intestine when other enzymes are utilized. The rate at which starch is digested into maltose is a quantitative measurement of the enzymatic reaction. The rate of starch degradation is relative to the rate at which maltose is produced, however it is easier to test for the presence of starch than it is to measure the rate of maltose production. I2KI will be used as indicator for the presence of starch. When starch is present, I2KI turns a blue-black color. In the presence of maltose, I2KI will not react and remains an amber color. Reaction 2 $Starch + I_2KI \rightarrow \text{Dark Blue-Black color} \nonumber$ Reaction 3 $Maltose + I_2KI \rightarrow \text{Amber color} \nonumber$ Your group will be assigned to conduct one or more of the following activities (in part or whole): I. The effect of pH on amylase activity II. The effect of temperature on amylase activity Results from each exercise will be presented to the class and students will be responsible for the information and results from all exercises. Part I: The Effect of pH on Amylase Activity Each enzyme has an optimal pH at which it is the most active or effective. A change in pH can alter the bonds of the 3-dimensional shape of an enzyme and cause the enzyme to change shape, which may slow or prohibit binding of the substrate to the active site. You will determine how pH affects amylase activity in this exercise. Before beginning this experiment, formulate a hypothesis you wish to test and a prediction to evaluate your hypothesis by and write these into the data sheet at the end of the exercise. Materials • Test tubes • Buffers (pH: 1.0, 5.0, 10.0) • Micropipettes • Sterile pipette tips • 1% starch solution • I2KI solution • Well plate • 0.5% amylase solution • Timer Procedure 1. Label 3 test tubes #1 - #3. Beginning with tube #1 and pH 1, mark one tube with each of the following buffer pH: 1.0, 5.0, and 10.0 (See Table 1 below). After you mark the test tubes, use a P-1000 micropipette and add 4.0 mL of the appropriate buffer to each test tube (4.0 mL pH 1.0 buffer to tube #1, 4.0 mL of pH 5.0 buffer to tube #2, etc). Be sure to place a new tip on the micropipette for each buffer. 2. Using a P-1000 micropipette, add 2.0 mL of the 1% starch solution to each tube and mix by gently swirling the tube and tapping the bottom of the tube against your palm. 3. Place 2 drops of I2KI into the compartments of several rows of the test plate so that 24 compartments have clear amber liquid in them. 4. Starting with Tube #1 only for now, do the following: 5. Using a clean new tip on a P-200 micropipette, draw 50.0 microliters of liquid from the test tube and dispense it into the first compartment of the test plate containing I2KI. The mixture should turn dark blue or black. (This confirms that starch is present in your test tube before the enzyme is added to the tube.) • Do not touch the I2KI with the Pipette Tip! • If you do, eject the tip and change to a new clean one. 6. Add 400.0 µL of 0.5% amylase solution using a P-1000 micropipette. Begin recording the time in seconds the moment the amylase is added. Mix the tube contents by swirling the tube and gently tapping the bottom of the tube against your palm. Proceed to the next step immediately (within 20 seconds). 7. At exactly 20 seconds, transfer 50.0 µL (using your P-200 micropipette) of the reaction mixture from tube #1 into the next new compartment containing I2KI on the test plate. • Do not touch the I2KI with the Pipette Tip! • You can continue using the same tip for step 8 below as long as it remains uncontaminated. 8. Repeat step 7 every 20 seconds using the next new compartment on the test plate. Continue until a blue-black color is no longer produced and the I2KI solution remains amber (indicating that no starch remains). Then count the total number of compartments that did change colors plus on that did not change colors and multiply by 20. Record the time required for the complete digestion of the starch in Table 1. If the color of the I2KI continues to change to a darker color after a total of 8 minutes of testing, stop testing that reaction mixture, record 480 seconds as the time in the data table, and proceed with step 9. 9. Repeat steps 5 - 8 using tube #2 then #3. You may need to clean your test plate by rinsing it with DI water, tapping it dry, and then adding fresh I2KI to the compartments. Data Table 1 Tube pH Time of Starch Digestion (sec) 1 1 2 5 3 10 Data Analysis 1. How would you interpret the results shown in Table 1? Part II: The Effect of Temperature on Amylase Activity Chemical reactions speed up as temperature increases. A 10o C rise in temperature typically results in a two- to threefold increase in the rate of reaction. However, at high temperatures proteins can be irreversibly denatured and substrate binding is prohibited. The activity of an enzyme is dependent on its proper structure, and the optimum temperature for activity may vary depending on the structure of the enzyme. Before beginning this experiment, formulate a hypothesis you wish to test and a prediction that can be used to evaluate your hypothesis. Write these into the data sheet at the end of the exercise. Materials • Test tubes • Micropipettes • Sterile pipette tips • DI water • Hot water bath (80oC and 37 oC) • Ice bath (4oC) • 1% starch solution • I2KI solution • Well plate • 0.5% amylase solution • Timer Procedures 1. Label 3 test tubes #1-#3. 2. Using a P-1000 micropipette, add 1.0 mL of 1% starch solution to each tube. 3. Using a new tip on your P-1000 micropipette, add 3.0 mL DI water to each tube. 4. Using a new tip on your P-1000 micropipette add 1.0 mL of pH 5.0 buffer to each tube. 5. Place the test tubes as follows: Tube #1 in 80oC water bath, Tube #2 in 37oC water bath (or incubator), Tube #3 in crushed ice (4oC). 6. Let all 3 tubes sit in the specified environments for at least 15 minutes. 7. Place 2 drops of I2KI into the compartments of several rows of the test plate so that 24 compartments have clear yellow liquid in them. 8. Starting with tube #1, do the following: 9. Using a CLEAN NEW TIP on a P-200 micropipette, draw 50.0 microliters of liquid from the test tube and dispense it into the first compartment of the test plate containing I2KI. The mixture should turn dark blue or black. (This confirms that starch is present in your test tube before the enzyme is added to the tube.) DO NOT TOUCH THE I2KI WITH THE PIPETTE TIP! If you do, eject the tip and change to a new clean one. 10. Add 400.0 µL of 0.5% amylase solution using a P-1000 micropipette. Begin recording the time in seconds the moment the amylase is added. Mix the tube contents by swirling the tube and gently tapping the bottom of the tube against your palm. Proceed to the next step immediately (within 20 seconds) IMPORTANT! Leave the tubes in their temperature environments as they are being tested! 1. At exactly 20 seconds, transfer 50.0 µL (using your P-200 micropipette) of the reaction mixture from tube #1 into the next new compartment containing I2KI on the test plate. • Do not touch the I2KI with the Pipette Tip! • You can continue using the same tip for step 8 below as long as it remains uncontaminated. 2. Repeat step 11 every 20 seconds using the next new compartment on the test plate. Continue until a blue-black color is no longer produced and the I2KI solution remains amber (indicating that no starch remains). Then count the total number of compartments that did change colors plus on that did not change colors and multiply by 20. Record the time required for the complete digestion of the starch in Table 2. 3. If the color of the I2KI continues to change to a darker color after a total of 8 minutes of testing, stop testing that reaction mixture, record 480 seconds as the time in the data table, and proceed with step 9. 4. Repeat steps 9 - 13 using tube #2 then #3. You may need to clean your test plate by rinsing it with DI water, tapping it dry, and then adding fresh I2KI to the compartments. Data Table 2 Tube Temperature (oC) Time of Starch Digestion (sec) 1 80 2 37 3 4 Data Analysis How would you interpret the results shown in Table 10.2? Study Questions 1. How does an enzyme speed up a chemical reaction? 2. What factors can denature a protein? How? 3. What reaction does amylase catalyze? 4. Explain the colormetric assay used to monitor amylase activity.

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.10%3A_Enzyme_Function.txt

Learning Objectives Goals: • Run agarose gel electrophoresis on samples. • Learn how to analyze DNA fingerprints. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Separate molecules by electrophoresis. • Analyze bands resulting from gel electrophoresis. • Determine the paternity of offspring using DNA fingerprint analysis. Part I: Agarose Gel Electrophoresis Introduction Gel electrophoresis is a very common and useful technique for separating DNA, RNA, and protein molecules on the basis of molecular size and charge. Agarose is a polysaccharide, found in seaweed, that forms a gel matrix (meshwork of various-sized holes). When an electric current is passed through the buffer and the gel, the molecules in the sample move toward the electrode with the opposite charge. DNA, RNA and protein molecules typically have a negative overall charge and will move toward the positive electrode. Smaller molecules can move through the matrix of the gel faster than larger molecules. DNA fingerprinting uses band patterns that result from specific treatment of DNA samples to identify the relationship of a sample to reference samples. In this lab, you will run a simulation of a DNA fingerprinting activity in order to become familiar with this process. You will load samples on a gel and separate the bands in each sample to create specific patterns using gel electrophoresis. Preparing Agarose Gels There are various running buffers that can be used to separate DNA. A few of the commonly used buffers are called TAE (Tris Acetate EDTA), TBE (Tris Borate EDTA), and SB (Sodium Borate). Always use the same buffer to make the agarose gel and run the electrophoresis. MATERIALS • Agarose powder • Spatula • Weigh boat • 20x stock • Graduated cylinders • PipetAid • Serological pipet • Flask with vented cap EQUIPMENT • Balance • Microwave PROCEDURE 1. Prepare 500 ml of 1X Sodium Borate buffer from a 20X stock solution. 1. Measure 25 mL 20X Sodium Borate buffer stock in a 25 mL graduated cylinder and pour into a 500 mL container. 2. Measure 475 mL DI-water in a 500 mL graduated cylinder and pour into the same container. 3. Cap tightly and mix. 2. Prepare 50 ml 0.8% (w/v) agarose in 1X Sodium Borate buffer to pour four Mini One gels. Note that agarose (and gelatin) are two substances that are prepared in a special way, as they can only dissolve in boiling liquids. So, we NEVER put agarose (and gelatin) powder into graduated cylinders. Instead we pour the powder into the final container (Erlenmeyer flask). 1. Measure 50 mL 1X buffer with a 50 mL graduated cylinder and pour into an Erlenmeyer flask. 2. Measure 0.4 g of agarose powder and pour into the same flask. This will look like an opaque slurry. 3. Use a vented cap if possible (or no cap). Place the flask in a microwave oven and turn on (for 1 minute) at high setting. Keep a close watch - do not allow the liquid to boil over! 4. Watch for bubbling of the liquid. As soon as the liquid starts to bubble, stop the microwave, use mitts or silicone “Hot Hands” to swirl the flask 2-3 times. 5. Then replace and turn on the microwave again for the second boil. 6. As soon as the liquid starts to bubble, stop the microwave, use mitts or “Hot Hands” to hold the flask to the ceiling light. Look carefully for any specks or crystals in the liquid. When there are no more specks visible in the clear solution, then the agarose has completely melted. 7. Place the flask on the table and allow to cool to 60oC. When you are first able to hold the flask with bare hands, then the agarose is cool enough to pour into trays. Do not pour agarose too hot, as the casting gels will warp and crackle. Do not cool agarose too long, as the gel will not polymerize evenly. 8. Prepare the casting trays and practice loading gel samples while you wait. Casting Agarose Gels (MINI ONE EMBITEC GEL SYSTEM) 1. Place two clear acrylic casting trays into the white casting stand. 2. Insert the 9-well comb into the proper slot of the casting stand. 3. It is best to use a Pipet-Aid and 25 mL Serological Pipet to measure and transfer 12.5 mL of melted agarose solution into each casting tray. Or pour agarose solution until 1/3 up the comb. 4. Quickly move or pop air bubbles with a pipet tip or gel comb. Insert the gel comb into the proper slot. 5. Do not move or bump the gel tray until the gel has solidified in about 15 minutes. 6. Store extra agarose solution in flask, covered with parafilm or cap, at 4oC for later use. Practice Loading Gel Samples Loading gel samples is a skill that takes practice to learn! The actual agarose gel that you will be using for electrophoresis is very delicate and can easily be punctured. The practice gel cannot be punctured, but provides the same size wells to dispense your samples. As DNA is clear, usually a colored loading dye is added to the DNA samples. High-density glycerol is also added to the loading dye, so that the DNA samples will fall to the bottom of the well quickly. Lab Tip: When loading samples into the gel wells, only push the micropipette plunger to the first stop, do NOT push to the second stop. Be sure to keep your thumb pressed down on the plunger, until the micropipette is completely out of the buffer tank. 1. Obtain a practice urethane gel. 2. Cover the gel with deionized water. If there are bubbles in the wells, use a plastic transfer pipet to remove the bubbles. 3. Use a pipet tip on a P20 micropipette and set dial to 10.0 uL. 4. Push and hold micropipette plunger to the first stop. 5. Pick up 10 µL of the practice red dye and slowly release your thumb. 6. Hold the micropipette vertically (see Figure 1) over the practice gel, such the tip is below the water level and just above the well. There is no need for tip to enter into the well, as the heavy glycerol will pull the sample down into the bottom of the well. 7. Push the plunger to the FIRST STOP only and keep your thumb there. (Optional: try pushing to the second stop to see what happens.) 8. Move your entire arm up, so that the micropipette is out of the water, then allow your thumb to come off the plunger. (Optional: try releasing your thumb while the pipette is still in the water to see what happens). 9. Practice loading 10.0 µL of the red dye into three or more wells of the practice gel. 10. You should be able to see the colored sample drop down to the bottom of the wells. Lab Tip: If done correctly, all of the sample will stay in the well. Check if there is any colored dye floating away from the top of the well, which means that the sample may contaminate another well. Check if there is any dye leaking out from the bottom of well, which means that you punctured the well and the sample may not enter the gel. PART II: Paternity Case: Who is the Father of My Kittens? Mary has a white cat named “Honey” who was lost for two days about three months ago. She now has four kittens (photo 1) and Mary wants to know if the two neighboring cats, “Tom” or “Butch,” could be the father of each kitten. To analyze their DNA fingerprint, Mary has collected hair follicles from each adult cat and kitten, extracted DNA, and amplified DNA using the polymerase chain reaction. Hypothesis Using the photo, complete table 1 with your prediction of the father of each kitten. Table 1. Hypothesis on Paternity of Kittens Kitten Potential Father Reasoning Cream Molasses Ginger Sugar Materials Reagents • Pre-cast 0.8% agarose gel • Seven samples in microfuge tubes. One for each feline • 135-150 mL 1X sodium borate running buffer (enough to submerge the agarose gel) Equipment and Supplies • Electrophoresis system such as MiniOne or other brand with the gel chamber and power supply • P-20 micropipettes and appropriate tips • Cell phone or camera to photograph the gel to document results Procedure 1. NOTE: The following is completed when the electrophoresis chamber has been prepared with an 0.8% agarose gel and 1x Sodium Borate buffer in the chamber. Do not forget to document your procedure appropriately in your laboratory notebook. 2. Obtain the “DNA samples” – there are seven microfuge tubes labeled P- V. 3. Using a P-20 micropipettor and a pipet tip, measure 10µL from Tube P and transfer into the first well of the agarose gel. Be sure to follow the gel loading order noted in Column 1 – Well. 4. Using a new tip for each sample, transfer 10µL of each sample into new wells of the gel. 5. Be sure to keep track of your sample loading, if you do not follow the table below. If there were any problems with the loading (punctured gel, not enough sample), be sure to write in the NOTE column. Table 2. Loading notes: Include any deviations or notes in your laboratory notebook Well Tube DNA Sample 10µL Notes for loading 1 P Tom (male) 2 Q Cream (kitten) 3 R Molasses (kitten) 4 S Honey (female) 5 T Ginger (kitten) 6 U Sugar (kitten) 7 V Butch (male) 1. If using a MiniOne electrophoresis system, run the gel for 15 minutes, until color bands separate. If using another electrophoresis system, run the gel at 135V until the dye front is. 2. For best viewing of the results, pick up the casting tray (with gel) out of the buffer tank, slide the gel onto a white laminated paper, label the samples (and your team name) and take a photo. 3. Because DNA samples will diffuse through the agarose gels, you should always record results quickly once the electrophoresis has been turned off. ANALYSIS 1. Use colored pencils to record the band patterns (color the appropriate blocks) in the Data Table below. Table 3. Colored “DNA” Bands Separated by Agarose Gel Electrophoresis Tube P Q R S T U V Band Tom (Male) Cream Molasses Honey(Female) Ginger Sugar Butch (Male) Blue #1 Blue #2 Pink #1 Purple #1 Yellow #1 Yellow #2 1. Carefully consider each band of all four kitten samples and determine whether the band matches Tom, Honey or Butch. For the kitten samples (columns QRTU) in Data Table 3, write (within the colored blocks) who matches that band -- Tom, Honey, or Butch. 2. Draw your conclusions based on the “DNA evidence”. 3. Fill in the 2nd and 3rd column in table 4 below. Compare your hypothesis in table 1 where you guessed the father for each kitten based on appearances to your conclusion regarding the father based on the DNA evidence. Was your hypothesis correct for each kitten? 4. What is the specific evidence that justifies your conclusion determining each kitten’s father? Fill your responses to these questions in the table below. Table 4. Comparison of Hypothesis and Conclusion backed by Experimental Evidence KITTEN FATHER based on visual FATHER based on DNA Evidence Cream Molasses Ginger Sugar Study Questions 1. During gel electrophoresis, DNA will migrate toward which electrode? 2. If you had DNA molecules that were small, medium, long, and extra long, which would be closest to the bottom of the gel after electrophoresis? 3. What do you know about the pattern of bands that result from an offspring as they relate to the mother and father? 4. If you ran DNA fingerprint analysis but the band pattern for the offspring was not matching either parent, what would you conclude?

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.11%3A_Paternity_Case_with_Electrophoresis.txt

Learning Objectives Goals: • Understand the function of restriction enzymes. • Conduct analysis of DNA fragments by gel electrophoresis. STUDENT LEARNING OUTCOMES: Upon completion of this lab, students will be able to: • Read a plasmid map to determine restriction sites and fragment sizes. • Determine if restriction enzyme recognition sequences are palindromes. • Predict the sizes of DNA fragments formed after a restriction digest. • Compare gel electrophoresis bands to determine DNA sizes. Introduction Recombinant DNA technology is possible due to several tools useful for manipulating DNA molecules and transforming cells -- including plasmids, restriction enzymes and DNA ligase. This lab introduces you to plasmids and restriction enzymes, as well as the lab technique of gel electrophoresis. Later lab experiments will introduce you to the other tools of biotechnology. Restriction enzymes (also called restriction endonucleases) are proteins made by many bacterial species, to defend against viral infections. Each restriction enzyme moves along a DNA molecule until it finds a specific recognition sequence in the DNA. The enzyme cuts the double-stranded DNA, resulting in DNA fragments. Over 3000 restriction enzymes that recognize short (4-8 bp) palindromic sequences have been discovered. Figure 1 shows the recognition sequence for restriction enzyme Hind III. Notice that the recognition sequence is a palindrome, and reads the same going forwards and backwards. The Hind III enzyme makes a staggered cut of the DNA, and produces fragments that have single stranded areas called “sticky ends”. Figure 2 shows the recognition sequence of two other restriction enzymes Sca 1 and Pst 1. Enzyme Pst 1 makes a staggered cut of the DNA at its recognition sequence. But restriction enzyme Sca I makes a blunt cut at its recognition sequence to generate DNA fragments with no sticky ends. Bacterial cells have all of their genes (genome) in a single circular chromosome. But bacterial cells can also carry non-essential pieces of DNA called plasmids. A plasmid is a small circular DNA that is able to replicate itself, and can carry a few genes from cell to cell. Scientists are able to design recombinant plasmids to carry specific genes into a target host cell. The genetic map of a plasmid “pUC19” is shown in Figure 3. The total size of the plasmid is 2686 bp. There is a Pst I recognition site at position 439, Hind III recognition site at position 447, and Sca I recognition site at 2179. If one restriction enzyme is used to cut pUC19 plasmid, what would be produced? Determine what DNA fragments are produced when two restriction enzymes are used to cut pUC19 plasmid DNA. Table 1. Predicted DNA Fragments from Restriction Digest of pUC19 Plasmid Cut with Restriction enzymes Sca I and Pst I Sca I and Hind III Pst I and Hind III Resulting DNA fragment sizes Part I: Restriction Digest Agar is a polysaccharide derived from red algae. The agar powder is first dissolved in a boiling liquid, and then cooled to form a gelatinous solid matrix. As microbes cannot digest agar, this material is used commonly in laboratories to hold the nutrients that bacteria need. Materials • P-20 micropipette • Box of disposable pipette tips • Clean microfuge tubes • Microfuge tube rack • Permanent marker • Waste container for used tips and microfuge tubes • Microfuge tubes containing: • pUC19 plasmid DNA • pPUS2 plasmid DNA • Pst 1 Restriction enzyme • Sca 1 Restriction enzyme • Restriction buffer • Deionized water Equipment • Microcentrifuge • 37oC water bath (or dry bath or incubator) Method 1. Use a Sharpie to label the top and side of 3 clean microfuge tubes A B C and your group name. 2. Follow the reagent table below and dispense the proper amounts of reagents to the labeled tubes. Use new tips for different reagents. Add reagents to the solution at bottom of tube. Always check that your pipet tip is empty after dispensing the reagent. Table 2. Volumes of Reagents to Add to Each Tube Tube DNA Pst 1 RE Sca 1 RE Restriction Buffer Water A 4 µL pPUS2 2 uL none 4 uL none B 4 µL pUC19 2 uL 2 uL 2 uL none C 4 µL pUC19 2 uL none 4 uL none D 4 µL pUC19 none none none 6 uL 1. Cap tubes tightly Place two tubes directly across from each other in the microcentrifuge. 2. Spin for five seconds to bring all the reagents to the bottom of each tube. 3. Place tubes into a floating rack in the 37°C water bath for at least one hour (but no more than two hours.) 4. After the incubation period is finished, you will analyze the contents by gel electrophoresis in Part IV. Part II: Casting Agarose Gel Agarose is a complex carbohydrate found in seaweed. If agarose is dissolved in a boiling liquid and then cooled, the solution converts into a solid gel matrix. The agarose solution will be poured into a casting tray to form the desired gel shape. A gel comb has teeth that is used to form the “wells” or holes for loading the samples. You will be prepare and cast a 1% agarose gel with electrophoresis buffer. Materials • Agarose powder • Weigh boat • Spatula • Masking tape • 100 Graduated cylinder • 250 mL Erlenmeyer flask • Electrophoresis Gel Casting tray • Gel comb • Deionized or distilled water • 1X Electrophoresis buffer • Heat-resistant silicone mitts or tongs • Electronic or analytical balance • Microwave Method Note • Note: If you have concentrated electrophoresis buffer stock, you must dilute the stock to 1X working concentration before preparing agarose solutions or running gel electrophoresis. • For 20X stock, combine 25 mL 20X stock with 475 mL deionized water to make 500 mL 1X buffer. • For 50X stock, combine 10 mL 50X stock with 490 mL deionized water to make 500 mL 1X buffer. 1. Using the graduated cylinder, measure 100 mL of the 1X electrophoresis buffer. 2. Using an electronic scale, measure 1.0 g of agarose powder. 3. Pour some of the measured buffer into an 250 mL Erlenmeyer flask. Pour in the measured agarose powder. Pour some of the measured buffer into the agarose weigh boat, and pour into flask. Repeat until all agarose has been transferred to flask. Pour rest of buffer into flask. 4. Cover the opening of the flask with plastic wrap. Use a pipette tip to poke a small hole in the plastic wrap. 5. Place the covered flask in a microwave and heat on high. When you see bubbles form in the solution, pause the microwave, use oven mitts to gently swirl the flask a few times. 6. Continue microwaving the flask until the liquid starts to bubble again. Using oven mitts, hold the flask to the light and swirl the solution. Look carefully to check that there are no specks or swirls of agarose suspended in the liquid. If liquid is clear, then the agarose is dissolved. Wait five minutes for the agarose to cool. Note: Instructor will announce if you have a casting stand system and do not need to tape each tray. 7. Prepare the acrylic electrophoresis gel trays for casting. You may need to tape the two open ends of each tray. Be sure to press tape firmly along the entire edge of the tray with your fingernail. If using masking tape, you can see a difference in the tape translucence. 1. Place a comb in each tray before adding the agarose solution. 2. When the agarose solution has cooled to the point that you can safely touch the bottom of the flask (~60°C; about five minutes), pour agarose solution into each casting tray, so that the solution covers about 2 mm of each comb. Note: Each Mini One gel requires 12.5 mL agarose solution, each casting tray holds two gels = 25 mL total. 3. Once the gels solidify (which will take around 30 minutes), pull the comb out of each gel. Pull it straight out without wiggling it back and forth; this will minimize damage to the front wall of the well. Part III: Practice Pipetting While you are waiting for the restriction digest to incubate, you can practice loading samples into a practice gel. As agarose gels are very easy to puncture through, it is important to have good technique for loading the samples. As the gel wells are small, only push the micropipette to the FIRST stop to dispense the sample. Purified DNA looks like water, so a colored dye is added to ensure that you can see the sample loading into the well. Glycerol, a viscous liquid, is added to the loading dye to ensure that the DNA sample will sink to the bottom of the well. Materials • P-20 micropipette • Box of disposable pipette tips • Waste container for used tips • Tube of colored dye/glycerol • Agarose or polyurethane practice gel • Agarose powder • Weigh boat • Spatula • Masking tape Method 1. Watch the video or instructor demonstration. 2. Submerge the practice gel with water or buffer. 3. Practice loading 5 µL and 10 µL colored dye into several wells of a practice gel. Do not change tips for this practice. 4. To steady your pipette hand, place your elbow on the table. You may also use your other hand to support and steady your pipette hand. Part IV: Gel Electrophoresis Gel electrophoresis is a technique to use electrical current to separate a mixture of molecules such as DNA, RNA, and proteins. The electrophoresis buffer contains ions to conduct electric current. As DNA molecules are negatively charged, they will migrate towards the positive electrode (red). The solidified agarose gel matrix will have pores of various sizes (similar to a sponge), so the size, shape and charge of the molecules can affect the rate of travel through the agarose gel. Smaller molecules move faster than the larger molecules. DNA can be visualized with various dyes. Scientists typically use ethidium bromide (either inside the agarose gel or as post-stain after the gel run). As ethidium bromide is mutagenic, we will not be using that in our class. Instead, we will use gel green stain, which is compatible with the blue LED transilluminators (eg. MiniOne). The alternative stain is gel red, which works with the uV transilluminators. Materials • Agarose powder • Weigh boat • Spatula • Masking tape • 100 Graduated cylinder • 250 mL Erlenmeyer flask • Electrophoresis Gel Casting tray • Gel comb • Deionized or distilled water • 1X Electrophoresis buffer • Heat-resistant silicone mitts or tongs • Electronic or analytical balance • Microwave Method Setting Up the DNA Samples 1. Find your tubes from the restriction digest (Part 1). 2. Add 2 µL of Gel green Loading dye into each of the sample tubes. Pipet up and down twice to mix the liquid. 3. Place tubes in a balanced configuration in a MicroCentrifuge and spin for five seconds. Setting Up the Electrophoresis System 1. Watch a demo or assigned videos and follow instructions for placing the gel tray into the electrophoresis buffer tank. 2. Fill the buffer tank with 1X Electrophoresis buffer, ensuring that the entire gel is completely submerged. You want about 1 mm liquid layer above the gel, but not too much buffer as that can build up resistance. 3. Check that the gel is oriented with sample wells closest to the negative electrode (black). Check that the power cord can reach easily. Check that the gel box will not need to be moved for 30 minutes. 4. Draw and label in your notebook how the samples will be loaded in the gel. Check whether you will be sharing the gel with another group. 5. Using a new tip for each sample, load the DNA samples carefully into the gel wells. 6. After all the samples are loaded, place the cover over the electrophoresis box. [Note: Gel green is especially sensitive to light, so do not leave the Mini One light on during the electrophoresis]. 7. Connect the electrical leads to the power supply. Connect both leads to the same channel, with the negative (-) cathode to cathode (black to black) and the positive (+) anode to anode (red to red). [Note: Mini One system must have orange hood in place to turn on]. 8. Turn on the power supply and set the voltage to 130–135 V. [Note: Mini One systems do not have adjustable voltage]. 9. After turning on the power on the gel boxes, look for bubbles forming on the negative electrode (to show electric current) and that dyes are moving toward the correct direction. If running the wrong way, wait until dyes are inside the agarose gel, then turn the gel 180o and restart the run.. 10. Do not allow the loading dye to run off the gel. Be sure to turn off the power switch and unplug the electrodes from the power supply. Do this by grasping the electrode at the plastic plug, NOT the cord. 11. Carefully remove the cover from the gel box and pick up the gel tray. Slide the gel onto plastic wrap on top of the appropriate transilluminator. Take a photo. 12. Compare the sizes of the DNA ladder to the pUC19 fragments. The pPSU1 cut with Pst1 has fragments of 4100, 2000, 1000, 900, 800, 700, and 500. The pPSU2 cut with Pst I have sizes of 4100, 1500, 600, 500, 400, 300, 200, 100, 50. 13. What sizes are the pUC19 DNA fragments? Study Questions 1. In nature, what is the function of restriction enzymes? 2. What is a palindrome? How does that relate to restriction enzymes? 3. Why do molecular biology research labs always have microwaves? 4. Why should you not ever eat in a molecular biology research lab? 5. How do you dispense samples into an agarose gel?

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.12%3A_Restriction_Digest_with_Gel_Electrophorisis.txt

Learning Objectives Goals: • Explain how the information encoded in a gene is expressed as a trait • Describe the role of transformation in cloning genes • Explain the purpose of each control in the transformation experiment Student Learning Outcomes: Upon completion of this lab, students will be able to: • Carryout a transformation • Predict the growth results for the negative control and plasmid containing reaction on both antibiotic-containing and nutrient agar only media • Explain your reasoning, if predicted growth results don’t match actual growth results Introduction Genetic engineering or DNA technology has been useful for producing large quantities of a specific protein to treat human diseases. For example, patients with diabetes, hemophilia, or anemia require treatments with insulin, clotting factor, and growth factor proteins. Targeted genes (DNA) can be cut with restriction enzymes and joined with other DNA with the enzyme ligase. A cloning vector is used to carry the recombinant DNA into living cells, so that the cells can synthesize the encoded proteins. The best cloning vectors are small in size, able to replicate its DNA, contain restriction enzyme recognition sites, and have a marker gene (usually antibiotic resistance gene). In this lab, we will use a recombinant plasmid as the cloning vector. This recombinant plasmid contains (1) a promoter that enables transcription of desired gene, (2) a sequence for the initiation of DNA replication (ori site), and (3) an antibiotic resistance gene. Transforming Bacteria with Recombinant Plasmid Inserting a gene into a plasmid vector is an important first step in the gene cloning process. However, if the ultimate goal is to produce a large amount of a particular protein, the plasmid must replicate to make sure that there are many copies of the gene and the gene of interest must be expressed, meaning the gene is utilized to produce the encoded protein. Both activities can only occur inside a cell. Therefore, in this lab we will put a recombinant plasmid into E. coli bacteria through a process that is called transformation, so named because it changes the DNA content of the bacteria. The plasmid will be taken up by bacteria where it replicates, and its genes will be expressed using the bacterial cellular machinery. If a gene of interest has been inserted into the plasmid vector, the bacteria produces the product encoded by that gene. In this exercise, you will carry out the transformation of E. coli bacteria using a recombinant plasmid that contains a gene that produces colored proteins. Bacterial Transformation Once a recombinant plasmid is made that contains a gene of interest, such as insulin, the plasmid can enter bacterial cells by a process called transformation. Figure 13.1 illustrates transformation. The uptake of DNA from the environment of a bacterial cell occurs with a very low efficiency in nature. E. coli bacteria have complex plasma membranes that separate the external environment from the internal environment of the cell and carefully regulate which substances can enter and exit the cell. In addition, the cell wall is negatively charged and repels negatively charged DNA molecules. Cells that have been treated to become competent are more efficient at taking in DNA from their surrounding environment. Competent cells can be made by treating the bacteria with a calcium solution. Calcium ions are positively charged, and will neutralize the negatively charged outer membrane on the E. coli bacteria. With the positive charge now coating the membrane, the inherently negatively charged DNA molecules will move through the plasma membranes and into the cell. The transformation efficiency can be further increased by stressing the cells in a heat shock. By changing the temperature of the cells drastically from cold to warm, the plasma membranes become more fluid and create pores in them. The plasmid DNA can travel from the environment through these pores and enter the cell. The cells are then plunged back into a cold temperature, which causes the pores to close and the plasmid DNA to remain inside the cell. However, even competent cells do not always uptake the plasmid. For some plasmid DNA molecules, only about 1 in 10,000 cells will be transformed. When so few cells have taken in the plasmid, how will you be able to identify transformed cells? When designing a recombinant plasmid, one of the requirements is to add a gene for an antibiotic resistance. This way, the bacteria can be grown in the media with an antibiotic added to it, and only cells that have the resistance gene, such as those that express the recombinant plasmid, will be able to grow. From Plasmid DNA to Protein After a recombinant plasmid enters a bacterial cell, the cell begins to express the genes on it. DNA polymerase locates the ori- the origin of replication, and starts to replicate the plasmid using the bacterial cell’s machinery. Multiple copies of the recombinant plasmid can enable the bacterial cell to express large amounts of a protein. Usually, a bacterial cell will only make the protein of interest, after it is induced to do so by adding a chemical which will promote the transcription of the gene. Recall that to express the gene encoding the protein on the recombinant plasmid, DNA is transcribed to mRNA, which is then translated to protein (Figure 13.2). The expressed proteins may affect the visible traits when observing the bacteria colonies. Recombinant plasmids and other forms of genetic engineering is possible because all living organisms use DNA as a platform to encode genetic information. Genes from different organisms can be expressed in other organisms like bacteria since they are encoded in DNA. The DNA instructions can be transferred, and other organisms can express foreign traits. Proteins have many different functions inside and cells. They are made up of smaller subunits, amino acids, which are encoded by DNA nucleotides. A specific three nucleotide sequence that codes for a single amino acid is called a codon. For example, the codon TTG codes for the amino acid tryptophan, whereas the codon AAG codes for the amino acid lysine. In many cases, more than one codon can encode the same amino acid. For example, AAA is also a codon for lysine. In addition, there are informational codons, such as the start codon (ATG) and the stop codon (TTA), which show where in the DNA sequence the code for the protein begins and ends. Transforming Bacteria with Plasmids In this laboratory experiment you will transform E. coli bacteria cells with plasmids. You will be using E. coli that has been made competent with a calcium chloride treatment, and form two different testing groups: a negative control cell group that does not have plasmids added to it, and the experimental group that has the plasmids added. After the cells are heat-shocked, they will be grown under various testing conditions: • The control group on nutrient agar (a type of growth media that bacteria thrive on). • The control group on nutrient agar with an antibiotic added. • The experimental group on nutrient agar. • The experimental group on nutrient agar with an antibiotic. • The experimental group on nutrient agar, antibiotic and an inducer (such as IPTG). By examining the growth of bacteria under these conditions, you can verify that your procedure worked, and you can identify the bacteria transformed with the added plasmid. How will you know if you are successful? In the examples for plasmids we have recommended for this exercise, the recombinant bacteria will have a new and highly visible trait: It will now produce colored protein, which makes the cells themselves colored! As the bacteria multiply on the media, they form visible collections of cells called colonies. Each colony represents the decedents of the original bacterial cell that landed on that spot on the medium and began to replicate. Thus colonies are clones (exact copies) of the cell that began the replication process. The relevant components of your plasmid are the gene for the colored protein, the inducible promoter, and the ampicillin resistance gene (ampR). The ampR gene confers resistance to the antibiotic ampicillin. (Biotechnologists call these genes selectable markers because only bacteria having the gene will survive in the presence of an antibiotic.) If the inducer is present in the bacteria, the promoter will be “turned on” so RNA polymerase can transcribe the gene of interest. This will allow protein to be produced. Prelab Questions Discuss the following amongst yourselves. Be ready to share your thoughts with the rest of the class. 1. Ampicillin is a derivative of the antibiotic penicilliin. It disrupts cell wall formation in bacterial cells which kills the cells. However, our recombinant plasmid contains a gene that provides antibiotic resistance by producing a protein that breaks down ampicillin. Why do we include ampicillin in the test medium? 2. What will happen if the transformed cells do not grow in the presence of the chemical inducer? 3. In the experiment, you will add the control and experimental groups of cells onto different media combinations. What do you predict for each condition? Fill in Table 1 by indicating if you predict growth or no growth, and if growth, will there be minimal growth or lots of growth. Read through the Procedures below and outline the steps, using words and a flowchart in your lab notebook. Table 1. Predictions for your experiment; transformation of E. coli Medium No plasmid control Treatment with plasmid Nutrient Agar Nutrient Agar + Ampicillin Nutrient Agar + Ampicillin + Inducer Transforming E. coli MATERIALS Reagents • Plasmid – in microfuge tube • Nutrient Broth (NB) – in microfuge tube • Competent E. coli cells (CC) – in microfuge tube (Always keep CC tube on ice) • 3 agar plates: Plate 1: NA Plate 2: NA/amp Plate 3: NA/amp/ind Supplies and Equipment • P-20 micropipette • P-200 micropipette • Pipette tip box (for P-20, P-200) • Microfuge tube rack • Two 1.5 mL microfuge tubes • Permanent marker • Disposable gloves • Crushed ice in a Styrofoam cup (fill cup first with ice before taking CC tube.) • Pack of cell spreaders (do not remove spreaders from pack until directed to do so) • Timer or clock • Floating microfuge tube rack • 42°C water bath • 37°C incubator • Tape • Waste container • Biohazard bag (for supplies that handle cells) SAFETY Check your protocol and follow all safety measures and wear proper attire prior to conducting the experiment. Practice aseptic technique while using E. coli or other live specimens in a laboratory setting. Aseptic technique is the practice of taking precautions to limit potential contamination to both the person performing the experiment, and to the sample/s. Please note the following: • Wear gloves when working with bacteria. • Avoid touching contaminated areas which includes anything that has touched bacteria. Notify your instructor ASAP if an accident takes place, such as a spill. • Put all supplies that have been exposed to bacteria into either a biohazard bag, or a designated biowaste container. These contaminated supplies may include pipette tips, cell spreaders, and microfuge tubes. • Keep agar plates closed at all times after removing them from the incubator. • Always wash your hands for 20 seconds with soap and water before leaving the lab. PROCEDURE 1. Make sure you have all the reagents in a tube rack. 2. Retrieve a chilled CC tube and put in the cup of crushed ice. Keep the competent cells cold at all times. Hold the tube by the rim, not the bottom. 3. Label the top and sides of two new microfuge tubes with “P-” and “P+”. 1. Put the P– and P+ tubes with the CC tube on ice. To ensure the best results possible, it is crucial that each step is followed exactly. Limit any possible contamination to the materials, yourself, and surroundings. 2. Add E. coli competent cells (CC tube) to both the P- and P+ tubes. 3. Take the P-200 pipette, set to 50 µL and put on a tip. 4. Holding the CC tube by the rim, gently resuspend the cells by slowly pumping between the first and no stop with the pipette (a gentle downward plunger motion to the first resistance point then a gentle upward motion to the top plunger position). 5. Add 50 µL of cells to the P+ tube and place the P+ tube on ice immediately. Discard the tip into the sharps container. 6. Grab a new pipette tip. Repeat for the P- tube. Discard the tip. Both P- and P+ tubes should be on ice and contain 50 µL of competent cells. 7. Add plasmid to the P+ tube only. 1. Take the P-20 pipette, set to 10 µL and put on a tip. 2. Remove 10 µL of the plasmid and add it to the P+ tube. Mix together by slowly pumping between the first and no stop 2-3 times then place the tube back on ice. 8. Put the P- and P+ tubes on ice for 15 minutes. 9. While the tubes are chilling, obtain your agar plates and marker. Do not open the plates during this step 1. Each agar plate contains different media- one of Nutrient Agar only (NA), one of Nutrient Agar + ampicillin (NA/AMP), and one of Nutrient Agar + ampicillin + inducer (NA/AMP/IND). These may be labeled with a stripe pattern or written on the plate 2. Do not open the plates. Turn every plate upside-down; the agar should be on top. Label the agar side with 1) date 2) group number 3) class period. Try to write small along the bottom edge of the plate. 3. Next, draw a line down the middle of the NA and NA/AMP plates. One half is labeled as “P-” and the other is “P+”. The NA/AMP/IND is only labeled “P+”. They should look similar to Fig 4 1. After the P- and P+ tubes have been on ice for 15 minutes, keep the tubes on ice and bring the ice cup over to the 42°C water bath. You will also need your timer/clock. Put both tubes into a floating microfuge tube rack, then place it into the water bath for precisely 45 seconds. 2. As soon as the 45 seconds pass, immediately put the tubes back into the ice cup and keep on ice for a minimum of 1 minute. 3. Add Nutrient Broth (NB) to the P- and P+ tubes. 1. Take the P-200 pipette, set to 150 µL and put on a tip. 2. Remove 150 µL of NB and add to the P- tube. Mix together by slowly pumping between the first and no stop with the pipette. Discard the tip into the biowaste container. 3. Get a new pipette tip. Repeat the same process for the P+ tube. 4. Keep the tubes at room temperature for 15 minutes. If you are running short on time, this step can be shortened. 5. Add cells from the P– tube onto your NA and NA/amp plates. Keep the plates right side up so the agar is on the bottom. You add cells to the surface of the agar (not the plastic lid). 1. Take the P-200 pipette, set to 50 µL and put on a tip 2. Take the P- tube. Slowly pump the pipette between the first and no stop with the pipette to resuspend the cells. Remove 50 µL of the cells. 3. Lift the lid of the NA plate like a “clamshell” to leave a large enough gap to deliver the cells, while lowering the risk of airborne contamination. Add the 50 µL of cells to the P- half of the plate. Close the plate and prepare to spread the cells. 4. Repeat this for the NA/AMP plate by resuspending the P- tube cells with the pipette and same tip. Add 50 µL of the cells to P- side of the NA/AMP plate using the clamshell method again. Discard the tip into the sharps container. 1. Spread the cells from the P– tube on your NA and NA/amp plates. You must spread your plates in this order. 1. Open the sterilized cell spreader package. Take a single spreader out and hold it only by the end you removed it by. Be careful not to touch the other end of the spreader to anything but the cells and agar. Close the package. 2. Using the “clamshell” method, open the NA lid and spread the cells on the P- half of the plate. Gently hold the spreader flat against the surface of the agar; treat it gently as if you were handling gelatin. Close the plate. 3. Repeat the same technique for the NA/AMP plate on the P- side using the same spreader. Once you are finished, discard the spreader into the designated biowaste container. 2. Add cells from the P+ tube to your NA, NA/amp, and NA/amp/ind plates: 1. Take the P-200 pipette, double check it is set to 50 µL and put on a tip. 2. Take the P+ tube. Slowly pump the pipette between the first and no stop with the pipette to resuspend the cells. Remove 50 µL of the cells. 3. Open the NA plate again like a clamshell to deliver 50 µL of cells to the P+ half of the plate. Close the plate. 4. Repeat this for the NA/AMP plate by resuspending the cells with the pipette and same tip. Add 50 µL of cells to the P+ half of the plate. Close the plate. 5. Repeat this for the NA/AMP/IND plate by resuspending the cells with the pipette and same tip. Add 50 µL of cells two times to the entire plate. There is a total of 100 µL of P+ cells added to the plate and must cover the entire surface when spread. Close the plate. 1. Spread the P+ cells on the NA, NA/AMP and NA/AMP/IND plates. You must spread your plates in this order. 1. Open the cell spreader package again and take out a single spreader, only touching the handle. Do Be careful to not touch the other end of the spreader to anything but the cells and agar. 2. Using the clamshell method, open the NA lid and spread the cells on the P+ half of the plate. Gently hold the spreader flat against the surface of the agar; treat it gently as if you were handling gelatin. Close the plate. 3. Using the same spreader, repeat the same technique for the NA/AMP plate on the P+ side . 4. Repeat the same technique for the NA/AMP/IND plate except the cells must be spread across the entire plate, not just one half. Rotate the plate gently to evenly disperse the cells with the spreader. Once you are finished, discard the spreader into the designated biowaste container. 2. Keep all plates right side up for 5 minutes until the liquid is fully absorbed into the plate. Stack the plates together and tape them, labeling the tape with your class period, group number and date. 3. Put the plates upside down (agar side on top) into the 37°C incubator to prevent condensation from forming and falling on the cells. 4. Put anything that touched the cells into the biohazard bag, including pipette tips, microfuge tubes and cell spreaders. Wipe down tabletops with disinfectants and wash hands. 5. Incubate the plates at 37°C for 24-36 hours and look for growth. Keep the plates closed. 6. Put the agar plates into the biohazard bag when told to do so. Analysis 1. Look at the results of your transformation. Fill out Table 2 with observations on whether you see growth or not on the different media. 2. Do your actual results match your predicted results? If not, what differences do you see and what are some explanations for these differences? 3. How many colored colonies were present on your NA/AMP/IND plate? Table 2. Transformation of E. coli Medium No plasmid control Treatment with plasmid Nutrient Agar Nutrient Agar + Ampicillin Nutrient Agar + Ampicillin + Inducer Study Questions 1. Why would colored colonies form on the NA/AMP/IND plate and not the NA/AMP plate? 2. What are some possible reasons for colored colonies to form on the NA/AMP plate? 3. Extrachromosomal DNA in bacteria, like a recombinant plasmid, can replicate within the cell without the rest of the cell’s DNA replicating. This can lead to multiple plasmids within a cell. Why is this important? 4. Previously, you learned about the interactions between DNA, RNA, proteins and traits. Explain how an inserted gene such as one in plasmid DNA, is expressed as a trait. 5. How can bacteria make proteins from foreign DNA, such as human insulin or a protein from a jellyfish like green fluorescent protein (GFP)? 6. What would happen if we grew the transformed bacteria in the presence of a different antibiotic such as kanamycin, instead of ampicillin?

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.13%3A_Transformation.txt

Learning Objectives Goals: • Explain the conditions for bacterial growth and relate it to the goal of collecting protein. • Explain what is meant by protein folding. • Describe the relationship between a protein’s conformation (three-dimensional shape) and function of the protein. • Use column chromatography to separate proteins. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Lyse bacterial cells to release protein. • Purify GFP via hydrophobic interaction column. • Identify the location of GFP throughout the purification process. Introduction Proteins are biological molecules made of chains of amino acids that take on a three-dimensional shape called a conformation. A specific conformation is achieved by folding of the amino acid chain in a way that the protein can perform a specific job or function for the cell. If the protein does not fold in the specific way, it cannot do the job it otherwise would. Proteins can be purified and used as therapeutic agents (drugs) to treat patients with specific conditions. Because purifying specific human proteins can be difficult or impossible from human or animal tissues, we can employ cells such as bacteria like E. coli to do the job. These cells are genetically engineered to make the proteins of interest in large amounts that are more easily purified. An example of a therapeutic protein is insulin, used to treat diabetes. This was the first genetically engineered protein to be introduced as a therapeutic agent. The gene for human insulin was engineered into a plasmid and this recombinant plasmid was introduced into E.coli. The bacterial cells made insulin which was purified to be used for treating diabetes. Similarly, green fluorescent protein (gfp) can be produced and purified. Prior to this lab, the gfp gene was introduced by the process of genetic engineering into a recombinant plasmid capable of allowing E. coli to produce protein from the genetic instructions. Producing protein from a gene is termed expression. This recombinant plasmid was introduced into E. coli using the process of transformation. This laboratory uses the process of obtaining purified green fluorescent protein to model how therapeutic proteins are purified for human treatments. You will be provided a culture of bacteria that have been grown and induced (stimulated) to produce gfp. You will treat the bacteria with a solution that will lyse (break open) the cells to release the protein. Then you will employ the process of column chromatography, the focus of this laboratory. Column chromatography is a method of allowing a solution to flow over a substance that will selectively bind and separate the components of the solution. In this case, tiny beads are packed into a tube-like column and the solution obtained through bacterial lysis is allowed to flow over the beads. As you pass other solutions over the column, you will be able to collect some of the solution flowing through the beads which will contain a much more concentrated and pure gfp. Growing Bacterial Cells The pattern of growth for bacterial cells is well understood. In the laboratory setting, the goal is to grow cells and have them produce the protein we are interested in purifying. When using optimal conditions to grow E. coli, four phases of growth will occur (see Figure 1) 1. During lag phase no cell division occurs. Cells are preparing to divide by making new enzymes and proteins as well as copies of their DNA. Cells enlarge. 2. In the log phase, a doubling of the population is occurring. This is termed logarithmic growth. Cells undergo binary fission (cells divide in half) approximately every 20 minutes for E. coli under optimal conditions. Other types of bacteria, and E. coli under less than ideal conditions, will divide at different rates. 3. The stationary phase occurs after the log phase when there is no overall change in the population size. During this period, cell division is equivalent to cell death and happens as resources such as nutrients and oxygen are depleted, and waste products are building up in the environment. 4. During the decline or death phase of a bacterial culture, cells are dying faster than they replicate. The cell population is decreasing. This occurs as waste builds further and the food supply is exhausted. CONSIDER: If the gene of interest is controlled by an operon, such as the lac operon, when is the best time to turn on the gene? Keep in mind: • Production of the protein takes energy away from the processes of cell growth and cell division. • A greater number of cells will produce more protein • Proteins can degrade over time Pre-lab Activity: Think Pair Share - Discuss What You Already Know Prior to the lab period you should read the material, take some notes on your thoughts on the following questions (Think). In lab, you will be asked to discuss with your partner your thoughts and hear theirs (Pair). Take additional notes on new insights during this small discussion. Finally, you may be asked to discuss your ideas with the class (Share). It is not expected that you know all the answers before the class discussion but by the end of the activity, you should have the questions answered completely and correctly. 1. What is the term for bacterial reproduction? Describe this process. 2. What roles do proteins play within cells? 3. What happens to protein function if a protein loses, or never correctly achieves, the prescribed conformation? 4. How does the order of amino acids relate to protein conformation and thus protein function? 5. Since we can control when to “turn on” or express our gene, when is the best time to do so? To help you decide ask yourself: 1. Would producing protein take energy? 2. Would a greater number of cells produce more of your protein of interest than fewer cells? 3. Can proteins degrade if left too long? 6. Compare your flow charts with each other prior to beginning lab. Note any differences and attempt to resolve which flow chart(s) has/have more accurate information. Adjust your own flow chart as necessary. Protein Purification Transformed bacteria can multiply in culture and produce the protein of interest. If this protein is to be used therapeutically, it will need to be purified. This means that other cellular components, including other proteins, must be separated from your protein. Column chromatography is a common method to separate proteins. Proteins are made of amino acids. Individual amino acids have different properties such as hydrophobicity (water-hating) or hydrophilicity (liking water), ionic charge, or the ability to form weak or strong bonds with other amino acids. When a protein is first made in a cell, it is a long chain of amino acids in an order determined by the gene. The order of the amino acids in a protein determines how the chain will fold to produce a three dimensional protein conformation (See Figure 2). This specific conformation will have different amino acids interacting with each other in specific ways. Amino acids facing the environment in a folded protein can interact with other molecules. Specific groups of amino acids near each other can form binding sites to interact with other specific molecules. Overall, these relationships determine protein structure and thus protein function. Imagine proteins involved in enzymatic reactions, as channels in membranes, in transporting other molecules, or for binding DNA. These proteins all have very specific binding interactions determined by amino acids in specific locations in a folded protein. QUESTION: If individual amino acids are swapped or deleted in an amino acid chain, do you imagine this would affect the function of a protein? The rules for protein folding are not perfectly understood and is an area of active scientific investigation. However, a few basic rules have been discovered. Factors that cause proteins to fold in specific ways include: 1. Weak bonds will form between amino acids with a negative and a positive charge. 2. Strong (covalent) bonds will form between sulfur-containing amino acids. These are called disulfide bridges. 3. Hydrophilic amino acids locate to the outer surfaces of proteins because they interact with the cell environment, which is mostly water. Hydrophobic amino acids hide on the inside of proteins or embed within cell membranes to avoid contact with the water in the environment. Depending on the content of amino acids in a specific protein, overall it will take on a hydrophobic or hydrophilic character. Column chromatography can separate hydrophilic and hydrophobic proteins from the rest of the cell contents. Small beads coated with a material called a resin are packed into a column. The resin attracts proteins which will bind to the resin as other cell contents flow past. For hydrophobic proteins to stick, they must be treated to expose the typically buried hydrophobic amino acids. Buffer solutions can be used to cause proteins to denature (unfold) and expose the amino acids that will be attracted to the resin. Different buffers are passed over the column in an order determined to best separate the proteins of interest from the rest of the cell contents. Figure 14.4 shows three solutions used to separate green fluorescent protein from the rest of the cell. The binding buffer denatures proteins so that the hydrophobic amino acids stick to the resin. The wash buffer removes loosely adherent proteins and material from the column leaving the more strongly attached protein of interest. Finally, the elution buffer, which has a low buffer concentration, causes the protein to begin to refold to hide the hydrophobic amino acids which releases the protein from the resin coated beads in the column. The portion or fraction of fluid exiting the column that contains your protein can be captured in a container and saved. QUESTION: Do you believe that all types of protein would use the same types of resin-coated beads and the same types of buffers to become purified? Explain your answer. Part I: Lysis of Bacterial Cells Previously, bacteria were transformed with a recombinant plasmid capable of expressing gfp when cells were induced. The reason the cells can be induced to produce protein is that within the plasmid, in front of the gene for gfp, there is a special sequence of DNA that will respond if a chemical is placed in the media. This chemical is called an inducer (ind) and signals that the gene should be “turned on” and messenger RNA should be transcribed from the DNA instructions and the protein should be produced. The plasmid also contains the selectable ampicillin (amp) resistance gene to ensure that the cells growing in your culture are cells that contain your plasmid. Prior to this lab period, cells were grown in the presence of ampicillin until late in log phase. The cells in culture divide and each cell contains many copies of the plasmid. At late log phase, the chemical inducer was added to the medium to turn on the gfp gene and the cells were allowed to continue to grow and produce gfp. First, you will collect your cells and break them open. This process is called cell lysis. After the cells are lysed, you will use column chromatography to purify gfp. MATERIALS Reagents • Microfuge tube rack with the following tubes: • LB/amp/ind culture of E. coli cells (EC) • Elution buffer (EB) • Lysis buffer (LyB) • Extra 1mL of the EC culture – from the instructor Equipment and Supplies • P-200 micropipette • Pipette tip box • Permanent marker • Microcentrifuge (shared with class) • Vortex mixer (shared with class) • Long wave UV light • Liquid waste container • Sharps container • Biohazard bag for materials that come into contact with E. coli cells (shared with class) Safety Reminders Appropriate safety precautions should be used at all times. These will be reviewed by your instructor and can be found in the beginning of your laboratory manual which you should refer to before you begin this procedure. Aseptic technique is required when handling E.coli and materials that have come in contact with the bacterial culture. Remember that aseptic technique are the procedures used to protect your culture and samples from contamination but also protect you. 1. Disinfect your work area and wash your hands before beginning an experiment. 2. Never touch anything that has come in contact with the E.coli. This includes pipettes, spreaders, and the interior of tubes. Pipet tips should never touch anything except the material to be transferred. Spreaders and pipettes should only be handled from the end that will not touch bacteria. 3. When handling petri dishes, only open the lid enough to work with the agar surface and then close the lid immediately. This will avoid contamination, such as fungal spores from the air, landing on your agar plate. 4. If something becomes accidentally contaminated, speak to your instructor to inquire if a replacement is appropriate and available. 5. Avoid spills. If one occurs, notify your instructor immediately for help in cleaning it appropriately. 6. Contaminated waste such as used microfuge tubes and cell spreaders will be placed in the biohazard bag. Pipet tips will be placed in a sharps container. 7. Only when directed to do so will you dispose of your used petri dishes in the biohazardous waste. 8. Be sure to clean your work area and wash your hands before exiting the lab. Procedures 1. Take a long wave UV light and look at the EC tube, record your observations. 2. Weigh your EC tube. Look for another tube with a similar weight; +/- 0.1g or create a balance tube for the microcentrifuge. 3. Spin the EC tube for 5 minutes at 13,000 rpm (or as high speed as possible) in a microcentrifuge. Make sure to balance the tubes correctly. 4. Very carefully take out the EC tube from the microcentrifuge. Avoid disturbing the cell pellet at the bottom of the tube. 5. Take the P-200 micropipette, set it to 200.0 µL and get a tip. Press to the first stop before going into the supernatant (liquid layer) and gently pull out the old liquid growth media. Do not disturb the cell pellet when doing so. 6. Discard the liquid into the liquid waste container, and the tip in sharps container. 7. Bring your cell pellet (the EC tube) to your instructor to dispense 1 ml of the same culture into your tube. 8. Repeat steps 2-6, so spin down the cells for 5 min again and remove the supernatant. Record the color of the supernatant and pellet at this step. 9. Take the P-200 micropipette and a new tip and carefully try to fully remove all the liquid from the pellet without taking up the cells. Discard the tip in sharps. 10. Set the P-200 to 150.0 µL and get a new tip. Add 150 µL of elution buffer (EB) to the EC tube. Discard the tip. 11. Firmly close the EC tube and resuspend the cell pellet with a vortexer. If one is unavailable, drag the tube quickly across an empty microfuge tube rack. This should cause the cell pellet to dislodge from the bottom of the tube and the buffer should become turbid. Repeat this movement until the entire pellet is gone. 12. Take the P-200 and get a new tip. Add 150 µL of lysis buffer (LyB) to the EC tube. Mix the tube contents with a vortexer or the microfuge tube rack method like previously. 13. The EC tube will incubate in the lysis buffer overnight at room temperature. Label your tube with class period and group number and give to your instructor to do this step. 14. Clean your work area and discard all contaminated tubes and tips into the appropriate biohazardous waste. Part II: Using Column Chromatography to Separate the Green Fluorescent Protein Materials Reagents • Microfuge tube rack with the EC tube that contains cells, elution buffer, and lysis buffer • Bottles of: • Binding buffer (BB) = 4.0 M Ammonium sulfate solution • Equilibration buffer (EQ) = 2.0 M Ammonium sulfate solution • Wash buffer (WB) = 1.3 M Ammonium sulfate solution • Elution buffer (EB) = 10 mM Tris, 1 mM EDTA, pH 8.0 solution • 20% Ethanol solution (For cleaning and storing resin in columns at the end of lab) Equipment and Supplies • P-1000 micropipette • Pipette tip box • 2-3, 1.5 mL microfuge tubes • Chromatography column • Microcentrifuge (shared) • Liquid waste container • Biohazardous waste container • Sharps container Procedure 1. Divide the work by assigning one person to do step 2-3, another 4-5, and a third do 6-7. 2. Verify that you have all the necessary materials. 3. Label one microfuge tube as “SUPER” and another as “GFP”. 4. Set up your column as directed, always maintain it in an upright position. Do not ever allow the column resin to go completely dry. 5. To set up the column: • Take off the caps at the top and bottom of the column. Do not confuse the bottom cap with the stopcock. • Place the column liquid waste container at the base of the column. • Turn the stopcock valve to a vertical position and drain the column until 1-2mm of liquid remains above the column resin. Turn the stopcock to a horizontal position to close the valve. • Take the P-1000 micropipette, attach a tip, and set to 1000 µL. Add 1000 µL of equilibration buffer (EQ) gently down the side of the column, trying to disturb the resin bed as little as possible. • Drain the column until 1-2mm of liquid remains above the column resin then close the valve. • Using the same tip, add another 1000 µL of equilibration buffer (EQ) gently down the side of the column, trying to disturb the resin bed as little as possible. Discard the tip afterwards. • Drain the column until 1-2mm of liquid remains above the column resin then close the valve. • Double check that the liquid stopped draining when the valve is closed. 1. Weigh the EC tube, find a balance tube, and spin the tube down for 5 min at 13,000 rpm (or the highest speed) in a microcentrifuge. Be sure to balance the microcentrifuge. 2. Carefully remove the tube and bring it back to your workspace. Record your observations when using a long wave UV light to examine the tube. What do you observe regarding the pellet and supernatant? 3. Take the P-1000 micropipette, set to 250 µL and get a tip. Very carefully, try to remove as much of the supernatant and transfer into the labeled “SUPER” tube. If the pellet is disturbed during this step, spin down the tube again and repeat this step. Discard the empty tip in sharps. 4. Get a new tip and add 250 µL of binding buffer (BB) to the SUPER tube. Gently pipette up and down two times to mix the solution. There should be approximately 500 µL of liquid total now. 5. With the same tip, add 200 µL of the SUPER tube solution to the column two times. The entire contents of the SUPER tube should be added to the column. Slowly drip the solution down the sides of the column, so the resin bed is disturbed as little as possible. Discard the tip in sharps. 6. Turn the stopcock valve and drain the liquid from the column until there is 1-2 mm of liquid above the resin. 7. Use the long wave UV light to examine the column and record your results. Where is the green fluorescent protein located in this step? 8. Take the P-1000 micropipette and set it to 1000 µL and get a new tip. Add 1000 µL of wash buffer (WB) gently down the side of the column, again trying to disturb the resin bed as little as possible. Discard the tip in sharps. 9. Drain the wash buffer until there is 1-2 mm of liquid above the resin. 10. Use the long wave UV light to examine the column and record your results. Where is the green fluorescent protein located in this step? 11. With a new tip for the P-1000 pipette, add 1000 µL of elution buffer two times to the column (a total of 2 mL of elution buffer). Slowly add the buffer down the sides of the column. Discard the tip in sharps. 12. Hold your “GFP” tube under the column stopcock. Another person should shine the UV light on the column so GFP can be located. Open the stopcock and collect the GFP into the GFP tube. OPTIONAL: For this step, if you have an extra microfuge tube, you can collect the fainter fluorescent liquid in one and the stronger glow in another to concentrate the GFP. 13. Once the GFP is mostly collected, drain the column into the waste container until 1-2 mm of liquid is above the resin. 14. With a new tip, add 1000 µL of storage solution- 20% ethanol three times down the side of the column. 15. Drain the column until there is 1 cm of liquid above the resin bed. 16. Put the caps back onto the top and bottom of the column for storage. 17. Dispose of the column flow through waste container by pouring the contents down the drain in the sink. Data Analysis While under the UV light, compare your GFP tube with GFP tubes from other groups. Record any observed differences in the color intensity in your lab book. Study Questions 1. What characteristics of amino acids are important for protein conformation? 2. How is protein conformation related to protein function? 3. Did you notice if your lysed cell solution looked more or less bright than the fraction you collected from the column? If you observed a difference, why might that be the case? 4. Why are you able to use the column to separate your green fluorescent protein from the other cellular components? 5. For this procedure, what could be adjusted to increase purity of your protein in the sample?

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.14%3A_Column_Chromatography.txt

Learning Objectives Goals: • Prepare protein samples from transformed bacterial cells and perform a PAGE. • Analyze PAGE products and identify proteins by molecular weight. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Explain how SDS-PAGE works. • Run and analyze the results of a SDS-PAGE. Introduction Polyacrylamide Gel Electrophoresis Polyacrylamide gel electrophoresis (PAGE) is probably the most common analytical technique used to separate and characterize proteins. A solution of acrylamide and bisacrylamide is polymerized. Acrylamide alone forms linear polymers. The bisacrylamide introduces crosslinks between polyacrylamide chains. The 'pore size' is determined by the ratio of acrylamide to bisacrylamide, and by the concentration of acrylamide. A high ratio of bisacrylamide to acrylamide and a high acrylamide concentration cause low electrophoretic mobility. Polymerization of acrylamide and bisacrylamide monomers is induced by ammonium persulfate (APS), which spontaneously decomposes to form free radicals. TEMED, a free radical stabilizer, is generally included to promote polymerization. The gels are usually prepared with the top portion of the gel under the sample wells made less dense than the remainder of the gel below that is intentionally made denser. The top portion is referred to as the “stacking gel” and the lower portion is termed the “running gel” or “separating gel”. The purpose of the stacking gel is to concentrate all of the different sized proteins into a compact horizontal zone by sandwiching them between a gradient of glycine molecules above and chloride ions below. This way most of the proteins will enter the denser resolving gel simultaneously before they begin to migrate downwards at different rates based on their size. This way, the bands are much clearer and better separated for visualization and analysis. Without the stacking gel, the proteins will produce a long smear through the resolving gel instead of tight distinct bands for us to analyze. SDS-PAGE Sodium dodecyl sulfate (SDS) is an amphipathic detergent. It has an anionic head group and a lipophilic tail. It binds non-covalently to proteins, where roughly one SDS molecule is attracted to every two amino acids. SDS causes proteins to denature and disassociate from each other (excluding covalent cross-linking) and essentially unravel into linear molecules. It also confers negative charge. In the presence of SDS, the intrinsic charge of a protein is masked. During SDS-PAGE, all proteins migrate towards the anode (the positively charged electrode). SDS-treated proteins have very similar charge-to-mass ratios, and similar shapes. During PAGE, the rate of migration of SDS-treated proteins is effectively determined by their unfolded length, which is related to their molecular weight. Part I: SDS-PAGE Materials • Vertical gel electrophoresis chambers and gel cassette assembly (Bio-Rad Mini PROTEAN) • Tris/Glycine/SDS Running Buffer • Power supply • Bio-Rad 10% precast polyacrylamide Mini PROTEAN TGX stain-free gels (8.6 X 6.7 cm) • Gel loading guide • Micropipettes with gel loading tips • Protein samples • Bio-Rad 2X Laemmli Sample Buffer (contains SDS and either sucrose or glycerol) and 2-Mercaptoethanol (reduces disulfide bonds, disrupts protein cross-links) and loading dye • Prestained protein molecular weight standards (already prepared in sample buffer) Procedure Sample Preparation 1. Be sure to wear gloves. 2. Prepare a hot water bath (100°C). Place some water in a 600 mL or larger beaker and microwave or leave on a hot plate to boil. (This can take 15 minutes or more.) 3. Combine 10 µL of each protein sample with 20 µL of Laemmli sample buffer/Loading Dye in labeled screw-top microcentrifuge tubes. 4. Boil the samples for no more than 5 minutes to fully denature the proteins. 5. After boiling, leave the sample tubes at room temperature until ready to load onto the gel. Preparation of the Gel and Electrophoresis Chamber 1. Be sure to wear gloves. 2. Remove the pre-cast gel from the packaging. Carefully remove the green strip from the bottom of the gel. 3. Open the two green side clamps on the vertical gel cassette assembly. 4. Place the pre-cast gel on one side of the cassette and use the clear buffer dam on the other side of the cassette. Then carefully close the green side clamps. 5. Insert the cassette into the vertical gel chamber matching the color of the electrodes (red and black) with the color guides at the sides of the chamber. 6. Fill the inside of the cassette with 1X Tris Glycine SDS PAGE buffer until the wells are submerged. 7. Fill the bottom of the vertical gel chamber with 1X Tris Glycine SDS PAGE buffer up to the mark on the side for 1 to 2 gels. Loading the samples into the Gel 1. Place the yellow gel loading guide on the top of the cassette. 2. Using gel loading tips, micropipette 10 µL of prepared protein MW standard into the first (#1), fifth (#5) and last (#10) lanes 3. Using gel loading tips, micropipette 10 µL of each protein sample into each of the remaining wells (2-4; 6-9) of the gel. Note which sample is in which lane in your notebook. Electrophoresis 1. Place the lid on the vertical gel chamber 2. Insert the red and black wires into the correct matching colored terminals on the power supply 3. Plug in the power supply and turn on the power switch 4. Select “Constant Voltage” and then adjust the voltage to 300 volts 5. Press the run button 6. Set a timer for 10 minutes 7. If the smallest band of the protein marker has traveled down to 1 cm from the bottom edge of the gel, turn off the power and stop the run, otherwise continue the run until this is the case 8. Unplug the power supply and wires from gel chamber 9. Disassemble gel chamber and carefully remove gel 10. Pour used buffer into a used buffer container – Do not pour down the sink! 11. The gel can now be imaged on a gel documentation camera system or it has to go through stain/destain. Study Questions 1. What is SDS and why is it added to a protein sample prior to running a PAGE? 2. Why is the protein heated for 5 minutes before being loaded into a gel? 3. Which electrode does a protein run toward in a SDS-PAGE and why? 4. What is the difference between a stacking gel and a separating gel? 5. Given a gel, be able to analyze it using the molecular weight standard?

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.15%3A_SDS-PAGE.txt

Learning Objectives Goals: • To understand basic PCR and gel electrophoresis • To understand basic DNA mutation detection • To learn how restriction enzymes are incorporated in biotechnology Student Learning Outcomes: Upon completion of this lab, students will be able to: • Understand SNPs • Know how to perform a DNA extraction, PCR, and restriction digest • Know how to interpret a DNA gel after electrophoresis Introduction Every organism on Earth has a different way to perceive the world due to their individual life experiences as well as their genetic make-up. Humans are no different; every individual has their own experiences that shapes their world perception but so too does their DNA. You may be surprised to learn that, 99.9% of the human genome is identical from one individual to the next, and it is the 0.1% difference that makes each individual unique. Some of these differences can affect our sensory systems and how we perceive the natural world. For example, over time we have learned which things taste good and are good for us while simultaneously learning which things taste bad or are bad for us. Specifically, bitter compounds are closely associated to toxic substances in nature. The way we know things taste bitter, or any other flavor for that matter, is because we have special chemical receptors in our mouth and nose that bind molecules in our food and send signals to the brain telling it what the food tastes like. One type of bitter receptor in our mouth senses the presence of a chemical called phenylthiocabamide, or PTC. PTC is a non-toxic chemical but it very closely resembles toxic compounds often found in food. The unique thing about PTC is that not everyone can taste it! We first learned this in the 1920s when Arthur L. Fox and C. R. Noller were working with PTC powder and Noller complained about the extremely bitter taste while Fox tasted nothing at all. This lead to experimentation where scientists ultimately discovered the ability to taste PTC was hereditary; it was in our DNA! Before we talk about the genetics of PTC tasting, we first need to understand some terminology. The observable trait, such as the ability to taste PTC, is called a phenotype. The genetic information that codes for that phenotype is called a genotype. The genes that make up a genotype come from the parents in the form of alleles; one allele from the mother and one allele from the father. The two copies can be the same allele, homozygous, or the two copies can be different, heterozygous. The ability to taste PTC comes from the gene TAS2R38 which encodes one of the chemical receptors in our mouth that binds to PTC. By comparing PTC tasters to non-tasters, scientists have found three single nucleotide polymorphisms (SNPs) that differentiate the taster allele (T) from the non-taste allele (t). A SNP is a genetic mutation where one nucleotide in DNA is different from one individual to the next. The word mutation sounds scary but a mutation is not always bad; there are nearly 10 million SNPs in humans which means SNPs are common. The three SNPs (see table 1) found in the TAS2R38 gene leads to changes in the amino acid sequence which can potentially change the proteins function. Table 1. SNPs Present in Tasters vs Non-Tasters for PTC Nucleotide position (bp) Nucleotide Change Codon Change Amino Acid Change phenotype Non-Taster Taster Non-taster Taster Non-taster Taster 145 G C GCA CCA Alanine Proline 785 T C GTT GCT Valine Alanine 886 A G ATC GTC Isoleucine Valine Before you figure out your tasting ability, lets first understand the genetics of the alleles. Individuals who are tasters can be TT (homozygous dominant) or Tt (heterozygous). Individuals who are non-tasters will always be tt (homozygous recessive). To understand how the genes are inherited, examine table 2 below where the potential offspring of two heterozygous parents are analyzed. There is a 75% chance of having children that are tasters for PTC and a 25% chance of having children that are non-tasters. Table 2. Sample Inheritance Pattern for PTC Tasting Parent Alleles T t T TT (homozygous taster) Tt (heterozygous taster) t Tt (heterozygous taster) tt (homozygous non-taster) We will figure out your genotype today using three very commonly used assays in the field of biotechnology. The first is polymerase chain reaction (PCR) which is used to selectively amplify a specific region of DNA of interest. PCR allows us to take one or two copies of DNA and make millions of them making it easier for us to analyze the results. Then we will perform a restriction digest with restriction enzymes. Restriction enzymes are like “molecular scissors” because they cut DNA at specific nucleotide sequences called recognition sites. For this lab, you will be using the restriction enzyme called HaeIII, which recognizes the sequence GGCC. When HaeIII comes across the recognition sequence, the enzyme will cut the DNA between G and C nucleotides producing two different size DNA strands. In order to visualize the DNA, we will run gel electrophoresis, our third assay, which allows us to separate DNA molecules based on their size. See Figure 2 below for the expected results. Part I: Day 1 Materials Reagents • PTC and control paper strips • 2 Small microcentrifuge/PCR tubes • 0.9% saline solution • Extraction solution • Taq master mix • Primer mix Equipment • P-20 and P-200 micropipettes and disposable tips • Microcentrifuge • Thermocycler • Ice bucket • Freezer -20oC • BioWaste container (for saliva, tips, test strips, PCR tubes) • Rack for PCR tubes (microtiter plate or empty p_200 tip boxworks as susbstitute) Procedure (per manufacturer guidelines) 1. Place one strip of PTC paper on the tip of your tongue and record whether it taste bitter or not. Discard the used PTC paper in biological waste • Bitter • Not Bitter 2. Tally the students in the class to determine the number of tasters and non-tasters and place that information in the box below: Table 3. Class Data Phenotypes Number of Students % Total PTC Taster PTC Non-taster Total 1. Label 2 PCR tubes and a cup of saline solution with your own identifier/initials. 2. Pour the 0.9% saline solution into your mouth and swish vigorously for 2 minutes to dislodge the cells in your mouth. This is where the DNA will be coming from in our experiment. 3. Pipette 200µL of your saliva/saline mix into one of the labeled PCR tubes and close the PCR tube tightly. 4. Centrifuge the PCR tube containing the saliva/saline at 8,000RPM for 3 minutes. (Be sure to counterbalance the tubes). 5. Look for the white cell pellet at the bottom of the tube. Carefully remove the supernantant using a micropipette (do not disturb the pellet) and discard into a biological waste container. Be careful not to disturb the cell pellet! 6. Add 50µl of the extraction solution to the PCR tube with the cell pellet. Resuspend the cells by mixing using the micropipette and continue to do so until the cell pellet is broken up and there are no longer large clumps of cells. 7. You need to incubate your tube at 95°C for 5 minutes to break open the cells and release the DNA into solution, followed by cooling it until ready to use. You can place a tube on ice to chill it. If using the MiniOne system, place the tube in the PCR machine. Using the mobile device with MiniOne PCR mobile app, program the PCR machine using the constant temperature mode to incubate the samples at 95°C for 5 minutes. Enter 4°C for final incubation temperature. This will keep your samples cold until you are able to pick them up. (Table 4) Table 4 Cell Lysis Program Step Duration Temperature Cell Lysis 5 mins 95⁰C Final Incubation 4⁰C 8. Retrieve PCR tubes and centrifuge for 1 minute at 8,000 RPM to collect cell debris at the bottom of the tube. Your DNA will now be found in the supernatant of the tube. 9. Without disturbing the pellet at the bottom, carefully pipette 5µL of the DNA containing supernatant into your 2nd labeled PCR tube. 10. To your PCR tube containing DNA, add 10µL of Taq Master Mix and 5µL primer mix. Make sure to avoid placing a bubble at the bottom of the PCR tube as this can affect the PCR reaction. 11. Cap the tube tightly, gently flick tube to mix, then centrifuge for 15 second at 8,000RPM to bring all the liquid to the bottom of the tube. 12. Place the PCR tube in the thermocycler. When all samples are loaded, close the lid and follow instructor’s direction to set up the PCR protocol as seen in Table 16.5. 13. Once the protocol is complete, remove your sample from the thermocycler and place at -20⁰C until next class period. Table 5. PCR Program (optimized for MiniOne PCR System)* Step Duration Temperature Cycles Initial Denaturation 30 sec 94⁰C Denaturation 5 sec 94⁰C 30 Cycles Annealing 10 sec 66⁰C Extension 15 sec 66⁰C Final Incubation 4⁰C Part II: Day 2 MATERIALS Reagents • Stored frozen sample from previous period • New PCR tube • HaeIII restriction enzyme • Dilution buffer • Agarose gel with Gel Green • Loading dye • Running buffer (TBE) • DNA marker Equipment • Water bath or programed thermocycler • Gel casting tray and comb • Gel electrophoresis unit • Microcentrifuge • Blue light box • Photo documentation equipment Procedure 1. Obtain your PCR tube from the previous lab session 2. Split your reaction into two by pipetting 10µL of your PCR product into a clean PCR tube. Label one “U” for undigested and the other “D” for digested. 3. Add 5µL of HaeIII restriction enzyme to the “D” tube and 5µL enzyme dilution buffer to the “U” tube. Cap the tubes and gently flick with your fingers to mix. Centrifuge your tubes for 15 seconds at 8,000 RPM to collect all liquid to the bottom of the tube. 4. Place your tubes in a suitable water bath or thermocycler using the settings in Table 5. When using the MiniOne PCR System, set up the incubation for the restriction digest at 37⁰C for 15 minutes using the constant temperature mode. Enter 4⁰C for the final incubation. (See table 6) Table 6. HaeIII Digest Program Step Duration Temperature HaeIII Incubation 15 mins 37⁰C Final Incubation 4⁰C 5. While you wait for your digest, prepare an agarose gel. You will need a dye such as gel green included to visualize DNA in the gel. Lab 11 has more detailed instructions if you are not using the kit. For the MiniOne kit, the gel green is included in a premeasured amount of agarose. Poke a small hole in the plastic on top of the gel cup to allow for steam to escape. Microwave gels for 20 second increments until the gel is completely dissolved and in a liquid state. Pour your gel in the casting tray using the 9-well side of the comb. Allow your gel to solidify (it will be somewhat opaque when dry). 6. When incubation is complete, retrieve your samples. Add 3µL of loading dye to each of your tubes containing DNA. Cap your tube and flick gently to mix reagents. Centrifuge your tubes for 15 seconds at 8,000RPM to bring liquid down to the bottom of the tube. 7. Obtain your electrophoresis unit. For the MiniOne Gel Tank, ensure the black platform is in the tank to aid in visualization. Place your gel in the tank and ensure the wells are on the negative end of the gel box. 8. Pour TBE running buffer into the tank and ensure the gel is completely submerged by the buffer. Incomplete submersion of gel will lead to pour results in the gel electrophoresis. 9. Turn on the low intensity blue light and load 10 μL of your undigested sample and 10 μL of your undigested sample into two adjacent wells of the gel. Make sure your group also loads a DNA marker into one of the wells. Your group may use 10 μL of the MiniOne® DNA Marker. Use table 6 below to keep track of which samples are loaded into which wells. Table 7. Loaded Samples Well 1 2 3 4 5 6 7 8 9 Sample 10. Turn on the MiniOne Electrophoresis System by placing the orange cover onto machine and pressing the power button. The green light should turn on and small bubbles should be visible in the buffer solution. Run samples for 20 minutes to allow proper separation of bands. If using a different electrophoresis system run the gel at 135V until the bands separate sufficiently and the dye front has traveled about 70% down the gel. 11. At the end of the run, turn on the high intensity blue light and use your phone, camera, or gel documentation system to take a picture of the gel. The blue light make the gel green that is incorporated into the DNA molecules fluoresce so they can be visualized. 12. Analyze the gel based on the information provided in the introduction of this lab. 13. Dispose of your gel and TBE buffer according to instructor instructions. Study Questions 1. If someone can taste PTC, what is/are their possible genotype(s)? 2. If someone is homozygous for a trait versus heterozygous, when comparing their results on gel electrophoresis, what differences, if any, do you expect to see. 3. When you used PCR to amplify the TAS2R38 gene, what component of the reaction makes it specific for that gene in your genome and not another gene? 4. Restriction enzymes recognize very specific sequences in the DNA. They read the same forward and reverse. What are these types of sequences called? 5. If you did not see any bands in your reaction after electrophoresis, what might have gone wrong? List two possible reasons for this result. 6. After comparing your bands to those of the marker DNA bands, did your bands and those of your classmates match the expected size bands? 7. Do your results in the DNA band analysis match your phenotype as a taster or non-taster based on the paper taste? What did you expect to see for the different phenotypes in the class? Attributions This lab is licensed as CC BY-NC-SA. The title, figure 2 and procedure are taken from the lab developed by Embi Tec and used with permission.

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.16%3A_A_Taste_of_Genetics_-_PTC_Taster.txt

Learning Objectives Goals: • Demonstrate the power of an ELISA as a biomedical diagnostic tool. • Perform an ELISA. • Analyze the results of the ELISA and present a diagnosis based on the results. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Describe how an ELISA works. • Given a set of data, interpret the results of the ELISA. Introduction ELISA (Enzyme-Linked ImmunoSorbent Assay) is an immunologic technique used to detect the presence and concentration of an antigen or antibody in a sample. The power of an ELISA is based on the extreme specificity of the antigen-antibody interaction. ELISAs have wide-ranging applications, especially as medical diagnostic tools. This lab is a simulation of an ELISA performed on patients to determine if they may have been exposed to the HIV virus. Patients exposed to the virus (foreign antigen) will develop antibodies to the HIV virus, and the antibodies circulate in the bloodstream. By testing the patient blood samples, the presence or absence of these antibodies can be measured using the ELISA. In the ELISA conducted for this lab, the antigen (from HIV virus) is adsorbed to the surface of the plastic wells (on the 8-well strip or 96-well plate). Patient blood serum samples (which may contain antibodies to the antigen) are added. If antibodies are present, then antigen-antibody complexes form (ImmunoSorbent Process). The detection of these complexes is accomplished by the addition of a secondary antibody that detects all human antibodies. For easier detection, the secondary antibody has been covalently linked to an enzyme. When the enzyme binds to its substrate, a reaction occurs to create a colored product. In summary, for patients with HIV, the antibodies in their blood bind to the HIV antigen, the secondary antibody will bind to the human antibodies, and the enzyme will produce a colored product that is easy to visualize. For patients that do not have antibodies to the HIV antigen, no antibodies bind in the first stage and no colored product is produced in the end. Clinical Application Scenario: You work in a clinic and two patients come in who have had possible exposure to HIV. ELISA is the first screening method for HIV antibodies because it uses less costly materials and machinery than other diagnostic procedures (i.e. Western Blot or PCR). You take a blood sample and centrifuge it to separate the blood serum from the red blood cells and will now be performing an ELISA, testing the serum for the presence of HIV antibodies. Materials Reagents Samples in Microfuge tubes • (GREEN) – Positive Control: Serum with Antibodies to HIV antigen • (YELLOW) – Negative Control: Serum with no Antibodies to HIV antigen • (PINK) – Patient A’s Blood Serum (potential primary antibody) • (BLUE) – Patient B’s Blood Serum (potential primary antibody) • (CLEAR) – Secondary Antibody: Anti-Human Immunoglobulin linked to an enzyme • (AMBER) – Substrate: • Tetramethylbenzidine (TMB) chromogenic substrate • 0.25M sulfuric acid (optional) Equipment • HIV protein-coated 8-well ELISA strips (antigen) • P200 micropipette • Box of P200 pipette tips • Microcentrifuge tube rack with samples • Squirt bottles with PBS Wash Buffer • Waste bucket for tips • Pan for washing strips • Paper towels • Microtiter plate reader with 450nm filter (optional) Procedure Step 1: Coat Antigen to Plate (Inactivated HIV Proteins) *This step has been completed for you* 1. 200-μL Inactivated HIV Proteins (antigens) were added to each well of the 8-well ELISA strip 2. The strip was covered with plastic wrap and incubated at room temperature for 1 hour. Step 2: Block Non-specific Binding of Antibodies *This step has been completed for you* 1. The contents of the 8-well strip were emptied by turning upside-down and flicking until no more liquid was present. 2. Blocking Solution was added to each well. This step will prevent non-specific binding of the antibodies. Step 3: Add the Sample (with possible Primary Antibody) Begin the experiment here: Your antigen-coated ELISA strip is now ready for you to add the samples* Note IMPORTANT: Before adding the samples, mix the solutions by inverting the tubes. Remember to change pipette tips between each solution. 1. Mark one side of the strip with a lab marker to keep it oriented during the procedure. 2. Add 100-μL of Positive Control (GREEN tube) to wells 1 & 2. 3. Add 100-μL of Negative Control (YELLOW tube) to wells 3 & 4. 4. Add 100-μL of Patient A’s Blood Serum (PINK tube) to wells 5 & 6. 5. Add 100-μL of Patient B’s Blood Serum (BLUE tube) to wells 7 & 8. 6. Let sit for at least 5 minutes. 7. Empty the contents of the 8-well strip by turning upside-down and flicking until no more liquid leaves the strip. Blot gently on paper towel to remove any remaining liquid. 8. Wash. Fill wells to the top with PBS Buffer. Empty the contents as above. 9. Repeat this wash step 3 more times. Step 4: Add the Secondary Antibody 1. Add 100-μL Secondary Antibody (CLEAR tube) to all wells. Let sit for 5 minutes. 2. Empty the contents of the 8-well strip by turning upside-down and flicking until no more liquid leaves the strip. Blot on a paper towel before washing. 3. Wash. Fill wells to the top with Buffer. Empty the strip and blot on paper towels. 4. Repeat this wash step 3 more times. Step 5: Detect Presence of Antigen-Antibody Reaction 1. Add 100-μL Substrate (AMBER tube) to all wells. After a few minutes, some wells may begin to change color. A color change to blue indicates the presence of the antigen-antibody complex. The more antibody bound to antigen, the bluer the solution will be. 2. Fill in the presence of color in the chart below and answer the questions on the results page. Step 6: (optional) Stop the Enzymatic Reaction and Read the Well on a Microtiter Plate Reader 1.      Add 100μL 0.25M sulfuric acid (color will turn from blue to yellow) 2.      Place your strip into the plastic frame carefully and read the absorbance (optical density) set to 450nm on the microtiter plate reader Results Using the following color key, record your results in the table below: 0 = no color + = very light blue (or yellow) ++ = light blue (or yellow) +++ = dark blue (or yellow) Data Table 1. Presence of Antigen-Antibody Complex Well # 1 2 3 4 5 6 7 8 Sample Added Color Absorbance (optional) Data Analysis 1. Did your positive control exhibit color change? If not, how could this have occurred? 2. Did your negative control remain clear? If not, how could this have occurred? 3. Compare patient A to the positive and negative control. What can you deduce about patient A’s condition? 4. Compare patient B to the positive and negative control. What can you deduce about patient B’s condition? Study Questions 1. Describe an ELISA assay. 2. Draw the Positive Control Well after Step 2. 3. Draw and label a diagram of the positive control well at the end of the procedure. What color is the product? 4. Draw the Negative Control Well at the End of the procedure. Attribution Adapted from Lab 17 ELISA by Sandra Slivka, PhD, Southern California Biotech Center, San Diego Miramar College, CA. Licensed CC-BY-NC-SA 4.0

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.17%3A_ELISA.txt

Learning Objectives Goals: • Perform several serial dilutions. • Use spectrophotometry to measure the absorbance of solutions. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Create a series of solutions of decreasing concentrations via serial dilutions. • Measure the absorbance of solutions with a microplate reader. • Generate standard curves in Excel. • Evaluate the quality of standard curves by their R2 value. Part I: Serial Dilutions Introduction A serial dilution is a series of dilutions made sequentially, using the same dilution factor for each step. The concentration factor is the initial volume divided by the final solution volume; the dilution factor would be the inverse of the concentration factor. For example, if you take 1 part of a sample and add 9 parts of water (solvent), then you have made a 1:10 dilution; this is 1/10th (0.1) of the concentration of the original solution and has a dilution factor of 10. These serial dilutions are often used to determine the approximate concentration of an enzyme (or molecule) to be quantified in an assay. Serial dilutions allow for small aliquots to be diluted instead of wasting large quantities of materials, are cost-effective, and are easy to prepare. Equation 1 $\text{concentration factor}= \dfrac{\text{volume}_{\text{initial}}}{\text{volume}_{\text{final}}}\nonumber$ $\text{dilution factor}= \dfrac{1}{\text{concentration factor}}\nonumber$ Diagram of 1:2 Serial Dilutions In your notebook, draw a diagram showing the serial dilutions for the 6 colored solutions you are preparing. In the diagram, indicate the volume being withdrawn from the concentrated solution, the volume of water added, the concentration of the new solution, and the total volume. Practice Calculations Problem 1. Assume the original sample used in Figure 1 contained 400 g/L of Reagent X. 1. Then the first 1:10 dilution tube would have a concentration of 400/10 = __________ 2. Then the second 1:10 dilution would have a concentration of ____________ Problem 2. Assume the original sample used in Figure is considered 100% concentration. 1. Then the first 1:10 dilution tube would have a _____ % concentration. 2. The second 1:10 dilution tube would have a _____ % concentration. Problem 3. To make a serial dilution with a dilution factor of 5, you would need to add 1 part of the reagent plus ___ parts of water to make a total of 5 parts. This five-fold serial dilution would have concentrations of 100%, ______% in first diluted tube, _____% in second diluted tube, ________% in third diluted tube. Problem 4. Suppose the third diluted tube of a two-fold serial dilution has a concentration of 300 g/L. 1. That means that the second diluted tube has a concentration of _________ 2. The first diluted tube has a concentration of ________ 3. The original tube has a concentration of _______ 4. What formula could you use to calculate the concentration of the original tube from the problem statement? Part 1: Making Serial Dilutions Materials Reagents • Blue (or other color) food dye • DI H2O • 96 well microplate (dry) Supplies • P200 Micropipette • Box of P200 Pipet tips Note Use one pipet tip for each serial dilution. Procedure Preparing Two-Fold Serial Dilution (Dilution Factor of Two) 1. Obtain a clean, dry 96 well microplate, always touching the edges only. Use a dry clean paper towel to wipe off any fingerprints on the bottom of the plate. 2. Hold plate up to the light and check that there are no dirty spots on the three rows that you will use. 3. (Optional) You can scan the plate with no liquid, to find out the baseline absorbance of the plastic. 4. Pipet 100 µL of DI-water into the first 5 wells of row A (A1-A5). 5. Pipet 100 µL of the original blue dye into the first well (A1). Carefully pipet up and down twice to mix. 6. You do not need to change the pipet tip. But make sure that you released all liquid into the first well. 7. Transfer 100 µL of the mixture into the next well (A2). Mix carefully and release all liquid. 8. Transfer 100 µL of the mixture into the next well (A3). Mix carefully and release all liquid. 9. Transfer 100 µL of the mixture into the next well (A4). Mix carefully and release all liquid. 10. Transfer 100 µL of the mixture into the next well (A5). Mix carefully and release all liquid. 11. Transfer 100 µL of the mixture into the next well (A6). This ensures that all well A1-A5 have the same volume. 12. Take a photo of the wells on top of a white paper. Preparing Four-Fold Serial Dilution (Dilution Factor of Four) 1. Using a new pipet tip, pipet 150 µL of DI-water into the first 5 wells of row B (B1-B5). 2. You do not need to change the pipet tip. Pipet 50 µL of the original blue dye into the first well (B1). Carefully pipet up and down twice to mix. Then make sure that you released all liquid into the first well. 3. Transfer 50 µL of the mixture into the next well (B2). Mix carefully and release all liquid. 4. Transfer 50 µL of the mixture into the next well (B3). Mix carefully and release all liquid. 5. Transfer 50 µL of the mixture into the next well (B4). Mix carefully and release all liquid. 6. Transfer 50 µL of the mixture into the next well (B5). Mix carefully and release all liquid. 7. Transfer 50 µL of the mixture into the next well (B6). This ensures that all wells B1-B5 have the same volume. 8. Take a photo of the wells on top of a white paper. Preparing Five-Fold Serial Dilution (Dilution Factor of Five) 1. Using a new pipet tip, pipet 160 µL of DI-water into the first 5 wells of row C (C1-C5). 2. You do not need to change the pipet tip. Pipet 40 µL of the original blue dye into the first well (C1). Carefully pipet up and down twice to mix. Then make sure that you released all liquid into the first well. 3. Transfer 40 µL of the mixture into the next well (C2). Mix carefully and release all liquid. 4. Transfer 40 µL of the mixture into the next well (C3). Mix carefully and release all liquid. 5. Transfer 40 µL of the mixture into the next well (C4). Mix carefully and release all liquid. 6. Transfer 40 µL of the mixture into the next well (C5). Mix carefully and release all liquid. 7. Transfer 40 µL of the mixture into the next well (C6). This ensures that all wells C1-C5 have the same volume. 8. Take a photo of the wells on top of a white paper. Part II: Measuring Absorbance A microplate reader is a spectrophotometric instrument that can measure the absorbance of 96 different samples at one time. Does that save time compared to working with individual cuvettes and a spectrophotometer? We will use a microplate with 96 wells, so that you can perform all of your serial dilutions onto one plate and scan the entire plate with the microplate reader once. The microplate has rows marked A-H and columns marked #1-12. Using blue dye, you will make a 1:2 serial dilution on row A, make a 1:4 serial dilution on row B, and a 1:5 serial dilution on row C. Materials: • Equipment • Microplate Reader and cables • Laptop computer with program installed to run microplate reader Procedure: 1. Attach the cable from laptop computer to microplate reader. 2. Power “ON” the laptop computer and the microplate reader. 3. Open the computer program to run the microplate reader. 4. Push the button to open the microplate reader and expose the microplate loading platform. 5. Place your microplate securely into the holder area, ensuring that well A1 is at the top left corner. 6. Push the button to close the microplate reader. 7. On the computer program, start “read new plate” using wavelength 595 nm (for blue dye). You might use a different wavelength if instructed to do to correspond to the best absorbance for the dye you are using. 8. With the computer mouse, highlight the cells corresponding to the microplate wells that you used. Take a photo of the computer screen and note the Absorbance data in the tables below. 9. Calculate the dye concentration for each well, by dividing the dilution factor for each step of the serial dilution. The original dye is 100% concentration. Data Table 1. Absorbance Measurements of Two-Fold Serial Dilution with Microplate Reader Well A1 A2 A3 A4 A5 Absorbance @ 595 nm Dye Concentration Data Table 2. Absorbance Measurements of Four-Fold Serial Dilution with Microplate Reader Well A1 A2 A3 A4 A5 Absorbance @ 595 nm Dye Concentration Data Table 3. Absorbance Measurements of Five-Fold Serial Dilution with Microplate Reader Well A1 A2 A3 A4 A5 Absorbance @ 595 nm Dye Concentration Part III: Standard Curves Introduction Standard curves (also known as calibration curves) show the relationship between two quantities. The standard curves are most often used to determine the concentration of “unknown” samples by comparing them to reference samples with “known” concentrations. Later in the course, we will use standard curves to measure amounts of extracted protein and to determine the size of DNA molecules. In today’s lab, you made three serial dilutions and should be able to calculate the concentrations for each dilution. Using Excel, you will prepare standard curves for each serial dilution and determine if your standard curve is accurate. Then you will determine the concentration of unknown samples, using your standard curves. The R-squared value (R2) is the correlation coefficient or the square of the correlation. For the standard curve, this value measures how strong the linear relationship is between the reagent concentration (X-axis) and the absorbance value (Y-axis). If the R2 value = 1, then that shows a perfect positive relationship. Since your standard curves are generated from the serial dilutions you pipetted, the R2 values can also show how accurate your pipetting skills are. Activity A: Making a Standard Curve for Each Serial Dilution 1. Enter the data into Excel. 2. Select the data values with your mouse. On the Insert tab, click on the Scatter icon and select Scatter with Straight Lines and Markers from its drop-down menu to generate the standard curve. 3. Be sure to add graph title and labels for X and Y axes. 4. To add a trendline to the graph, right-click on the standard curve line in the chart to display a pop-up menu of plot-related actions. Choose Add Trendline from this menu. 5. Select “display equation on chart” and “display R-squared value on chart”. Ideally, the R2 value should be greater than 0.99. 6. Print the standard curves and add to your notebook. Activity B: Determining the Concentration of “Unknown” Samples 1. Your instructor will have several unknown samples. 2. Determine the absorbance values of each sample. 3. On your standard curve, use the graph equation to solve for the corresponding concentration of these samples. Or estimate from the line graph. Data Table 4. Concentration Compared to Serial Dilution Graphs Unknown Sample Absorbance 2-fold 4-fold 5-fold Study Questions 1. Using a serial dilution, describe how you would prepare 10 mL of 1.0%, 0.1% and 0.01% solutions of NaOH. The stock solution is 10% NaOH. Draw diagrams as part of your descriptions/protocols. 2. Using the depicted standard curve, calculate the concentration of an unknown solution if its absorbance value is 0.55. 3. Evaluate the quality of the standard curve (see diagram) by using the R2 value.

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.18%3A_Serial_Dilutions_and_Standard_Curves_with_a_Microplate_Readers.txt

Learning Objectives Goals: • Learn the basics of aseptic technique. • Learn to prepare sterile agar plates for growing bacteria Student Learning Outcomes: Upon completion of this lab, students will be able to: • Practice aseptic technique. • Sterilize and pour agar plates by hand Introduction Microbes are all around us. In lab 4, our class sampled various surfaces and found that microbes were easily found everywhere in the environment. We used sterile agar plates that provided the nutrients and correct pH for bacteria to grow. In this lab, you will be learning to produce these sterile agar plates. Agar is a polysaccharide derived from red algae. The agar powder is first dissolved in a boiling liquid, and then cooled to form a gelatinous solid matrix. As microbes cannot digest agar, this material is used commonly in laboratories to hold the nutrients that bacteria need. The main instructions for pouring agar plates are presented here. But there are many different recipes to prepare growth media for bacteria, as some bacterial species require different combinations of nutrients. Some types of common agar include blood agar, Luria Bertani (LB) agar, MacConkey agar, nutrient agar (NA), and tryptic soy agar (TSA). Follow the specific package instructions regarding the amounts of powder and water to use for the growth media you are making. The recipe to make 1-liter LB agar is 9.1 g tryptone 4.6 g yeast extract, 4.6 g NaCl and 13.7 g agar. If an antibiotic additive is needed in the medium recipe, that is added after the sterilized agar has cooled to 60oC to avoid denaturation. An autoclave is a high-pressure apparatus that is used by laboratories, dentists, and hospitals to sterilize equipment, instruments, glassware, growth media, liquids and biohazardous waste. The autoclave applies high pressure (15 psi) and saturated steam at 121oC (250oF) for 15-20 minutes to kill microbes and spores. After the media has gone through this cycle, it is sterile. Cool to 60-65oC before adding any antibiotics and pouring into sterile Petri dishes. Materials • disinfectant spray • paper towels • petri dishes • gloves • LB agar powder • Weigh boat • Stir bar • 500 mL autoclavable bottle • Autoclave tape • Sharpie marker (colored) • Deionized or distilled water • Electronic balance • Autoclave or pressure cooker • Metal tray • Ampicillin or arabinose Procedure Preparing the media 1. Label a clean glass autoclavable 500 mL autoclavable bottle with media name, date, and initial. • Note: only fill bottle halfway, to avoid overflow during the heating process in the autoclave. 2. For a 500 mL bottle, calculate the needed weight of powdered media to make 250 mL. Subtract that from 250 to determine the volume of water to add. 3. Add __ mL of distilled water to the bottle. 4. Add __ g of media with agar powder to the same bottle. (your total should be 250 mL) 5. Add a stir bar (optional). Stir or shake until fully mixed and check that there are no lumps. 6. Add a piece of autoclave tape to the cap or bottle and loosen the cap a half-turn. If using a container with no cap, then cover loosely with aluminum foil Setting up the autoclave 1. Place the prepared media bottles into a metal tray. 2. Add distilled water until it covers the bottom of the tray; about 1-2 cm deep. 3. Place into the autoclave. 4. Autoclave at 121oC for 15 minutes at 15 psi. 5. Once the cycle is complete, wear heat-resistant gloves to remove the tray and bottles from the machine. 6. Allow bottles to cool to approximately 60oC. Prepping the workspace: 1. To keep as sterile of an environment as possible to avoid contaminating the media and plates, don a lab coat and gloves, and use a disinfecting agent or wipes to wipe down all surfaces. 2. This includes tabletops and edges, gloves, scissors, permanent markers, etc. 3. Make sure to clean your gloves if they have touched another surface that is not disinfected (eg.if you touched face, arm, chair, etc.). 4. If available, use Bunsen burners and carefully pour near the open flame to better prevent airborne contaminants. 5. Once the area is disinfected, bring out the sterile Petri dishes. Keep the sterile dishes closed. 6. Stand a bag up vertically. 7. To conserve the plate bag to reuse for storage, ignore any “Tear Here” markings, and snip a small corner off the top of the bag. Insert half of the scissors into this opening and cut along the crease of the bag. 8. Flip the entire stack of plates upside down, with the cut opening at the very bottom of the stack. 9. Gently apply a small amount of pressure downward while simultaneously rolling the bag up. 10. Fold or roll up the empty bag and put aside to use for re-bagging. Striping the plates 1. To quickly differentiate between plates that have a similar appearance, a stripe code can be used. A combination of different colored permanent markers can signify different additives to a plate. For example, a green stripe may mean ampicillin, a type of antibiotic, was added to the media in that plate. Striping codes are specific to an individual lab, so always double check the code key. 2. To stripe a plate, the top AND bottom must be labeled with the code. 3. Take the marker with the color in the key, and with the unbagged stack of plates, apply a gentle amount of pressure with your hand onto the top of the stack. 4. Draw a line straight down from the top edge to the base of each plate in the stack. 5. If done quickly, you may need to go back in and redraw the line on the bottom base. 6. If the stripe code has another line or color, repeat the process by adding another line. 7. The spacing of the second line should be within 1 cm from the first line. 8. Repeat the process until the stripe code is complete. Setting out the plates 1. Begin to unstack the plates. Make sure the plate tops and bottoms do not separate. 2. Place individual plates around the edge of the table (not in stacks), to create a line or chain of plates. Pouring the Plates 1. Once the media has cooled to 60 o C, the liquid solution is ready to be poured. 2. At this time, an antibiotic (ex: ampicillin) may be added to the media and gently swirled or stirred to mix. Note: do not add the antibiotic if the liquid is hotter than 60 o C, as the antibiotic would be denatured. 3. Uncap the media bottle and hold the bottle in your dominant hand. Note: once the bottle is opened, do not talk. Talking will allow bacteria from your mouth to become airborne and may contaminate the media. 1. The cap can be held in the same hand (between fingers) as your bottle or can be placed on a disinfected surface. 2. Grab a plate with your other hand and slide it towards the edge of the table, while keeping it closed. 3. Once the plate is at the edge, open the lid as if there is an imaginary hinge at one end; so the plate opens like a clamshell. 4. Pour the media into the bottom of the plate until it just covers the surface. Do not over fill. 5. Close the lid and allow to cool. The media will be solid. 6. Leave the plates out for a day if possible so the condensation will evaporate from the plate. You may place the plates in a 25C incubator overnight. 7. Stack plates with the same type of media and slide the plastic sleeve over the top. 8. Flip the stack over and seal the plastic sleeve with masking tape. 9. Label the tape with the type of media, date produced, and name of individual that produced the stack. 10. Store sealed stacks in the refrigerator until use. STUDY QUESTIONS 1. What is the typical amount of agar included in 1 L of media? 2. Why must one take such precautions to disinfect the space and avoid actions that may cause bacteria and mold to become airborne? What is the term applied to these precautions and procedures? 3. Does agar provide nutrients for bacteria? 4. Why can’t you include ampicillin in the media before it is autoclaved? 5. Why must you leave solidified plates out for a day before you seal them and refrigerate them?

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.19%3A_Pouring_Agar_Plates.txt

Learning Objectives Goals: • Make a batch of Good Manufacturing Practice (GMP) popcorn within a specified timeframe (1.5 hours). • Use Standard Operating Procedures (SOPs) to accomplish the manufacturing task. • Understand the complexity of the GMP process. • Understand Quality Control (QC) and Quality Assurance (QA). • Understand the need for team members to complete individual jobs appropriately to accomplish goals. Student Learning Outcomes: Upon completion of this lab, students will be able to: • Explain the role of Standard Operating Procedures (SOPs) and batch/lot Records. • Employ the principles of a quality systems approach to manufacturing. • Learn the difference between Quality Control (QC) and Quality Assurance (QA). • Discuss the value of teamwork. Part I: Review Terms and Background Information Introduction In everyday speech, quality is a relative attribute like beauty. However, in the Life Sciences or any other manufacturing-related industry quality means compliance to specifications. Quality systems are comprised of the policies, processes, and procedures for maintaining a product with specifications. This lab exercise will utilize the manufacturing of a popcorn snack as an example where good manufacturing practices (GMPs) can be followed. The exercise used the components of a Quality System. Students are the employees with tasks to accomplish within the defined QA/QC parameters. Quality Management Systems (QMS) Quality is the business of the entire company. Generally, companies build their quality systems by first making a commitment by management to design and deliver a ‘quality’ product. The term quality management system refers to the organizational resources, processes, and procedures to implement quality management. In the case of pharmaceuticals, diagnostics and medical devices, these requirements mean the product is EXACTLY what was tested in clinical trials. Quality product management is usually implemented through two departments; quality assurance (QA) and quality control (QC). The QA department plans activities and develops the processes that guarantee the accuracy and precision of outputs. QC performs the actual tests during the process and on the final product to ensure that specifications are met. Quality Assurance is process oriented and focuses on defect prevention, while quality control is product oriented and focuses on defect identification. QC refers to a measuring process, or to check a result and provide assurance that all activities are performing within predetermined limits. Often, QMS systems are explained in this simple statement: Say what you do, do what you say, document it.” Say What You Do = SOPs Standard Operating Procedures (SOPs) and documentation are essential components of a QA program. The management team is responsible for ensuring adherence to the QA plan and SOPs. Essential to this process is documentation of the proposed quality system and processes used by the company. Perhaps the most important form of documentation is SOPs. SOPs are validated methods that are at the technical core of the product or service. To determine whether methods are fit for their intended purpose, the selected methods must have established accuracy, precision, calibration and limits of detection and quantification. All methods must be fully validated for accuracy and precision before a company starts to sell its product or service. Do What You Say = Follow the Process (SOPs) Quality systems are implemented in many sectors of the life sciences industry including manufacturing, a testing laboratory, clinical trials or even Research and Development. In all cases the SOPs must be followed. In the example of a manufactured product, all manufacturing employees follow the defined process and document that they have done so. The QC department provides the process checks and balances. For example, they manage the acceptance and release of raw materials, in–process checks and testing of the final product. Document It = Evidence of Quality If you didn’t write it down = you didn’t do it! No documentation = no PROOF you did it! No documentation = BAD product and lost money for your company Current Good Manufacturing Practices (cGMPs) The general principles that all QMS have in common are: • Say what you do. Quality, safety, and effectiveness must be designed and built into the product, not tested or inspected into the product. • Do what you say. Each step in the manufacturing process must be documented and controlled to ensure the finished product meets design and regulatory specifications. • Document it. Process documentation provides evidence of compliance with cGMPs. Statistical Process Control Another aspect of a quality program it use of statistical process control (SPC), which utilizes statistical methods to evaluate variability in procedures. In the design of the product, multiple data sets are obtained to establish accuracy and precision criteria. These criteria are documented in the Master Record. QC testing procedures ensure SPC through instrument calibration and validation, in process testing, final product testing, raw material testing etc. They use process control charts to monitor the process and procedures in order to manage variability. The purpose of the quality systems is to ensure quality. Since quality is defined as compliance to specifications, a statistical process control (SPC) must be established to ensure this compliance. The SPC requires understanding of both the accuracy and precision required in the product. Accuracy is the ’right answer’ or ‘bulls-eye". Accuracy is not always known but when it is, it is part of the process. Precision is reproducibility. Whatever the process or procedure, the quality system is there to ensure reproducibility. The ideal situation is when precision and accuracy are on target: Expected and observed values are close and the results are consistently reproducible. If results are reproducible but the results are not close enough to the expected value, one has good precision but poor accuracy. Poor precision but good accuracy occurs when the results are not close to each other in value but they all fall within an acceptable target range. This situation often can be improved upon with the appropriate action. Poor precision and poor accuracy is typically the most problematic result since neither reproducibility nor an expected target value have been achieved (Figure 2). Corrective and Preventative Actions (CAPA) The purpose of the Corrective and Preventative Actions (CAPA) system is to serve as a feedback loop to identify and investigate all quality problems. CAPA policies are central to a quality system. Part of the QC testing that takes place on every lot of product, is to assure compliance to specifications. If the specifications are not met, it is important to determine what is the root cause of the problem. Until the root cause is used to identify the cause of problems with accuracy and precision, product quality cannot be assured. Quality Assurance and Quality Control (QA/QC) Table 1. Quality Assurance Versus Quality Control Element Quality Assurance (QA) Quality Control (QC) Definition the activities focused on the processes for preventing mistakes and producing products free of defects a set of activities concerned with monitoring and verifying resulting products meet the defined standards and specifications for quality Purpose Verification: Answer the question "Am I building the product correctly"? Prove the system meets all specified requirements at a particular stage. Validation: Answer the question "Am I building the right product"? Ensure that the product meets customer expectation. Type of process Proactive Reactive Goal Plan to prevent problems Identify defects in the finished product Identify and correct source of product defects Tools Statistical Process Controls: Control Charts Run Charts Statistical Quality Controls: Random Acceptance Sampling Range Charts Histograms Means Standard Deviation Responsibility Everyone Quality Control Group Part II: Train and Prepare for a Production Run A. Lab Activity: Review the Lab Flow Construct a flow diagram of the following overview of the training and production of your component for the snack product today. Scenario: Your company, Awesome Snacks Company (ASC), needs you to produce popcorn for their seasonally available Summer Snack Mix. Your job will be to take the raw material and produce the popcorn that goes to the Snack Mixing Department. Materials needed: microwave popcorn bags, microwave, digital balance, forms ASC001-004 1. Employee Overview • Supervisor (teacher) – Welcomes Employees (students) to Awesome Snack Company. • Overview of QMS and why it’s important to the company. 2. Group Formation • Divide employees up into Quality Assurance Teams (5 employees each team) 3. Training 1. Supervisor gives training form (see figure below, in QA packet) and packets to team. 1. Team Assigns Jobs to Members 1. Material Control Tech. 2. Quality Control Tech. 3. Manufacturing Tech. I 4. Manufacturing Tech II 5. Quality Assurance Tech. 2. QA Tech Reads SOP Standards 11-001 to team 3. QA Tech distributes packets to each team member • Members read through their training packet 4. Team completes ASC Training Document 5. The completed ASC Training Document must be turned in to the supervisor (instructor) to receive material to start the production run. 4. Production 1. Each technician performs their role 2. Document everything on company forms 3. Put the following calculation from ASC Form 004 into your laboratory notebook: • Percent weight loss for each of the three bags. 4. Evaluate: Does batch meet specification? • Statistical Process Control: Mean, Standard Deviation, and Coefficient of Variation 5. Post Production Product Specifications: Release or Reject • Are you accepting or rejecting this batch? Why? 6. Once everything is completed, QA will turn forms into Supervisor 5. Corrective Action Plan 1. Class discussion of Statistical Process Control 2. Corrective and Preventative Action plan is constructed. B. Activity: Training Using Good Manufacturing Practices (GMP) PURPOSE: Every employee must be trained in conformance with GMP (Good Manufacturing Practices). MATERIALS • 1 official SOP Standards for Employee Safety and Conduct: STANDARDS 11 -001 (see below) • 1 official Awesome Snack Company (ASC) Documentation of Training Document (see below) • 1 Set of the Standard Operating Procedures (SOPs) for Production: MAT-11-001, MAN-11-001, MAN-11-002, MAN-11-003, QA-11-001, QC-11-001 • 1 set of production forms: ASC 001, ASC 002, ASC 003, ASC 004 PROCEDURE Form Groups, Assign Roles, Complete Training 1. The ideal group size is 5. Form groups and assign roles (jobs) to each member of Production Team. Jobs: Quality Assurance (QA), Quality Control (QC), Manufacturing Tech I, Manufacturing Tech II, Material Control (MC). Note: If the team is comprised of a group less than 5, 1 member must take multiple roles. 2. Follow the training instructions below. After training, the documentation of training document (Figure 4) must be turned in to the supervisor (instructor) to receive material to start your production run. Instructions: 1. Quality Assurance (QA) Technician will read SOP Standards-11-001 to the Team. 2. QA Technician distributes signs, SOPs and ASC Forms to each team member. 3. Each team member reviews the scope and ASC guidelines, signs the page and receives a supervisor (or their designee) signature (see below) 4. Each team member reads the SOP for his/her job to identify their primary activity. (Ex. Weigh unpopped popcorn (UPP)) 5. QA fills out table 2 below. In the order presented, QA lists the activity and asks the name of who will do it. SCOPE • ALL ASC employees must be trained, acknowledge training, and receive sign-off from a supervisor. • Not following the stated ASC guidelines may result in written warning and/or termination of employment The ASC Guidelines include but are not limited to the following: 1. All hair that is shoulder length or longer must be tied back or contained in a hair net 2. Fingernails must be neatly trimmed. Fingernails should not protrude past the ends of the fingertips more than ¼ inch 3. Clothing and other personal belongings must be stored in designated areas 4. All jewelry is prohibited in all manufacturing areas with the exception of one smooth ring (no stones) on finger. This includes and is not limited to watches, multiple rings, ear, nose, tongue, eye, belly piercings or rings...etc. are not allowed 5. No items are allowed in pockets or affixed to clothing above the waist in the manufacturing area. The exception is for PPE (Personal Protective Equipment) 6. Electronic devices such as cell phone, iPods, blue tooth, radio, pager, MP3, handheld games, etc. These items may be stored in lockers. Employees may use these devices only in designated areas during breaks, lunch, before and/or after work 7. Areas must be left in a clean and organized manner at the end of each shift 8. No food (including gum, candy, nuts and/or similar snacks) and/or drinks can be stored or consumed in manufacturing areas 9. Every glass or plastic breakage in any manufacturing area must be reported to the Shift Supervisor or Safety Coordinator and a Quality Incident Report generated 10. Use the following format for dates: Day-Month-Year (ex. 05-Mar-2019) 11. When Initialing, use THREE initials, to include your middle initial I, ___________________________ , certify that I have read and understand the ASC Guidelines. Employee Full Name Employee Signature Supervisor Signature Date Date Table 2. Assignment of Production Roles ACTIVITY WHO DOES THIS JOB? (NAME) SOP/FORM Inspect and/or Release, Reject UPP* MAT-11-001 / ASC 002 Start Lot/Batch Record QA-11-001 / ASC 001 Prepare and clean microwave/ balance MAN-11-001, MAN-11-002, / ASC 003 Inspect Cleaning; OK production start QC-11-001 / ASC 003 Weigh UPP MAN-11-003 / ASC 004 Produce IPP* MAN-11-003 / ASC 004 Place popcorn in Reject or Release MAT-11-001 / ASC 002 Complete Lot/Batch Record QA-11-001 / ASC 001 If necessary, initiate CAPA *UPP= unpopped popcorn; IPP= in process popcorn 1. Print name and Initial on the OFFICIAL Documentation of Training document (looks like below) after training on Standards and SOPs is complete. Be sure to include your middle initial 2. Once completed, Material Control turns in the document in to Supervisor (Instructor) to receive the starting material (UPP) and start production Table 3. Documentation of Training JOB TITLE NAME (Print) INITIALS (Include Middle Initial) Material Control Tech Quality Control Tech Manufacturing Tech I Manufacturing Tech II Quality Assurance Tech This is similar to the official document to be used and completed during the exercise. Part III: Production and Documentation Perform Roles and Document Appropriately Using Company Forms Procedure 1. Use official company SOP documents to perform the assigned roles in Table 1. 2. Document appropriately on the “official” Awesome Snack Company (ASC) forms as listed in Table 1 Results ASC form 004 (IPP production report) is to be completed by your team and turned in to your supervisor (instructor) along with ASC forms 001, 002, 003. Put the following calculations from this form into your laboratory notebook: 1. Percent weight loss for each of the three bags. Are you accepting or rejecting this batch? Why? 2. Statistical Process Control: • Mean: • Standard Deviation: • Coefficient of Variation: 3. Post Production Product Specifications: Release or Reject Study Questions 1. Did you need to implement CAPA? Explain the deviance that caused this procedural process to begin and explain the corrective and preventative process you implemented. This will be shared with the class during discussion. 2. The Ishigawa fishbone diagram (Figure 4) is a tool used to determine the root cause of a problem. It enables a team to brainstorm and categorize all the potential problems that could be the cause of a problem so they can be systematically eliminated until the real cause or causes is/are identified. 3. With your team come up with all the potential reasons your popcorn may fail to meet quality specifications because it is burnt. Redraw the diagram, including the title, and fill it out in your laboratory notebook. Attribution: Adapted from Lab 20 Good Manufacturing Practices by Sandra Slivka, PhD, Southern California Biotech Center, San Diego Miramar College, CA. Licensed CC-BY-NC-SA 4.0

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.20%3A_Good_Manufacturing_Practices_%28GMPs%29.txt

Learning Objectives Goals • Convert cellulose biomass to usable biofuel. Student Learning Outcomes • Test predictions about how variables such as biomass type or grinding affect conversion into sugars and ethanol. • Trace the transformation of cellulose into glucose and then ethanol. • Infer the action of cellulase enzymes on cellulose based upon sugar readings. • Measure the conversion of sugars to ethanol using ethanol sensors. • Use sugar and ethanol readings to evaluate initial predictions and draw conclusions about the effects of treatment variables. Introduction Biomass is any organic material that comes from organisms, such as plants. Plant biomass contains energy that can be used for food or fuel depending on what part of the plant is used. Cellulosic biomass is the part of the plant that most people cannot digest such as tough fibrous or woody grass, leaves, stems, flowers, corn stalks, wood, or paper products. Although cellulosic biomass cannot be used for food, it contains a large amount of energy that can be used as fuel for transportation. Cellulosic biomass, also referred to as cellulose, is the primary component of plant cell walls. Without cellulose, plants would not be able to stand upright. Cellulose is one of the most abundant molecules on Earth and represents a huge potential pool of renewable energy if we can find a way to easily convert it into transportation fuel. In this lab, you will investigate the challenge of converting cellulosic biomass into ethanol. You will use some of the same strategies used by scientists and engineers in biotechnology companies. The process involves three key steps: Pretreatment, hydrolysis (enzymatic digestion) and fermentation. Biofuel Pipeline Overview The process outlined below provides an overview of the steps and describes the chemical changes occurring as cellulosic biomass is converted to sugar and then ethanol. We call this a “biofuel production pipeline” because the products generated from one step are used in the next step until ethanol is produced. In the pretreatment stage, the goal is to loosen the cell wall structure so that the cellulose is exposed. Plant cell walls are made up of three primary components: cellulose, hemicellulose, and lignin. These molecules must be separated so that enzymes can reach the cellulose. Heating and grinding are effective pretreatment methods. Cellulose is actually made up of long chains (polymers) of glucose molecules. In the hydrolysis stage, the goal is to break the long cellulose molecules down into individual glucose molecules. Special enzymes called cellulases are able to cut up the cellulose strands into glucose. Glucose is a simple sugar that can be used as food by many organisms. In the final step of the pipeline, yeast is added to the enzymatically digested biomass mixture. Without oxygen, yeast consumes the glucose and produces ethanol through a process called fermentation. The yeast used in this process is the same single-celled organisms used to bake bread or brew beer. The process outlined below provides an overview of the steps and describes the chemical changes occurring as cellulosic biomass is converted to sugar and then ethanol. We call this a “biofuel production pipeline” because the products generated from one step are used in the next step until ethanol is produced. In the pretreatment stage, the goal is to loosen the cell wall structure so that the cellulose is exposed. Plant cell walls are made up of three primary components: cellulose, hemicellulose, and lignin. These molecules must be separated so that enzymes can reach the cellulose. Heating and grinding are effective pretreatment methods. Cellulose is actually made up of long chains (polymers) of glucose molecules. In the hydrolysis stage, the goal is to break the long cellulose molecules down into individual glucose molecules. Special enzymes called cellulases are able to cut up the cellulose strands into glucose. Glucose is a simple sugar that can be used as food by many organisms. In this investigation, you and your research team will pick a cellulosic biomass sample to first convert into sugars, and then into ethanol through the process described above. You will track the conversion process by measuring sugar (glucose) and ethanol levels at key stages. The data you and your classmates collect will help you determine which biomass sources and pretreatment methods are most effective for producing sugars and ethanol and develop explanations for why some samples produce more sugar and ethanol than others. Part 1: Prelab Work Before the Lab The goal of this lab is to convert a cellulosic biomass sample into sugar and then ethanol. Your lab group should select a biomass sample and cutting/grinding treatment that you think will effectively produce ethanol. Your group will prepare both an experimental and a control treatment to evaluate the effects of the enzyme on the production of sugar and ethanol. Figure 2: Experimental and control samples of biomass Experimental Sample • Biomass • Cutting/Grinding Treatment • Enzyme Control Sample • Biomass • Cutting/Grinding Treatment • *No Enzyme* Table 21.1. Table 21.1 Project Timeline Lab Research Stage Duration Activities 1. Experimental Design and Planning 1-2 days • Develop research plan • Choose biomass type and/or pretreatment options (cutting or grinding) 1. Sample Prep and Pretreatment 1 day • Set up experiment • Cut, grind and/or boil biomass • Measure initial sugar levels 1. Hydrolysis (Enzyme Digestion) 1 day • Add cellulase enzymes • Measure sugar levels (after 24 hours) 1. Fermentation 1 day • Measure initial ethanol levels • Add yeast • Measure final ethanol levels (after 24 hours) 1. Data Analysis, Conclusions, and Discussion 1-2 days • Graph final results • Summarize conclusions and communicate findings to class • Write up final results based on evidence from your other lab group results Experimental Design and Planning In your group, discuss and decide which biomass and grinding options will be best for producing ethanol. As instructed by your teacher, write down why you think it will produce the most ethanol. Be prepared to explain what you think will happen in this experiment and pinpoint what evidence you will use to determine whether your prediction was accurate. The goal of this lab is to produce as much ethanol as possible from 1-gram of biomass mixed with 25-mL of water. Based upon the options provided by your teacher, work with your lab group to decide what biomass type and grinding option you would like to convert into ethanol. Answer the questions below and be prepared to share your answers with the class. 1. What biomass did you choose? Explain why. 1. If applicable, what grinding option did you choose? Explain why. 1. What evidence will you gather from this experiment to determine whether your biomass is effectively converted into ethanol? 2. At what stage in the lab (pretreatment, enzyme digestion, fermentation) and in which treatment (control or experimental) do you expect to measure the highest glucose levels? Explain. 3. At what stage (pretreatment, enzyme digestion, fermentation) and in which treatment (control or experimental) do you expect to measure the highest ethanol levels? Explain. Materials • Vernier or Pasco data-collection interface 4/class • Vernier or Pasco Ethanol Probe 4/class • 50mL Conical Centrifuge Tubes 2/group • TRUE balance Blood Glucose meter 1/group • Blood glucose test strips ~10/group • Wax paper or parafilm 1 sheet/group • Cellulosic biomass: sawdust, straw, corn stover, switchgrass, cardboard, etc. ~50 grams of each • Weight boats 1/group • Electronic balance 1/group • Grinder for biomass samples 4/class • Scissors, saws, shears, etc. for cutting biomass ~ 1/group • 25 or 50mL graduated cylinder 1/group • 600mL beakers 1/group • Hot plates 1/group • Pens or tape to mark Falcon tubes 1/group • Pipettes 1/group • Thermometer 1/group • Water bath or incubator with racks to hold tubes 1/class • Cellulase enzyme (Celluclast: available from Sigma) ~10mL/class • Yeast (standard dry active baker’s) 1/2 tsp/group • 1/4 teaspoon measurer 1/group Safety • All appropriate safety precautions and attire required for a science laboratory should be used, including safety goggles. Please refer to your teacher’s instructions. • Wash your hands well with soap after completing the lab. Part II: The Experiment Procedure STEP 1: Sample Preparation and Pretreatment GOAL Break down plant cell walls to release the cellulose fibers 1. Label two 50-mL conical tubes and caps with your team initials, date, and sample description (biomass source and any pre-treatment) • The labels in Figure 3. are examples. Every group will have 2 tube setups with the same biomass. • If any pre-treatment is required, do so (cutting, grinding, drying, etc.). 2. Measure 1.0 gram of your biomass samples and put the 1.0 gram into the corresponding 50-mL falcon tube. 3. Test the initial glucose concentration using the blood glucose test monitor and test strips, record this data. Describe the biomass (ex: Appearance, odor). 4. Test the initial ethanol concentration using the ethanol probes; record this data. Describe the biomass (ex: Appearance, odor). Figure 3: Example labels and diagram of sample preparation. Hot Water Pretreatment 1. Start the hot plate to bring approximately 400-mL water to a gentle boil in a 500-mL glass beaker. Use pre-heated water to fill your beaker. 2. Set up a conical tube holder (i.e. chicken-wire screen or aluminum) foil for your 500-mL beaker as directed by your teacher. If you are partnering with another group, you can pack 4 tubes in a beaker without setting up a holder. Figure 4: How to setup hotplate and tubes. 3. Add 25-mL of distilled water to the to all three of your labeled 50-mL conical tubes. 4. Swirl to mix the biomass and the water. Let it sit for 1 minute. 5. Loosely screw the cap onto the conical tube; DO NOT tighten all the way. Figure 5: Contents of the falcon (conical) tube. 6. Wait for water in your beaker to come to a gentle boil on your hot plate. 7. Gently push your two conical tube samples into the beaker though the aluminum foil or wire screen. If you are using the 4-tube method pack the 4 tubes into the 500-mL beaker. Make sure that the biomass samples and the liquid are completely submerged below the surface of the boiling water in the beaker. 8. Leave tubes in the water for 10 to 25 minutes depending on how much time you have. The longer the time period, the higher the potential yield of ethanol will be. 9. Turn off the hot plate and remove your samples. Allow them to cool to room temperature. Lab Tip: Use a cold-water bath to make the tubes cool more quickly. 10. Test the glucose concentration using the blood glucose test monitor and test strips; record this data. Describe any detectable changes in the biomass (ex: Appearance, odor). 11. Test the ethanol concentration using the ethanol probes; record this data. Describe any detectable changes in the biomass (ex: Appearance, odor). 12. If samples will not be used in the next 2 days, refrigerate or freeze them immediately. This will suppress microbial growth. Step 2: Enzymatic Digestion (Hydrolysis) GOAL Digest the cellulose fibers into glucose (sugar) 1. Remove samples from refrigerator or freezer and bring to room temperature. 2. Make sure the common water bath or the incubator is at 50°C. 3. Add 1.0 mL of Celluclast™ cellulase enzyme product to each test tube that is undergoing hydrolysis. The control will not have any enzyme added. 4. Screw caps on tightly. Mix gently. 5. Place both conical tubes in a common water bath or incubator at 50°C. 6. Leave the tubes in the water bath for 24 hours. 7. After 24-hour hydrolysis data collection: Use the blood glucose test monitor and test strips to test post-enzyme glucose concentration of the sample. Record this data. Describe any detectable changes in the biomass (ex: Appearance, odor). 8. Test the ethanol concentration using the ethanol probes. Record this data. Describe any detectable changes in the biomass (ex: Appearance, odor). NOTE: For more accurate ethanol readings, allow samples to reach room temperature before taking measurements. 1. If fermentation will not begin at this stage, freeze or refrigerate samples to prevent microbial contamination. Step 3: Fermentation GOAL Convert glucose (sugar) into ethanol (fuel) 1. Make sure the common water bath or incubator is at 37°C. 2. Add ¼ teaspoon or 1.0 gram of active yeast to each tube. These measurements are roughly equivalent. 3. Gently mix in the yeast. The yeast will grow more quickly if evenly mixed. 4. Loosely screw on the cap to the tubes. It is important that the tubes not be air-tight for the fermentation. Yeast will produce CO2 and will build up pressure in the tube unless the gas is allowed to escape. 5. Place conical tubes upright in the 37°C water bath or incubator. Use a test tube rack or similar apparatus (chicken wire) to keep the tubes upright. OPTIONAL: After 30 minutes measure ethanol and glucose concentration, record data and other observations about changes occurring in the tubes. 1. Return your tubes to the 37°C common water bath or incubator for 24 hours of fermentation. 2. After 24 hours, remove your tubes from the 37°C water bath. NOTE: If 24-hour measurement does not fit with class schedule, instructor can remove samples from water bath and refrigerate or freeze until final measurements can be taken. 1. Take final glucose readings: Use the blood glucose test monitor and test strips to test post-enzyme glucose concentration of the sample. Record this data. Describe any detectable changes in the biomass (appearance, odor?). 1. Take final ethanol readings. Test the ethanol concentration using the ethanol probes. 2. Record this data. Describe any detectable changes in the biomass (Appearance, odor). NOTE: For more accurate ethanol readings, allow samples to reach room temperature before taking measurements. 3. Clean tubes and lab area as instructed by your teacher. DATA ANALYSIS To organize and draw conclusions form your data, it is helpful to compare changes in glucose and ethanol levels over time using bar graphs. Using a computer program such as Microsoft Excel (or by hand), create two bar graphs to summarize your results (Graphs 21.1-2). The empty graphs below can serve as a guide (full sized are available on page 21-9). Discuss the graphs with your lab group: 1. Do these results match your initial prediction? Why or why not? 2. How do you explain your results? Summarize and communicate results as instructed by your instructor. RESULTS Use your graphs and lab notebook data to answer these questions about the results of this experiment. Be prepared to share your answers with the class. 1. Did you observe any changes in glucose and ethanol levels after the enzyme digestion stage (hydrolysis)? Explain why or why not. 2. Where does the glucose come from in this experiment? 3. Did you observe any changes in glucose and ethanol levels after fermentation? Explain. 4. Why do you think that glucose levels went up then then went down in over the course of this experiment? 5. Did your observed results match what you expected would happen? Explain why or why not. CONCLUSION Share your results and initial conclusions with the class. Learn from your classmates’ results and observations so you can determine what might be the most effective ways to convert biomass into ethanol. STUDY QUESTIONS 1. Of all of the samples tested in your class, what biomass treatment produced the most glucose and ethanol? Explain why you think this treatment was most effective. 2. Of all of the samples tested in your class, what biomass treatment produced the least glucose and ethanol? Explain why you think this treatment was least effective. 3. If you were to try this experiment again to produce more ethanol what would you do differently? Explain why. 4. Explain how you would design an experiment to determine whether the boiling pretreatment had an effect on how much glucose and ethanol is produced. This material is based upon work supported in part by the Great Lakes Bioenergy Research Center, U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research under Award Numbers DE-SC0018409 and DE-FC02-07ER64494 and is licensed CC-BY-NC-SA . Original activity, CB2E: Converting Cellulosic Biomass to Ethanol.

textbooks/bio/Biotechnology/Lab_Manual%3A_Introduction_to_Biotechnology/1.21%3A_BioFuel_Project.txt

Thumbnail: CRISPR Cas9 system (CC BY-SA 4.0; marius walter via Wikipedia) 01: Protocols • Created with biorender.com 1.02: Plasmid DNA Extraction (Mini-Prep) Zymo-Pure Plasmid DNA extraction (Micro-Centrifuge Method) Learning Objective • Isolation of Plasmid DNA from overnight cultures in LB. This method is spin column-based and purifies up to 100 $\mu g$ of ultra-pure endotoxin-free plasmid DNA in less than 15 minutes. The result is plasmid DNA suitable for transfection, restriction endonuclease digestion, bacterial transformation, PCR amplification, and DNA sequencing. (ZymoPURE Plasmid Miniprep Kit) Note Watch the Youtube video for questions about the Miniprep protocol ZymoPURE Plasmid Miniprep video Note The P1 reagent is temperature sensitive due to RNase being present, and should be kept in the fridge or on ice at all times. All other reagents will be stored at room temperature. Reagent name and Code Storage Temperature ZymoPURE™ P1 (Red) 4°C ZymoPURE™ P2 (Green) Room Temp. ZymoPURE™ P3 (Yellow) Room Temp. ZymoPURE™ Binding Buffer Room Temp. ZymoPURE™ Wash 1 Room Temp. ZymoPURE™ Wash 2 Room Temp. ZymoPURE™ Elution Buffer Room Temp. Zymo-Spin™ II-P Columns (must have purple ring) Room Temp. Collection Tubes Room Temp. Visual Procedure of Zymo Plasmid Mini-Prep TIPS BEFORE STARTING The first couple of times you do the Mini-Prep, on the protocol indicate/LABEL WHERE your DNA is for each of the steps! (e.g., DNA is in the supernatant/liquid OR DNA is in the pellet). Each step below has a “circle one” option asking where the DNA is! (pellet or supernatant). Note If you understand exactly where your DNA is in each one of the steps, you won’t LOSE your DNA!! Protocol: (make sure you have all reagents before you begin… get ice!!!) 1. Using a serological pipet, pipet out 1.0 to 3 mL (preferably 3 ml) of bacterial culture into a 1.5 ml microcentrifuge tube. Centrifuge this microcentrifuge tube at full speed for 20 seconds. You will see a small pellet form at the bottom of the tube. (You must repeat steps 1-2 to get more than 1 ml worth of cells Where is your DNA?           Pellet or          Supernatant 2. Remove as much media as possible by pouring it off into the Biohazard bag. Do not disrupt the cell pellet! (Repeat steps 1-2 to increase cell concentration: However, 1-2ml of culture should be enough plasmid.) Where is your DNA?           Pellet or          Supernatant 1. Add 250 $\mu$L of ZymoPUREP1 (Red) to the bacterial cell pellet and vortex or pipet the pellet to resuspend it completely. (P1 is stored in the fridge at 4°C. Keep on ice when not in use.) This step involves RNase to purify the DNA by destroying any RNA in the sample. Where is your DNA?           Pellet or          Supernatant 1. Add 250 $\mu$L of ZymoPURE™ P2 (Green) and immediately mix by gently inverting the tube 6-8 times. Do not vortex! Let sit at room temperature for 2-3 minutes. Do not let sit for longer than 3 minutes. (Cells are completely lysed when the solution appears clear, purple, and viscous.) Where is your DNA?           Pellet or          Supernatant • Centrifuge the neutralized lysate for 5 minutes at 16,000 xg (or Max speed). (Do not disrupt the white/pelleted cell debris). 1. Add 275 $\mu$L of ZymoPUREBinding Buffer to the cleared lysate from step 8 and mix thoroughly by inverting the capped tube 8 times. 2. Place a Zymo-SpinII-P Column (Purple ring) in a Collection Tube and transfer the entire mixture from step 9 by pouring or pipetting it into the Zymo-SpinTM II-P Column. 3. Incubate the Zymo-SpinII-P/Collection Tube assembly at room temperature for 2 minutes and then centrifuge at 5,000 xg for 1 min. Discard the flow through in the Biohazard bag. 4. Add 800 $\mu$L of ZymoPUREWash 2 to the Zymo-SpinII-P Column and centrifuge at 5,000 xg for 1 min. Discard the flow through. 5. Add 200 $\mu$L of ZymoPUREWash 2 to the Zymo-SpinII-P Column and centrifuge at 5,000 xg for 1 min. Discard the flow through. 6. Centrifuge the Zymo-Spin™ II-P Column at $\ge$ 10,000 xg (full speed) for 1 min in order to remove any residual wash buffer. 7. Transfer the Zymo-Spin™ II-P Column into a clean 1.5 ml microcentrifuge tube and add 25 $\mu$L of (warmed 50$^{\circ}C$- optional) ZymoPUREElution Buffer directly to the column matrix. Incubate at room temperature for 2 minutes, and then centrifuge at $\ge$ 10,000 xg (full speed) for 1 minute in a microcentrifuge. (warmed buffer and a 5 min incubation may increase plasmid concentrations) 1.03: DNA Double Digestion DNA Double Digestion Protocol Two restriction enzymes are used simultaneously to digest DNA in a single reaction. Reagent name Storage Temperature Distilled Water Room Temp DNA Sample 4°C 10x NEBuffer 2.1 -20°C Restriction Enzyme 1 (EcoRI or XbaI) -20°C Restriction Enzyme 2 (SpeI or PstI) -20°C TIPS BEFORE STARTING: • As you add each reagent to a 1.5 ml microfuge tube, stir it in well with the pipet tip and always change your tip in between steps - NEVER double dip your tip! • *VERY IMPORTANT!* Do not dispense the liquids onto the sides of the tube. Always dispense the volumes into the very bottom of the tube! • Enzymes are stored in glycerol and will never freeze and are ready to be used immediately. They never should be out of the table freezer block or an ice bucket. However, the buffer must be completely thawed before use. (Gently flick the tube and spin the contents to the bottom). You can store the buffers at 4°C but they will only last two weeks. You must keep up with how long your buffer has been at this temperature! Procedure: (Take your time! Make sure you’re doing each step correctly!) 1. Pipette the following into a 1.5 ml microfuge tube: Reagents must be added in the specified order (water is always the first reagent to add!). 25uL final volume reaction system If your DNA concentration is too low you can increase the reaction volume to 40-50 ul. X $\mu L$ of water to get final reaction volume of 25 $\mu L$ X is equal to 25 - (NEB+DNA+Enzyme 1+Enzyme 2) 2.5 $\mu L$ NEB buffer 2.1 $Y\ \mu L$ DNA (usually ~300 ng-Use spectrophotometer to determine concentration and calculate volume needed). Y is equal to 300 ng/DNA Concentration(ng/uL) $1\ \mu L$ BioBricks enzyme 1 (either EcoRI or SpeI) $1\ \mu L$ BioBricks enzyme 2 (either XbaI or PstI) 2. Mix well by pipetting slowly up and down approximately 5x. Be gentle, and do not vortex. Spin the samples for 5 seconds in a balanced microcentrifuge, or flick them to collect the mixture at the bottom of the tube. 3. Incubate at 37 degrees for at least 1 hour.  Samples can be stored at -20 degrees at this point, but DO NOT forget about step 4 before ligation. 4. After digestion, incubate your samples for 80°C for 20 minutes (in heat block). For 3A assembly it is important you heat inactivate your samples after digestion. THIS MUST BE DONE or NOTHING ELSE WILL WORK! 5. Run 5 $\mu L$ of your digested sample in an agarose gel in order to check that your digestion worked. (See Section 1.4 for making/pouring of agarose gel as well as running a gel electrophoresis).  Make sure you run the proper controls with your samples on the gel: (1) a small volume of uncut DNA for each plasmid digested. (2) Also, always run a lane with DNA Ladder! Be sure to clearly label and freeze the remainder of your digestion. This will be used for the ligation step.

textbooks/bio/Biotechnology/Lab_Manual%3A_Synthetic_Biology_Protocols/01%3A_Protocols/1.01%3A_Visual_Representation_of_the_Protocol.txt

Gel Loading and Running using MiniOne Instructions Using agarose gel electrophoresis for the visualization of digested DNA. Video example of pouring and running a gel Reagent name Storage Temperature Agarose Room Temp 1x TBE Room Temp SybrGreen/SybrSafe/GelRed Room Temp (Keep in dark place) Digested DNA $4^{\circ}C$ DNA Ladder Room Temp Loading Dye Room Temp TIPS BEFORE STARTING: Start by making a bottle of 500 ml stock of 1x TBE (C1V1=C2V2) for your team’s running buffer and to make agarose gels. (You can store this for future use- label the bottle clearly!) You will utilize either 10X, 25X or 50X TBE stock buffer– Pay attention to what stock solution you have been provided with! Procedure: 1. You will make 30ml of agarose that is 1X TBE and usually 0.75-1.5% agarose. (See Appendix V for suggestions on what percentage to use.) a. Measure ___ g of agarose (0.75-1.5%) b. Add ___ mL of 1x TBE buffer. 1. Heat gel for 1+ min in microwave – (Use plastic flasks!). Swirl to make sure all crystals are in solution! 2. Let the gel cool for 1 minute. 3. Add 2-3 $\mu L$ of SybrGreen, SybrSafe or GelRed (ask your instructor where this is stored; keep tube in the dark at all times) 4. Let the gel cool for another minute - Do not pour HOT!!!!! 5. Split warm agarose between the two gel containers (you will only need one). Do not forget the combs. 6. Load 5 $\mu L$ of your DNA ladder per gel lane. (Your DNA ladder should preferably be in the first lane of your gel). 7. Load your samples into the wells of the gel, and mark down in your notebook the order in which you loaded the lanes. a. Loading your samples: 5 $\mu L$ of DNA mixed with 1 $\mu L$ of 6x loading dye. Load this directly in the well. 8. Run gel for 20 min in the Gel rig (set up according to diagrams below). While the gel is running, simulate the digest(s) in your lab (physical/digital) notebook, adding the Quick-Load Purple 1 kb Plus DNA Ladder as your ladder and paste the image of the expected gel in your notes. Take a picture of your actual gel results and paste them into your lab notebook. The gel can be visualized in the gel rig (blue light) or for more sensitivity on the UV light box. WARNING: UV light is dangerous. Do not use unless you have talked to your professor! See Appendix V for any questions you might have about the agarose gel or the electrophoresis protocol 1.05: Ligation of Products Ligation of Products Joining of 2 DNA molecules catalyzed by DNA ligase This process forms a phosphodiester bond between the 3’ hydroxyl and 5’ phosphate of adjacent DNA strands, creating recombinant DNA. (NEB) Video example of performing a ligation Materials Storage Temperature Water Room Temp 10X T4 DNA Ligation Buffer -20°C Linearized Plasmid Backbone (Amp,Chlor,Kan,Tet) -20°C Double Digested DNA insert fragments -20°C T4 DNA Ligase -20°C TIPS BEFORE STARTING: An equal (1:1) molar quantity of each insert is best. However, 1 $\mu L$ of each digested insert is commonly used for the ligation and gets consistent results. If your parts are drastically different in size, you may want to adjust for molar quantity. (If you are not getting good results/colonies upon transformation, start looking at changing the molar ratio of your inserts. Use NEBioCalculator to calculate molar ratios.) Procedure 1. Thaw 10X T4 DNA Ligation Buffer at room temperature and then store it on ice until needed. Leave DNA ligase (enzyme) in the freezer block until immediately before it is needed; always keep cold! 2. Always add water and buffer first. Buffer must be fully thawed and mixed before use: 5 $\mu L$ of Water (water up to 10ul, if insert volumes are adjusted) 1 $\mu L$ of 10X DNA ligation buffer 1 $\mu L$ (25ng) linearized plasmid (destination) backbone 1 $\mu L$ of insert A (digested with appropriate enzymes / denatured) 1 $\mu L$ of insert B (digested with appropriate enzymes / denatured) 1 $\mu L$ of T4 DNA ligase (actual enzyme) 3. Incubate at room temperature for 1hr to 2hr. Ligations can go overnight or longer if stored at 4 °C (refrigerated). This works the best. 4. Heat inactivate the reaction at 65°C (or 80°C) for 10 minutes. (Optional but company recommended.) 5. Samples can be stored at -20°C or used immediately in the Zippy transformation protocol. It is best if you immediately transform the 5 $\mu L$ of your reaction into a tube of zippy cells. (Ligation buffer can reduce transformation efficiency. Using more than 5ul may actual decrease transformation efficiency)

textbooks/bio/Biotechnology/Lab_Manual%3A_Synthetic_Biology_Protocols/01%3A_Protocols/1.04%3A_Gel_Loading_and_Running.txt

Cell Transformation: Zippy Transformation of Z-competent Cells Introducing foreign DNA into E. coli bacteria Bacterial transformation is when cells take up foreign DNA from the environment. Cells may express the genetic information they received from this foreign DNA. (ThermoFisher) TIPS BEFORE STARTING: • Depending on the situation, particularly when you get to the analysis phase and you request a different type of bacterial chassis, you will use a variety of competent cells. Be sure you know what cells you are using and if there is a specific protocol for the type of cell. (The competent bacteria described in this protocol are Zippy Competent JM109, ZymoResearch) • Most plasmids carry a marker gene for a specific antibiotic resistance. By supplementing the growth medium with the antibiotic of choice, only cells containing the plasmid of interest will propagate. You must know the antibiotic resistance associated with your plasmid backbone!! (See Appendix I) All competent cells are stored in the -80 freezer. Ask the instructor for help when you are ready to get the competent cells. You must have ICE, first! Materials Storage Temperature Zippy Competent Bacteria Cells -80°C Ligation Mixture fresh / -20°C LB Agar plate w/Antibiotic Room Temp / 37°C SOC 4°C / Room Temp Sterile Glass Beads Room Temp Procedure: Read every step before you begin! 1) Make sure you have a warm plate. Pre-warm by placing it in the 37°C incubator or by taking it out at room temperature before starting the procedure. See color coding (Appendix I) to ensure you have appropriate LB+antibiotic plate type! 2) Get ice, then request cells / Let the cells thaw for 1-2 minutes on ice. – The 50 $\mu L$ of cells can be split into 2 tubes of 25 $\mu L$ each for two different transformations if used immediately to transform different plasmids. (If you don’t have two plasmids to transform, consider sharing with another team.) 3) Before the cells are completely thawed add 1-5 $\mu L$ of ligation (plasmid) mixture directly to the cells (do not add to the side of the tube). For best results add the plasmid ligation to the cells while they are still slushy. 4) Incubate on ice for 5 minutes. 5) Add 200 $\mu L$ of SOC media with no antibiotic to the cell-ligation mix. (SOC amount = ~4X volume of cell + plasmid mix; thus only 120ul needed for 25ul transformation) 6). Incubate with gentle shaking (200-300 RPM) for 1-2 hrs at 37°C. (1 hr will work well but you get a higher transformation efficiency with 2 hr out-growths). Skip this step if using Ampicillin resistance and proceed directly to step 7. 7) Spread transformed cells using glass beads onto a LABELED warmed (22-37°C) plate containing antibiotic. Allow plates to dry (37°C) before flipping plates upside down. (You do not want media/bacteria dripping onto the lid. You can flip plates early the next day, if needed.) 8) Incubate overnight (18-20 hrs) at 37°C. The next day, remove plates from the incubator, seal the lids with parafilm and store at 4°C. The next day: All colonies should be about the same size (diameter). It is not uncommon with 3A assembly to see only 1 to 10 colonies. 1.07: Inoculation Inoculation of Overnight Cultures Small sample of bacteria is taken from a plate and placed in LB broth to be used in ZymoPure miniprep or for long term storage. Materials Storage Temperature Sterile Toothpicks Room Temp LB Broth Room Temp Isolated Colony of Transformed Bacteria Room Temp Procedure: Using sterile technique, pick an isolated colony from a fresh plate (less than seven days old) and inoculate LB-Miller medium. 1. You will use a sterile toothpick to pick the colony, and you can simply drop the entire toothpick into the liquid culture tube. 2. Sterile 5 mL of LB broth will be provided for you for this step. You may add the required antibiotic to the LB prior to inoculating with your colony (optional). 3. Incubate with shaking for 8–16 hours at 37°C before harvesting. This results in maximum yields of a high-copy-number plasmid. (Typically, after overnight incubation, the absorbance of a tenfold dilution of the culture at a wavelength of 600nm (A600) with a 1cm path length should range from 0.10–0.35.) These cultures can now be used in the Mini-prep procedure or stored long term in glycerol. (See Appendix VI for how to make your own glycerol stock.) Growth of Overnight Cultures – Helpful Hints if you are having difficulty. Different culture media will also have a profound effect on the growth of different bacterial strains. Most plasmid DNA purification systems are appropriate for bacterial cultures grown in 1X Luria-Bertani (LB) medium. However, use of a LB-Miller medium containing more NaCl will produce significantly greater yields and is highly recommended. Richer media such as 2X YT, CIRCLEGROW® or Terrific Broth may be used to increase plasmid yields by increasing the biomass for a given volume of culture. Keep the biomass in a range acceptable for the plasmid isolation system used, as overloading may result in poor purity and yield of the plasmid DNA

textbooks/bio/Biotechnology/Lab_Manual%3A_Synthetic_Biology_Protocols/01%3A_Protocols/1.06%3A_Cell_Transformation.txt

LB Plates plus antibiotics (color coding) Green = LB + Ampicillin100* Black = LB + Chloramphenicol35** Blue = LB + Kanamycin50*** Red = LB + Tetracycline10**** Antibiotic Selection Ampicillin (Amp/A) A derivative of penicillin that kills growing cells by interfering with bacterial cell wall synthesis. The resistance gene (bla) specifies a periplasmic enzyme, $\beta$-lactamase, which cleaves the $\beta$-lactam ring of the antibiotic. *Working concentration 100µg/mL; freezer stock 100mg/mL (in water) Chloramphenicol (Chlor/C) A bacteriostatic agent that binds to the 50S subunit of the ribosome and blocking peptidyl transferase and inhibiting peptide bond formation. The resistance gene, chloramphenicol acetyltransferase (cat), specifies an enzyme that renders the antibiotic incapable of binding to the ribosome. **Working concentration 35µg/mL; freezer stock 35mg/mL (in EtOH) Kanamycin (Kan/K) A bactericidal agent that binds to 70S ribosomes and causes misreading of messenger RNA. The resistance gene (kan) specifies an enzyme (aminoglycoside phosphotransferase) that modifies the antibiotic and prevents its interaction with ribosomes. ***Working concentration 50µg/mL; freezer stock 50mg/mL (in water) Tetracycline (Tet/T) A bacteriostatic agent that binds to the 30S ribosome and disrupts codon and anticodon interactions. The resistance gene (tet) specifies a multimeric transporter protein that participates in the rapid efflux of tetracycline from the bacterial cell rendering it incapable of accessing the ribosomes. ****Working concentration 10µg/mL; freezer stock 10mg/mL (in water) 2.02: Appendix II- Using the Denovix How to Use the Denovix Watch the YouTube videos regarding questions for the DeNovix. The Denovix allows you to measure the concentration of DNA, RNA, and protein in a couple of microliters of the solution. It is best to use 1.5$\mu L$ to 2$\mu L$ for accurate measurements. It also has the ability to measure fluorescently labeled molecules. Startup Denovix by touching the screen. Set up parameters for measuring nucleic acid/double stranded DNA (dsDNA). 1. Clean Denovix. Pipette 5-10 $\mu L$ of water on the pedestal (metal part that was under the arm with a hole in the middle), close arm, and then wipe off water with a Kim-wipe(no paper towels). 2. You will now need to measure a blank. (This should be the same liquid your sample is dissolved in). Use the elution buffer you use in your Zymopure miniprep. Lift metal arm and pipette 2$\mu L$ of your blank liquid onto the pedestal. (Avoid introducing bubbles.) 4. Gently lower arm and click on the blank button on the screen. 5. When complete, lift the arm and simply wipe clean with a Kim-wipe (do not use a paper towel!). You are now ready to measure multiple samples. (It is recommended you re-blank the instrument every 30 min.) 6. Add 1.5 or 2$\mu L$ of your DNA sample and click measure on the screen. Note: You do not have to clean with water between samples. Simply wipe the pedestal dry when you are ready for the next sample. Repeat for all samples. 7. Record DNA concentration (ng/$\mu L$), 260/280 and 260/230 ratios for all samples. 260/280 = a ratio of ~1.7- 1.80 is considered pure DNA (most important value) 260/230 ratios are commonly in the range of 2.0-2.2 (can vary a lot) 8. Clean Denovix. Pipette 10 $\mu L$ of water on the pedestal, close arm, and then wipe off water with a Kim-wipe….then close out the program. (Press home button.) What do my values mean? Link to DeNovix Website to learn more: https://www.denovix.com/tn-130-purity-ratios-explained/ • 260/280 Nucleic Acid Purity Ratios “260/280 ratios are routinely used to determine the purity of nucleic acid measurements. This ratio is most commonly used to determine the presence of protein and or phenol in the isolated nucleic acid sample. Table 1 describes a general acceptable range for these ratios; however, they are not a guarantee of sample purity.” • 260/230 Nucleic Acid Purity Ratios “The 260/230 ratio is used to indicate the presence of unwanted organic compounds such as Trizol, phenol, Guanidine HCL and guanidine thiocyanate. Generally acceptable 260/230 ratios are in the range of 2.0 – 2.2. Values higher than this may indicate contamination with the aforementioned compounds.” A 260/280 ratio below 1.5 does not render the DNA unsuitable for any application, but lower ratios indicate more protein contaminants are present which may interfere with downstream steps. 260/230 measure residual contaminants from the purification process. Low ratios may indicate impure DNA that will be less successful in downstream steps.

textbooks/bio/Biotechnology/Lab_Manual%3A_Synthetic_Biology_Protocols/02%3A_Appendices/2.01%3A_Appendix_I-_Antibiotics_and_Color_Coding.txt

How to Use the NanoDrop Watch the YouTube videos regarding questions for the NanoDrop. The NanoDrop allows you to measure the concentration of DNA, RNA, and protein in a couple of microliters of the solution. It is best to use 1.5$\mu L$ to 2$\mu L$ for accurate measurements. Some models have the ability to measure fluorescently labeled molecules. Procedure: 1. Open the NanoDrop software on the computer by double-clicking the “ND-1000” icon that looks a bit like an hourglass 2. Shut down and close the NanoDrop computer. More information on what these NanoDrop values mean: https://tools.thermofisher.com/content/sfs/brochures/T123-NanoDrop-Lite-Interpretation-of-Nucleic-Acid-260-280-Ratios.pdf 2.04: Appendix IV- Using the Qubit How to Use the Qubit Fluorometer Watch the YouTube video regarding questions for the Qubit Fluorometer. The Qubit allows you to measure the concentration of DNA, RNA, and protein in a couple of microliters of the solution. It is best to use 1.5$\mu L$ to 2$\mu L$ for accurate measurements. Some models have the ability to measure fluorescently labeled molecules. Procedure: 1. Calibration: 1. On the “Home Screen,” choose the type of assay for which you want to run the standards. Standards Screen is automatically displayed. 2. The screen will prompt you to choose between reading new standards and using the previous calibration. Press “Yes” to read new standards. 3. 4. Insert Standard #2, and press “Read.” Ensure that you are using the Standard #2 appropriate for the assay you are performing. 5. Calibration is complete. The new standards graph with data points for standards connected by a line appears on the screen. 2. Reading Samples: 1. Choose “Sample” to go on the Sample Screen 2. Insert a sample into the Sample Chamber and press “Read.” The measurement takes approximately 3 seconds. Upon the completion of the measurement, the result is displayed on the screen. The number displayed is the concentration of the nucleic acid in the assay tube. 3. To read the next sample, remove the sample from the Sample Chamber, insert the next sample, and press “Read Next Sample.” 4. Repeat until all samples are read. 2.05: Appendix V- Common Agarose Gel Questions and Tips Common Agarose Gel Related Questions and Tips (http://www.lifetechnologies.com/us/en/home/life-science/pcr/elevate-pcr-research/agarose-content-with-tips-and-tricks.html#2) 1. What Percent Agarose is best? The standard percentage of agarose used to run a DNA gel is usually around 1.0%. A higher agarose percentage enhances the resolution of smaller bands; conversely, a lower agarose percentage gives better resolution and separation of higher-molecular-weight bands. If the wrong percentage is used, it can be difficult to visualize the DNA bands reliably % Gel Optimum Resolution/ Linear DNA (kb) 0.5 30 to 1.0 0.75 12 to 0.8 1.0 10 to 0.5 1.2 7 to 0.4 1.5 3 to 0.2 *For very small parts, 2% gel may be an option. Talk to your instructor about it!* 2. How does gel casting affect the band resolution? The recommended thickness for agarose gel is 3–4 mm; a gel thicker than 5mm will result in fuzzy bands and higher staining background. Similarly, the amount of running buffer to cover over the gel in an electrophoresis apparatus is 3–5 mm. Too much buffer will decrease DNA mobility and cause band distortion. The thickness of the comb is also important and significantly affects resolution. A thin comb (1 mm) gives very well-defined bands, while a thick comb gives thick bands leading to reduced resolution. 3. How much DNA to run (Less is best) The minimal quantity of DNA that may be detected is dependent on the stains used. The maximum quantity of DNA in a band that is still clear and well-defined is approximately 100 ng. 4. What is the right buffer for your agarose gel electrophoresis? The two most popular types of buffers for running agarose gels are Tris-acetate with EDTA (TAE) and Tris-borate with EDTA (TBE). For small DNA (<1000 bp), and if there is no plan to extract the DNA, then 1x TBE buffer is recommended. TBE buffer has a high ionic strength and buffering capacity. TAE buffer, together with low field strength (1–2 V/cm), is preferred for separating large DNA (12–15 kb). TAE buffer interacts with agarose, resulting in lower electroendosmosis, larger apparent pore size, and lower field strength compared to agarose gels in TBE buffer. Buffer must be added to the GEL. 5. Why do I see so many bands? Uncut DNA will typically appear to run faster than fully linearized plasmids. Isolated, uncut plasmid should be in the supercoiled form. The use of restriction enzymes will linearize our plasmids. (http://bitesizebio.com/13524/how-to-identify-supercoils-nicks-and-circles-in-plasmid-preps/) How to identify supercoils, nicks and circles in plasmid preps DNA Ladder (Quick-Load Purple 1kb Plus DNA Ladder, New England Biolabs) 2.06: Appendix IV- Preparing Glycerol Stocks Making a Glycerol Stock ONLY if you have confirmed that your NEW composite part (newly built plasmid) is CORRECT. This means that after conducting a Zymo Miniprep and restriction digest, the new plasmid now contains the parts that you have ligated together. How to make a glycerol stock? 1. Using sterile technique, aliquot 500µL of 80% glycerol into a cryovial (This may or may not have been done already, ask your instructor) 2. Label the cryovial clearly on top or on the side with the part number, the antibiotic resistance (amp, chlor, tet, kan), as well as any other labeling standard your lab uses (LABELING IS VERY IMPORTANT!!) 3. Vortex your culture 4. Carefully add about 500uL (0.5mL) of your culture to the cryovial. Vortex and place the vial on ice. Store the vial in a -80 freezer that has been designated for long term storage.

textbooks/bio/Biotechnology/Lab_Manual%3A_Synthetic_Biology_Protocols/02%3A_Appendices/2.03%3A_Appendix_III-_Using_the_Nanodrop.txt

LB Agar: Making 1 L of LB Agar: • 5 g Yeast extract • 10 g Peptone • 10 g NaCl • 12 g Agar 1. Mix this with 1 L of Distilled H2O 2. Autoclave at 121 °C for 30 minutes (If there is a setting, set it to slow/liquid) 3. Let cool before pouring into plates (approximately 25 mL of agar in each plate) This recipe makes about 40 plates and can be adjusted as needed! LB Broth: Making 1 L of LB Broth: • 25 g pre-mixed broth powder *This powder contains 10 g tryptone, 5 g yeast extract and 10 g NaCl* 1. Mix this with 1 L of Distilled H2O 2. Autoclave at 121 °C for 30 minutes (If there is a setting, set it to slow/liquid) 3. Let cool before pouring into STERILE test tubes with lids (approximately 5 mL of broth per test tube) This recipe makes about 200 tubes of broth and can be adjusted as needed! 3.1.02: Adding Antibiotics *Color coding LB-agar plates is recommended to simplify which plate contains which antibiotic* **Addition of antibiotics to media is done after autoclaving, when the media has cooled to 50-55oC** Ampicillin (Amp/A): *Working concentration 100 ug/mL freezer stock 100 mg/mL (in water) • Add 1 mL of 100 mg/mL ampicillin (dissolved in water) into 1 L of LB broth or agar Chloramphenicol (Chlor/C): *Working concentration 35 ug/mL freezer stock 35 mg/mL (in EtOH) • Add 1 mL of 35 mg/mL chloramphenicol (dissolved in ethanol) into 1 L of LB broth or agar Kanamycin (Kan/K): *Working Concentration 50 ug/mL freezer stock 50 mg/mL (in water) • Add 1 mL of 50 mg/mL kanamycin (dissolved in water) into 1 L of LB broth or agar Tetracycline (Tet/T): *Working concentration 10 ug/mL freezer stock 10 mg/mL (in water) • Add 1 mL of 10 mg/mL tetracycline (dissolved in water) into 1 L LB broth or agar 3.1.03: Linearized Backbone PCR Protocol PCR Protocol for Linearized Backbones *All procedures copied or modified from iGEM’s linear backbone protocol and Q5® Hot Start High-Fidelity 2X Master Mix Protocol* 1. Grow up part BBA_J04450 from the iGem plasmid. Grow 1 part for each different backbone (psB1C3, psB1K3, psB1T3, psB1A3) 2. Isolate the DNA from culture and obtain DNA concentration (via DeNovix/Nanodrop/Qubit) 3. Make PCR reaction mixture for plasmid amplification using the following table: *Keep everything on ice and label PCR tubes before starting. Always add the DNA polymerase last as it will sink to the bottom. Use the 50$\mu L$ reaction for linear backbones. Usually, 1µL of DNA is sufficient. * Component 25 uL Reaction 50 uL Reaction Final Concentration Q5 High-Fidelity 2X Master Mix 12.5 uL 25 uL 1X 10 uM Forward Primer (SB-prep-3P-1) 1.25 uL 2.5 uL 0.5 uM 10 uM Reverse Primer (SB-prep-2Ea) 1.25 uL 2.5 uL 0.5 uM Template DNA (psB1C3, A3, K3, T3) Variable 10 ng < 1,000 ng Distilled Water up to 25 uL up to 50 uL Primers for linear backbone: SB-prep-3P-1 gccgctgcagtccggcaaaaaa, SB-prep-2Ea atgaattccagaaatcatccttagcg Step Temperature Time Initial Denaturation 98°C 30 seconds 25-35 Cycles 98°C 10 seconds 66°C 30 seconds 72°C 3 minutes Final Extension 72°C 1.5 minutes Hold 4°C 1. Digestion: 1. 4 uL 10X NEB Buffer 2.1 2. 1 uL EcoRI-HF 3. 1 uL PstI 4. 1 uL DpnI (Used to digest any template DNA from production) 5. 25 uL PCR Linearized plasmid product (use total amount from purified PCR product) 6. Digest at 37°C for 3 hours 7. Heat kill at 80°C for 20 minutes *Choose a part with a relatively large insert that you know is correct and you have plenty to spare. Digest 300 ng of the plasmid with EcoRI and PstI according to the Double Digestion instruction. Heat inactivate the sample* 1. Ligation: 1. 1 uL purified E/P digested plasmid backbone (25 ng) 2. Equimolar amount of E/P digested fragment (2 uL) 3. 1 uL T4 DNA Ligase Buffer 4. 0.5 uL T4 DNA Ligase 5. Distilled water up to 10 uL 6. Ligate at 16°C for 30 minutes 7. Heat kill at 80°C for 20 minutes *See “Cell Transformation: Zippy Transformation of Z-competent Cells” protocol above for information on how to perform a transformation* Any colonies on the backbone-only control plates represent background to the three antibiotic assembly process. If there are too many, this could present a problem during the student projects. Many colonies on the backbone+insert plates indicate that the backbones are amplified and cut effectively to be ligated to E/P cut inserts.

textbooks/bio/Biotechnology/Lab_Manual%3A_Synthetic_Biology_Protocols/03%3A_Ancillary_Materials/3.1.01%3A_Making_Media_%28LB_Broth_and_Agar%29.txt

DNA Extraction: While many vendors offer mini-prep kits that will work for this step, Zymo provides an excellent kit (Cat#: D4210) with great results at a reasonable price. Materials Amount Needed (Per Reaction) ZymoPURE™ P1 (Red) 250 uL ZymoPURE™ P2 (Green) 250 uL ZymoPURE™ P3 (Yellow) 250 uL ZymoPURE™ Binding Buffer 275 uL ZymoPURE™ Wash 1 800 uL ZymoPURE™ Wash 2 1000 uL ZymoPURE™ Elution Buffer 25 uL Zymo-Spin™ II-P Columns (must have purple ring) 1 Collection Tubes 1 Serological Pipets 2 (at least 2 mL) Microcentrifuge Tubes 3 Centrifuge 1 (used by class) Micropipettes and Tips 100-1000 uL, 10-100 uL, 1-10 uL Ice Bucket 1 UV Spectrophotometer 1 (used by class) 3.1.05: Double Digestion Supplies Double Digestion: Enzymes and buffers are indicated from New England Biolabs. Materials Amount Needed (Per Reaction) Distilled Water 25 uL-(Sum of DNA+NEB+Enzyme1+Enzyme2) DNA Sample Determined by spectrophotometer (300ng/DNA concentration) 10x NEBuffer 2.1 (Cat#: B7202S) 2.5 uL Restriction Enzyme 1 (EcoRI [Cat#: R0101S]) or SpeI [Cat#: R0133S]) 1 uL Restriction Enzyme 2 (XbaI [Cat#: R0145S] or PstI [Cat#: R0140S]) 1 uL Water/Bead Bath (37C) 1 (used by class) Heat Block (80C) 1 (used by class) Microcentrifuge Tube 1 Micropipette and Tips 1-10uL, 2-20uL Microcentrifuge 1 (used by class) 3.1.06: Gel Loading Running Supplies Gel Loading and Running: Materials Amount Needed (Per Reaction) Agarose Varies depending on gel percentage 1x TBE Approximately 165 mL (to make gel and for gel rig) SybrGreen, SybrSafe, or GelRed 2-3 uL Digested DNA 5 uL DNA Ladder (Quick-Load Ladder Cat#: N0550S) 5 uL 6x DNA Loading Dye (Cat#: B7024S) 1 uL Microwave 1 (used by class) Flask 1 (at least 50 mL in size) Micropipette and Tips 1-10 uL Gel Rig (MiniOne; Cat#s: M1000, M1002, M1010, M1012) 1 (with all necessary parts included with the rig) Weigh Tray 1 Scale 1 (used by class) 3.1.07: DNA Ligation Supplies DNA Ligation: Materials Amount Needed (Per Reaction) Distilled Water 5 uL (up to 10 uL) 10X DNA Ligation Buffer (Cat#: B0202S) 1 uL Linearized Plasmid Backbone (Amp,Chlor,Kan,Tet) 1 uL Double Digested DNA insert fragments 1 uL T4 DNA ligase (Cat#: M0202S) 1 uL Ice Bucket 1 Microcentrifuge Tube 1 Micropipette and Tips 1-10 uL Heat Block (80C) 1 (used by class) 3.1.08: Transformation Supplies Transformation: Materials Amount Needed (Per Reaction) Competent Bacteria Cells (JM109= Cat#: T3003) 25-50 uL Ligation Mixture 1-5 uL LB Agar with Antibiotics (either Kan, Chlor, Amp, or Tet) 1 plate (depending on backbone) SOC Media (Cat#: 15544034) 200 uL Sterile Glass Beads Approximately 4-8 beads Ice Bucket 1 Microcentrifuge Tube 1 Shaking Incubator (37C) 1 (used by class) Plate Warmer (37C) (Can be the same as the Shaking Incubator) 1 (used by class) Incubator 1 (used by class) 3.1.09: Inoculation Supplies Inoculation: Materials Amount Needed (Per Reaction) Sterile Culture Tube (with cap) 1 Sterile Toothpick 1 LB Broth 5 mL Lab Hood 1 (used by class) Shaking Incubator 1 (used by class) Antibiotics (Amp, Chlor, Kan, or Tet) Optional (see Appendix I or Instructor’s Notes) 3.1.10: Glycerol Stock Supplies Glycerol Stock: Materials Amount Needed (Per Reaction) 80% Glycerol 500 uL Cryovial (Cat#: 5000-0020) 1 Vortex 1 (used by class) Micropipette and Tips 100-1000 uL

textbooks/bio/Biotechnology/Lab_Manual%3A_Synthetic_Biology_Protocols/03%3A_Ancillary_Materials/3.1.04%3A_DNA_Extraction_Supplies.txt

Linearizing Backbones: Materials Amount Needed: (Per Backbone Reaction) Q5 High-Fidelity 2X Master Mix (Cat #: M0492S) Up to 25 uL 10 uM Forward Primer (SB-prep-3P-1) Up to 2.5 uL 10 uM Reverse Primer (SB-prep-2Ea) Up to 2.5 uL Template DNA (psB1C3, A3, K3, T3) 10 ng Distilled Water Up to 60 uL Thermocycler 1 UV Spectrophotometer 1 Micropipette and Tips 1-10 uL, 0.2-1 uL, 20-200 uL Heat Block (80C) 1 Gel Rig 1 PCR Clean-up Kit (Cat #: D4033) 1 10X NEB Buffer 2.1 4 uL Digestion Enzymes (EcoRI, PstI, DpnI) 1 uL of each Competent Bacteria Cells (JM109= Cat#: T3003) 25 uL LB Agar Plate with Antibiotic (Chlor, Amp, Tet, Kan) 1 plate (depending on backbone) Sterile Glass Beads Approximately 4-8 beads SOC Media (Cat#: 15544034) 200 uL Shaking Incubator (37C) 1 T4 DNA ligase (Cat#: M0202S) 0.5 uL T4 DNA Ligase Buffer(Cat#: B0202S) 1 uL 3.1.12: Tips for Organizing the Lab for Large Classes Preparing for a Class Example of a Lab Room Pre-established Freezer Boxes: It can be helpful to have some already stocked freezer boxes ready for your students before they get into the lab. This can work both for individual students as well as teams. These freezer boxes can be marked via color and assigned to students when the lab has started. The boxes can be pre-stocked with the various reagents your students will need so they will be able to have ready access to them. This CryoSafe Cooler Box (Cat# 03-410-497) should consist of the following reagents: • Restriction enzymes (EcoRI, SpeI, XbaI, PstI) • 10x NEBuffer 2.1 • 10x DNA Ligation Buffer • T4 DNA Ligase It is helpful to have another color coded cardboard freezer box that is empty alongside the reagent box. This way your students will ideally have no problem storing their parts as they move through the protocol as well as ensuring fewer mixups between the various student parts as they are stored. Pre-established Student/Team Work Stations: Much like the freezer boxes, pre-stocked work stations allow for you to be able to provide your students with access to tools/materials such as micropipettes and microcentrifuge tubes. It is helpful to color coordinate a student/team work station with a freezer box. This work station should consist of: • A set of micropipettes (ranging from 1-10 uL to 100-1000 uL) per student • At least one tube rack • A container of microcentrifuge tubes • A Zymo Mini-Prep kit (this can be the kit itself or pre-aliquoted amounts of the reagents) • Sharpie • Pipet tips (a box per type of micropipette) • Any other room temperature reagents you would want easily accessible Before you begin a semester overview The protocols included in this lab manual are part of a Synthetic Biology undergraduate research course (CURE) designed by the authors. The lab presented in this manual is designed for a Genetics or Biotechnology class and has been used at both two-year and four-year institutions. The workflow for the semester long course is shown below. The lab is based off the iGEM genetic engineering competition (iGEM.org). Students are tasked with designing and then engineering a biological device in a bacterium (E.coli) using standardized DNA parts called Bio-Bricks from the iGEM registry. The process of engineering the device requires iteration of standard molecular biology cloning techniques which are outlined in this lab manual, some including video protocols. Additionally, provided are appendices with recipes for reagents, supply/resources list, and instructor recommendations. Instructors are encouraged to watch a series of implementation videos created for the Arkansas-CURE Projects Synthetic Biology faculty training workshop. Support for this manual was provided by: Support was provided by the Center for Advanced Surface Engineering, under the United States National Science Foundation Grant No. IIA-1457888 and the Arkansas EPSCoR Program and by the Cell Biology Education Consortium an NSF-RCN-UBE (Grant No. 1827066). We thank Malcom Campbell and the Genome Consortium for Active Teaching (GCAT) for introducing us to Synthetic Biology.

textbooks/bio/Biotechnology/Lab_Manual%3A_Synthetic_Biology_Protocols/03%3A_Ancillary_Materials/3.1.11%3A_Linearizing_Backbone_Supplies.txt

Objectives • Define Biotechnology • Describe the responsibilities of departments in a biotechnology company • Distinguish between quality assurance and quality control job functions • Discuss quality as it relates to the customer • Understand the basis for the importance of quality in a company • 1.1: Introduction to Biotechnology According to the United Nations Convention on Biological Diversity, biotechnology is “any technological application that uses biological systems, living organisms, or derivatives thereof, to make or modify products or processes for a specific use." The concept of “specific use” typically involves a commercial application or benefit to humanity. Genetic engineering, artificial selection, antibiotic production, and cell culture are current topics of study in biotechnology. • 1.2: Modern Applications to Biotechnology Recent advances in biotechnology are helping us prepare for and meet society’s most pressing challenges. According to the FDA, there are over 19,000 prescription drug products approved for marketing. More than 13.3 million farmers around the world use agricultural biotechnology to increase yields, prevent damage from insects and pests, and reduce farming's impact on the environment. • 1.3: The Structure of a Biotechnology Company A typical biotechnology company will employ an array of people with credentials and experience in these disciplines. These scientists and technicians may work in a laboratory setting performing research while others may lend their expertise to other departments such as Production, Quality Control, or even Marketing. The type and number of specialized departments within a biotechnology company, as well as the way talent is distributed across them, depends on the type of company it is. • 1.4: How is Quality Involved Company-Wide? A quality product is the result of a quality company involving every member of the company from the shipping and receiving, to marketing, in addition to any of the wet-lab job duties. This section address a summary of Total Quality Management in a company. • 1.5: An Introduction to Quality For businesses to succeed in such a competitive and demanding market, they need to formulate a way to do what they do faster, better, and cheaper than the competition. Their survival depends on it. Understanding quality and quality systems are what can give businesses the edge they need to succeed and compete. • 1.6: Quality Principles Most quality systems are based on the marriage of two main quality principles; Total Quality Management and Continuous Improvement. Meaning, the customer determines quality specifications, everyone in the company is responsible for product quality, and there is a formal process to continually improve the processes to ensure quality products. • 1.7: Quality Systems and Approaches Many companies follow quality systems and standards to help them meet the needs of the customer. We will go in-depth into the quality methodologies, which are important in the biosciences in a later chapter. Below is a brief mention of some common quality methodologies found in biomanufacturing. We will explore why a company would take on additional quality systems beyond what is required by law! • 1.8: Quality (Professional) Organizations There are prominent quality professional organizations of note, such as ASQ and RAPS. Quality organizations help regulatory professionals stay connected to professional development opportunities and certifications so they may stay current in a rapidly changing regulatory landscape. 01: Introduction to Biotechnology and Quality Assurance What is Biotechnology? According to the United Nations Convention on Biological Diversity, biotechnology is “any technological application that uses biological systems, living organisms, or derivatives thereof, to make or modify products or processes for a specific use." The concept of “specific use” typically involves a commercial application or benefit to humanity. Genetic engineering, artificial selection, antibiotic production, and cell culture are current topics of study in biotechnology. However, humans were using microbes to create useful products long before Karl Ereky, a Hungarian engineer, coined the term biotechnology. Some of the products of this early biotechnology are as familiar as cheese, wine, yogurt, and beer, which employ microbes, such as yeast, a fungus (Figure \(1\)). Early Biotechnology Cheese production began around 4,000 to 7,000 years ago when humans began to breed animals and process their milk. Fermentation, in this case, preserves nutrients: Milk will spoil relatively quickly, but when processed like cheese, it is more stable. As for beer, the oldest records of brewing are about 6,000 years old and were an integral part of the Sumerian culture. Evidence indicates that the Sumerians discovered fermentation by chance. Wine has been produced for about 4,500 years, and evidence suggests that cultured milk products, like yogurt, have existed for at least 4,000 years. In the early twentieth century, scientists gained a greater understanding of microbiology and explored ways of manufacturing specific products. In 1917, Chaim Weizmann first used a pure microbiological culture in an industrial process that of manufacturing corn starch using Clostridium acetobutylicum to produce acetone, which was used to manufacture explosives during World War I. Shortly after that, in 1928, Alexander Fleming discovered the mold Penicillium. His work led to the purification of the antibiotic compound formed by the mold by Howard Florey, Ernst Boris Chain, and Norman Heatley – to form what we today know as penicillin. In 1940, penicillin became available for medicinal use to treat bacterial infections in humans. The New Biotechnology The field of modern biotechnology is generally thought of as having been born in 1971 when Paul Berg's experiments in gene splicing had early success. Herbert W. Boyer Stanley N. Cohen significantly advanced the new technology in 1972 by transferring genetic material into a bacterium, such that the imported material would be reproduced, giving birth to the field of recombinant DNA technology. The commercial viability of a biotechnology industry was significantly expanded on June 16, 1980, when the United States Supreme Court ruled that a genetically modified microorganism could be patented. Technology breakthroughs since the 1980s, such as Polymerase Chain Reaction, Sanger Sequencing, Whole Genome Sequencing, and more recently, CRISPR have brought forth a new age of Biotechnology and products. Explore! New approaches to Biotechnology: Watch this video!: youtu.be/V0rIP_u1JPQ Test Your Knowledge! 1. In your own words, define biotechnology 2. Can you think of a biotechnology product that has improved your life? What makes it a biotechnology product?

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/01%3A_Introduction_to_Biotechnology_and_Quality_Assurance/1.01%3A_Introduction_to_Biotechnology.txt

Biotechnology: Healing, Fueling, and Feeding the World According to the FDA, there are over 19,000 prescription drug products approved for marketing. More than 13.3 million farmers around the world use agricultural biotechnology to increase yields, prevent damage from insects and pests, and reduce farming's impact on the environment. Also, biorefineries are built across North America to test and refine technologies to produce biofuels and chemicals from renewable biomass, which can help reduce greenhouse gas emissions. Recent advances in biotechnology are helping us prepare for and meet society’s most pressing challenges. Heal the World https://www.bio.org/healthcare Biotech is helping to heal the world by harnessing nature's toolbox and using our genetic makeup to heal and guidelines of research by: • Reducing rates of infectious disease; • Changing the odds of serious, life-threatening conditions affecting millions around the world; • Tailoring treatments to individuals to minimize health risks and side effects; • Creating more precise tools for disease detection & combating serious illnesses Fuel the World www.bio.org/industrial-environment Biotech uses biological processes such as fermentation and harnesses biocatalysts such as enzymes, yeast, and other microbes to become microscopic manufacturing plants. Biotech is helping to fuel the world by: • Lowering the temperature for cleaning clothes and potentially saving \$4.1 billion annually; • Reducing the use of and reliance on petrochemicals; • Using biofuels to cut greenhouse gas emissions by 52% or more; • Decreasing water usage and waste generation; and • Tapping into the full potential of traditional biomass waste products. Feed the World https://www.bio.org/food-agricultural-biotechnology Biotech improves crop insect resistance, enhances crop herbicide tolerance, and facilitates the use of more environmentally sustainable farming practices. Biotech is helping to feed the world by: • Generating higher crop yields with fewer inputs; • Lowering volumes of agricultural chemicals required by crops • Using biotech crops that need fewer applications of pesticides • Developing crops with enhanced nutrition profiles that solve vitamin and nutrient deficiencies; • Producing foods free of allergens and toxins such as mycotoxin; and • Improving food and crop oil content to help improve cardiovascular health. 1.03: The Structure of a Biotechnology Company A typical biotechnology company will employ an array of people with credentials and experience in these disciplines. These scientists and technicians may work in a laboratory setting performing research while others may lend their expertise to other departments such as Production, Quality Control, or even Marketing. The type and number of specialized departments within a biotechnology company, as well as the way talent is distributed across them, depends on the type of company it is (agricultural, medical, environmental, and so on) and whether it is marketing a service or a product. Let’s take a closer look! Explore! Take the Amgen Tour! www.amgenbiotech.com/index.html The Research and Development (R&D) Department In these laboratories, you will find Research Scientists working alongside technicians towards a common goal: to create new products and processes and improve upon existing ones. The R&D Department is where most of the creative problem solving takes place. In some companies, Research is split off from Development. In that instance, the Research Department focuses on the discovery of new products and processes, while the Development department helps transition the discoveries from the research phase into the product production phase. The Production Department Once a product has been researched and developed, it becomes the responsibility of the Production Department to manufacture it. Production requirements will depend on the type of product being manufactured. At a medical biotechnology company, the Production department may resemble a large-scale laboratory if the products in production, say a bacterium, for example, are grown as cultures. In a company producing medical equipment, the production department is more likely to resemble a cleanroom with people and machinery working together to assemble the parts. Job titles in this area might be Manufacturing Operator, Technician or Supervisor, Production Technician, or Pilot Plant Operator or Technician. The Quality (QA/QC) Department The Quality Department establishes guidelines to monitor manufacturing processes and examining in-process and finished products to ensure adherence to quality standards. These tasks are typically split across two departments: Quality Assurance and Quality Control. Quality Control (QC) QC has a limited function in the company and is responsible for the testing or sampling in compliance with the specifications determined by QA. During production, the QC technicians will sample and test at many stages, including the equipment and facilities. They will be trained in appropriate techniques, such as operating equipment and performing assays, and adhering to regulations. They will be monitored and supported by QA, who hold the final responsibility for releasing the product. Thus, the QC organization has specific responsibilities that center around following the direction given by the QA organization. Quality Assurance QA is the function that sets up the systems and methods for “assuring” the quality of the product. The product is determined by the methods of manufacture, and QA deals with the manufacturing process to “build quality" into the product through the control, evaluation, and audit of a manufacturing system. The QA department of a manufacturing company is ultimately responsible for all the factors involved to make sure that the customer receiving the product will be satisfied. Quality Documentation The documentation aspect of QA is broad and varied. A well-run company has a clear paper trail for every aspect of production. Examples of quality documents include regulatory submissions, auditing records, employee training documents, quality control, and environmental testing, and product batch records. Quality Control Quality Assurance 1. monitor equipment, environment, personnel, and product 2. test samples of the product and the materials that go into making the product to determine whether they are acceptable 3. compare data to established standards 1. review all production procedures 2. ensure that all documents are accurate, complete, and available 3. decide whether to approve the product for release to consumers 4. review customer complaints

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/01%3A_Introduction_to_Biotechnology_and_Quality_Assurance/1.02%3A_Modern_Applications_to_Biotechnology.txt

A quality product is the result of a quality company involving every member of the company from the shipping and receiving, to marketing, in addition to any of the wet-lab job duties. Below is a summary of Total Quality Management in a company. More on this quality philosophy later in the course. Engineering or Research & Development (R&D) New and existing products are designed, developed, and evaluated by R&D. A company’s Quality Department may partner in the process in the following ways: • Establish safety as a formal design parameter. • Review designs for safety • Verify that the design meets all government and industry standards. • Monitor all material and material substitutions to make sure they meet all safety codes. • Review the tracking method(s) in place for product traceability. Marketing (Sales) Product information must be up-to-date and accurate, including sales materials and user manuals. Quality can assist in this area by ensuring that all the following occur: • All sales and marketing materials are evaluated for clarity, accuracy, and regulatory compliance. • Products are properly packaged & labeled (e.g., with warnings, directions, and storage). Manufacturing Quality may assist manufacturing in the following ways: • Inspect & test product before shipping to confirm that it meets established specifications • Provide training for workers to meet safety and quality standards. • Audit the manufacturing process • Provide feedback to upper management about production and product safety. • Document product test results. • Ensure calibration of test equipment. • Schedule and perform tests. Evaluate results. 1.05: An Introduction to Quality Why is quality necessary? Making the connection between what a customer wants and what a company provides is essential for a successful business. How does managing quality fulfill customers’ needs and expectations? For businesses to succeed in such a competitive and demanding market, they need to formulate a way to do what they do faster, better, and cheaper than the competition. Their survival depends on it. Understanding quality and quality systems are what can give businesses the edge they need to succeed and compete. Quality may mean different things to people. If you asked several people to define quality, you would most likely get different answers because each person values items or processes in their way. What one person feels is important; another person may not. You have probably experienced this at home or with friends. There are likely different views in your family on how to clean the bathroom and the quality of the cleanliness. Quality is a Customer Determination Many prominent contributors in the field of quality use various definitions and meanings of the word Quality. One definition of quality is provided by one prominent quality pioneer, Armand Feigenbaum. In his comprehensive text on the subject, Total Quality Control, Armand states that: “Quality is a customer determination based on the customer’s experience with the product or service, measured against his or her requirements – stated or unstated, conscious or merely sensed, technically operational or entirely subjective – and always representing a moving target in a competitive market.” (Summers, 2010) Several principles stand out in this view of quality No two customers will have the same expectation for the same product, and one customer’s needs may even change over time as they use the product. Companies must solicit feedback from their customers and respond to their needs even as they change. • Customer Determination: Only a customer can decide how well a product meets their needs. • Experience: A customer will determine the quality of a product using the product. • Requirements: Necessary aspects of the product may be stated or unstated by the customer. • Technically operational: Aspects of a product may be identified verbally by the customer. • Entirely Subjective: Aspects of a product may be conjured in a customer’s personal feelings. Corporate Culture & Quality Corporate culture is an important aspect of a good quality product. A successful company has a clear vision statement (how they see themselves in the future), which helps them create a cohesive atmosphere of shared value systems with both their employees and customers alike. A mission statement is developed to support the organization’s vision. The mission statement should be short, complete, and timeless. Many companies incorporate a value (or philosophy) statement that relay to the customer core beliefs and guiding principles of the company. Companies will frequently have also a quality statement or quality policy outlining their dedication to a quality product. Explore! Amgen is a worldwide biopharmaceutical company. Review their quality statement: www.amgen.com/about/how-we-operate/policies-practices-and-disclosures/business-conduct/quality/ As a customer or prospective employee, what do you think about these? Do they influence how you feel about purchasing their product or working at their company?

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/01%3A_Introduction_to_Biotechnology_and_Quality_Assurance/1.04%3A_How_is_Quality_Involved_Company-Wide.txt

In the next few chapters, we will investigate different quality philosophies and quality systems. Most quality systems are based on the marriage of two main quality principles; Total Quality Management and Continuous Improvement. Meaning, the customer determines quality specifications, everyone in the company is responsible for product quality, and there is a formal process to continually improve the processes to ensure quality products. "Total Quality Management (TQM) is a management approach that emphasizes continuous process and system improvement as a means of achieving customer satisfaction to ensure long-term company success.” (Summers, 2010). TQM is not a temporary fix or used for short-term problem-solving. It is a long-term, deeply committed management style that is dedicated to the improvement of the process of an unwavering commitment to meeting the customers’ needs. “The Continuous Improvement (CI) philosophy focuses on improving processes to enable companies to give customers what they want the first time, every time.” (Summers, 2010) This customer-focused philosophy is a flexible one emphasizing customer service, teamwork, and problem-solving. 1.07: Quality Systems and Approaches Many companies follow quality systems and standards to help them meet the needs of the customer. We will go in-depth into the quality methodologies, which are important in the biosciences in a later chapter. Below is a brief mention of some common quality methodologies found in biomanufacturing. Note – not all quality systems are mandated by law – some are voluntary! We will explore why a company would take on additional quality systems beyond what is required by law! • Current Good Manufacturing (CGMP) is a set of FDA-enforced manufacturing guidelines, which oversee the production of biotechnology products. The goals of CGMP regulations are to ensure product quality, safety, and regulatory compliance. • ISO9000 is a quality standard that has been developed to provide guidelines for improving quality management systems. Eight key principles are integrated into ISO9000 standards: customer-focused organization, leadership, involvement of employees, process approach, systems approach to management, continuous improvement, factual decision-making, and mutually beneficial supplier relationships. • Six Sigma is a methodological strategy that deals with product and system failures. To increase system reliability and reduce failure, companies utilize a rigorous process improvement methodology, Define-Measure-Analyze-Improve-Control, which encourages management decisions based on data. • Lean production focuses on removing waste from production processes. Lean workers recognize the seven forms of waste: Producing defective parts, producing more parts than needed, excessive inventory, unnecessary activities, unnecessary movement of people, unnecessary transportation or handling of materials, and people waiting. 1.08: Quality (Professional) Organizations There are prominent quality professional organizations of note, such as ASQ and RAPS. Quality organizations help regulatory professionals stay connected to professional development opportunities and certifications so they may stay current in a rapidly changing regulatory landscape. One example of a worldwide quality professional organization is RAPS (Regulatory Affairs Professionals Society). RAPS focus is on Regulatory Affairs training and certification as a non-lobbying nonprofit both nationally and worldwide. To learn more, visit their website here: www.raps.org/. To keep on top of Regulatory issues in the news, visit their news trends page: www.raps.org/news-trends/ Explore! Professional Quality Organizations 1. Look up the website for the American Society for Quality and give a brief description. 2. How can you use this site to help you learn more about Quality principles? 3. What is ASQ, and what do they do? In your own words, discuss their vision.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/01%3A_Introduction_to_Biotechnology_and_Quality_Assurance/1.06%3A_Quality_Principles.txt

Objectives • Identify significant contributions to the field of quality • Evaluate Total Quality Management • Apply the Plan-Do-Check-Act Cycle • Understand and apply Juran’s ‘fitness for use’ definition of quality • Distinguish between inspection, audit, surveillance, prevention • 2.1: History of Quality Quality philosophies have been around for as long as humankind. Standards of quality were necessarily different thousands of years ago and, some might say, lower by our standards today. Where you and I might throw away a half-rotten apple, the nomadic cave dweller would likely judge the unspoiled half as a great dinner. • 2.2: Quality Pioneers Good quality management techniques are as numerous and varied as the types of biotechnology companies that use them. Most companies will lean towards a ‘favored' quality philosophy, but few rely on just one. It is much better to draw from several schools thought. We will present some of the major contributors to the field of quality below. You are encouraged to research more on these pioneers' interesting backgrounds! • 2.3: The Juran Trilogy Dr. Joseph Juran was one of the foremost experts in the area of quality. Juran believed that to achieve quality, you must start with organizational goals, policies, and vision. Converting organizational goals into results is accomplished through three managerial processes called the JURAN TRILOGY: Quality Planning, Quality Control, and Quality Improvement (The Juran Institute, 2016). • 2.4: Feigenbaum - Total Quality Management (TQM) • 2.5: Company Culture and Employee Needs Quality professionals are limited in their ability to alter the culture of a manufacturing organization. For real change to occur, everyone in the organization must be motivated to change. A successful company takes care of its employees' basic needs by cultivating a culture of respect, fairness, and rewards for a job well done. These key ingredients are powerful motivators that inspire employees to work hard and conscientiously for the company. • 2.6: Establishing Quality Control - The Essentials Every company develops a routine way of doing things, but what happens when the way they are doing things no longer works for reasons out of their control? What if the market changes? What happens when the customer needs change? What about the needs of their workforce? How an organization adapts to a rapidly changing market and customer base is crucial to its survival. • 2.7: Inspection, Audit, and Surveillance • 2.8: Validation of Processes and Equipment • 2.9: Nonconformance When a process, product, or raw material is out of specification, it is called a nonconformance. Inspections, audits, and surveillance will occasionally uncover nonconformance or defects. Nonconformance problems are placed in one of three categories based on the product defect: critical, major, and minor. 02: Introduction to Quality Principles Quality philosophies have been around for as long as humankind. Standards of quality were necessarily different thousands of years ago and, some might say, lower by our standards today. Where you and I might throw away a half-rotten apple, the nomadic cave dweller would likely judge the unspoiled half as a great dinner. Quality Reputation Areas of expertise in quality inevitably evolved alongside the division of labor into hunting and gathering, and this knowledge was passed down from generation to generation. It evolved further still as humankind began to settle into relatively permanent locations and start the practice of agriculture. Settlements grew into villages with full-fledged marketplaces where a buyer could come to inspect a producer's product and provide immediate feedback as to its quality. There was no intermediary between buyer and seller. The consumer and producer usually lived in the same village. Hence, the producer had a personal stake in maintaining quality: his reputation. A buyer could quickly spread the news of a poor-quality product by word of mouth. The Effects of Growth on Commerce As population growth transformed villages into towns and cities, and new routes and methods of transport opened to expand trade into larger geographical regions. A producer and consumer living in the same village could rely on oral warranties and face-to-face meetings to resolve quality concerns, but what happened when the two lived many miles apart from each other? Here we see the birth of the "intermediary" or wholesaler, and the idea of the written warranty. The wholesaler became a kind of communications liaison between buyer and seller in that he not only transported and sold products on behalf of the producer but also negotiated quality specifications between the two. In the case of material goods, for example, a buyer could specify requirements to a wholesaler who would report those conditions back to the manufacturer. Naturally, conflicts arose in this area due to differing ideas between buyers and sellers when it came to issues of quality and quality testing. Hence, the concept of establishing standards of quality testing and inspection evolved out of necessity, which inevitably led to the standardization of measuring instruments and the need to calibrate them as well. A good example of this is the ancient Egyptian unit of measure known as the "cubit." The cubit was determined to be the length of the Pharaoh's forearm. Measuring sticks were made to match this length and subsequently used by every architect as a standard measuring tool. Soon after that, the idea of the "Mark" or "Seal" was developed as a means of identifying and tracing the origins of a product. The seal gave buyers a modicum of assurance as to the quality of a product. This approach to quality assurance is with us even today. Meat and dairy products, for instance, come stamped as "USDA Approved." Likewise, the various electronic appliances we use every day are tested to meet such standards as the ANSI specification. An Early Example of Quality Control In ancient Rome, bridge engineers were required to stand under their finished product while the bridge was weight-tested by various types of traffic. Although this was a very harsh method of ensuring quality, it worked given that many of those structures still stand to this day. What the Romans understand very well was the necessity of holding people accountable for quality products. As skillful as the Romans were, however, their philosophy of quality lacked an understanding of the need to set standards and specifications that did not change over time or at the whim of individual judgment. This was true not just of the Romans but most other cultures. It was not until the industrial revolution that we begin to see notions about quality mature towards the idea of controlling for consistency in the manufacturing process. The Industrial Revolution Efforts towards developing a means of mass production arose in the United States during the Civil War when the U.S. government contracted with Eli Whitney to manufacture 700 muskets with interchangeable parts. The hope was that, by setting standard specifications for each piece, the natural variations introduced by handcrafted production is reduced enough to allow failing parts to be replaced in the field. The central idea of mass-producing identical, interchangeable parts carried forward even though Whitney's attempt to solve the problem was a relative failure with only 14 muskets correctly assembled. Most products continued to be crafted and inspected one at a time by individual artisans and craftspeople until Henry Ford revolutionized the manufacturing industry with the introduction of the assembly line. No longer was production the responsibility of one person. Instead, dozens of workers operated the assembly process, and the responsibility for quality assurance fell to supervisors. As growth continued, the average number of employees on an assembly line climbed into the hundreds, and quality became the responsibility of an entire inspection department. The increase in numbers beyond this point leads to the introduction of statistical sampling in today's manufacturing environments. The Effect of Culture on Quality: The Taylor Method Changes in production methods were not the only factors affecting quality control. A growing need for skilled workers coincided with the influx of non-English speaking immigrants to the U.S. from 1860-1920. Differences in language, culture, and skills among these workers introduced new variables into quality control. Many of these immigrants had never seen nor worked on an assembly line, and language differences presented a clear challenge when it came time to train them. A mechanical engineer by the name of Fredrick Taylor was the first to address this problem by automating each part of the manufacturing process into a series of repeatable steps these workers could learn and execute only by watching and then doing. Taylor eliminated the need for any assembly line worker, English speaking or not, to do anything other than learning their steps by rote and perform them robotically. Issues of quality became the sole authority of management. Workers' feedback on such matters was often ignored and usually dismissed entirely. This polarized and often created an adversarial relationship between labor and management, which continues in many industries even to this day. After World War II Manufacturing industries across Europe and Asia (specifically Japan) were devastated in the aftermath of the Second World War. In those countries where the war was fought on their soil, entire factories were decimated. The American manufacturing industry, however, was unharmed and meant a huge surge in U.S. dominance in manufacturing as no other country could fill the resultant worldwide shortage of goods. It also meant that producers of goods in the U.S. had the luxury of dictating product requirements and quality to the public rather than responding to the type of feedback that would otherwise inform a genuinely competitive marketplace. It was not until foreign companies recovered and targeted this weakness in U.S. attitudes that U.S. businesses succumbed to paying better attention to customer needs. Where U.S. industries remained cavalier about product quality, overseas companies, particularly Japanese firms, solicited customer feedback and willingly responded to those needs and demands. They also developed management philosophies that respected the needs of labor. It was not long before these foreign companies began to outperform the U.S. in manufacturing. The steel industry in Japan, for example, thrived while in the U.S., many companies faced insolvency and were forced to lay off their workers. Need for Quality in Today’s Business Environment By the 1980s, the U.S. manufacturing industry had lost so much ground that it was no longer considered the leader in the production of consumer goods. Nowhere was this fact clearer than in the automobile industry. Year after year, sales of domestic vehicles slipped as the Japanese and Koreans outpaced the U.S. in price, quality, and customer satisfaction. Quite simply, these foreign manufacturers took their cue from the lessons that American businesses continued to ignore – the most important one being the necessity of committing to quality and quality control. Quality plays the deciding role in a company’s ability to mass-produce competitive products at a level of quality and at a price point that satisfies both the consumer’s needs and the company’s profit margin. Companies focus on quality in three major areas: 1. Marketing: The features or "bells and whistles" of a product might be highlighted, but the consumer responds better when quality is used as a selling tool. 2. Profit: Improve manufacturing methods and training of employees on the production line helps increase profit by reducing waste. 3. Liability: Quality programs identify and limit areas of potential liability.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/02%3A_Introduction_to_Quality_Principles/2.01%3A_History_of_Quality.txt

Good quality management techniques are as numerous and varied as the types of biotechnology companies that use them. Most companies will lean towards a ‘favored' quality philosophy, but few rely on just one. It is much better to draw from several schools thought. We will present some of the major contributors to the field of quality below. You are encouraged to research more on these pioneers' interesting backgrounds! Dr. Walter Shewhart (1891-1967) Dr. Walter Shewhart developed statistical methods that are applied to improve quality processes that provide both goods and services. While at Bell Laboratories, Dr. Shewhart was the first to encourage the use of statistics to identify, monitor, and determine the source of variation found in repetitive processes. His work was to target and remove sources of variation. Dr. Shewhart recognized two sources of variation in a process: controlled and uncontrolled variation. Controlled variation is internal to the process and is also referred to as common causes. In an uncontrolled variation, the source is external to the process and known as assignable causes. Dr. Shewhart believed that once a process is under control process is predicable. The most influential contribution of Dr. Shewhart is statistical process control charts. These charts provide a framework for monitoring the behavior of a manufacturing process and provide feedback to help an organization improve the process. In figure 2.1 is a p-chart tracking the number of non-conforming units in a sample. The red dots indicate points that are outside allowable quality parameter. To learn more about the seven basic tools of quality control: https://en.Wikipedia.org/wiki/Control_chart Dr. W. Deming (1901-1993) Dr. W. Deming was one of the preeminent figures in the quality control profession. Deming worked as a consultant to the U.S. War Department during World War II. After the war, he adapted the technique he had developed for quality improvement in the War Department to private industry. This method centers on statistical controls on manufacturing processes and cooperation between management and labor. Deming believed that most quality problems were generated by management and created a philosophy to facilitate quality improvement in a company through better management. Mass inspection of the product was replaced by statistical methods, extensive training of personnel, and two-way communication between the workers and management. Deming pushed for a cooperative atmosphere between the employees and management by increasing the employee's status through encouraging participation in solving problems and giving the training to facilitate this. The W. Edwards Deming Award for Quality is a national award presented annually in Japan to the company that has demonstrated the greatest quality improvement effort and to the individual who has been responsible for the most significant quality improvement. Plan-Do-Check-Act Cycle Popularized by Deming, the Plan-Do-Act (PDCA) Cycle, also known as the Shewhart Cycle, is a four-step process for quality improvement and can be used as a model for improvement of a current project or when starting a new improvement project. The PDCA is based on the scientific method, and an updated version of the cycle will sometimes include “observation” (OPDCA) for emphasis on the concept that observation is what led to starting the process for improvement and is a cycle for continuous improvement. 1. PLAN: The first step is to develop a plan to effect improvement. What are the objectives and desired results? What are the resources that can be used to implement the plan? 2. DO: In the second step (do), a small-scale plan is carried out. Data is collected to see how the plan worked. 3. CHECK: In the third step (check), the data collected in the DO phase is evaluated for effectiveness. Here is where a gap analysis can be performed. Data is frequently graphed for trend analysis. 4. ACT: Sometimes called adjust, the last step (Act), an action is taken to effect change in the process. Are there are any disparities between the Plan and Do? Root cause analysis is helpful at this phase. At this step, you use what is learned to tackle new improvement projects, and the cycle continues. Test Your Knowledge! Using your results/grade from your first homework grade, create a Plan-Do-Check-Act Cycle for improving your study approach.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/02%3A_Introduction_to_Quality_Principles/2.02%3A_Quality_Pioneers.txt

Dr. Joseph Juran (1904-2008) Dr. Joseph Juran was one of the foremost experts in the area of quality. Juran believed that to achieve quality, you must start with organizational goals, policies, and vision. Converting organizational goals into results is accomplished through three managerial processes called the JURAN TRILOGY: Quality Planning, Quality Control, and Quality Improvement (The Juran Institute, 2016). To learn more about Juran, visit the Juran Institute. Quality Planning “Quality does not happen by accident; it must be planned.” Quality planning is the structured process of designing products and services to meet new goals and ensure that customer needs are met. Quality Planning Steps: 1. Establish the project. 2. Identify customers. 3. Discover the customer’s needs. 4. Develop the product. 5. Develop the process. 6. Develop the controls and transfer to Operations. Quality Control Quality control is a universal managerial process for conducting operations to provide stability, to prevent adverse change, and to "maintain the status quo." Quality control can also be described as "a process for meeting the established goals by evaluating and comparing actual performance and planned performance and taking action on the difference." The quality control process: 1. Choose a control subject. 2. Establish Measurement. 3. Establish Standards of Performance. 4. Measure Actual Performance. 5. Compare to Standards (interpret the difference). 6. Act on the difference. Quality Improvement "All improvement takes place project by project." Quality improvement is the process of creating breakthrough levels of performance by eliminating wastes and defects to reduce the cost of poor quality. Steps to Quality Improvement: 1. Prove the need for improvement. 2. Identify the improvement projects. 3. Establish project improvement teams. 4. Provide project teams with resources. Juran’s Fitness for Use Quality begins with whom, how, and why customers will use a product; all improvement activities should be customer-focused. Juran’s fitness for use definition of quality means the product should be a good price, work well for the customer, be distributed efficiently from the producer to the customer, and be supported efficiently by the company. Juran’s four components of product fitness: 1. Quality of Design: A successful company conducts market research and creates satisfied customers by building their needs into the product design. The quality of design must also consider the intended functions of the product and the type of conditions in which it will perform. Another consideration affecting the quality of the design is cost. How much will it cost to make the product? 2. Quality of Conformance: Does the manufacturing process adhere to specifications? Attention to conformance can be a vital tool and decrease the cost of manufacturing as it reduces the likelihood of these types of catastrophic failures. 3. Availability: In the customer's view, availability and reliability are often synonymous. For example, if a customer attempts to order a laboratory instrument only to find out that the product is out-of-stock and will be on backorder for a month, his level of customer satisfaction goes down. Quality, as it relates to availability, can be a matter of maintaining inventory and ensuring availability as in the above example, and it can also be an issue of speedy shipping and have a good distribution infrastructure. 4. Field Service: Field service personnel are, typically, the technicians who deliver, install, and set up products, providing training to the customer on proper use and maintenance. Philip Crosby (1926-2001) Philip Crosby was an American-born author and business executive, noted for his contributions to the management of "quality crises." He is credited with effecting a 30% reduction in costs incurred through scrap waste when he served as the lead quality control manager for the Pershing Missile program. Later in his career, when the U.S. manufacturing industry faced a quality crisis and stiff competition from the Japanese, he responded with the creation of the DIRFT principle. Short for "doing it right the first time." Crosby’s DIRFT philosophy on quality: 1. Quality means conformance to requirements. 2. Quality systems should focus on the prevention of nonconformance. 3. The performance target should be "zero defects." 4. The cost of nonconformance should be the standard by which quality is measured. Ultimately, Crosby's guiding principle was that robust quality assurance systems pay for themselves in the end and are more than worth whatever initial costs a company must absorb to establish such a system. Additional insight into his philosophies can be found in his first published book; Quality is Free. Dr. Kaoru Ishikawa (1915-1989) Dr. Kaoru Ishikawa is best known for his creation of the "Fishbone Diagram" or "cause and effect diagram." This type of chart is used in an evaluation of industrial processes to investigate the potential root-cause of an identified issue. In the example on the left is an Ishikawa fishbone diagram to investigate the cause of bad coffee. Here, people, procedures, material, and equipment are all identified as potential causes as branches from the backbone (bad coffee). An Ishikawa diagram is helpful to visualize the interrelated causality “cause and effect” in various processes used to create a product. The Fishbone diagram is not Ishikawa’s only innovation in the area of quality. He also introduced the idea of "quality circles." A quality circle is a volunteer group of individuals within a company who are trained to analyze and solve work-related problems, sharing their insights with upper management. This quality circle theory was a direct shoot-off from Deming's Plan-Do-Act-Check cycle. It should be noted that Dr. Ishikawa was intimately familiar with Deming's work, and many of his contributions to quality philosophy arose as a direct result of his lifelong work in synthesizing and expanding Deming's ideas into Japanese corporate culture. Dr. Genichi Taguchi (1924-2012) Dr. Genichi Taguchi was a Japanese engineer and statistician known for his development of the ‘Taguchi Methods’, which represents a type of statistical methodology for improving quality in the manufacturing process. Many industrial statisticians in the U.S. are coming to accept his ideas after years of resistance. There are two key philosophies from the Taguchi Method that stand out as representative of his views on quality. The first is that poor quality represents a loss to society, not just the individual consumer. The nature of this loss can be calculated using any number of loss functions to derive a real number cost from a variable (the Taguchi method uses the “mean-squared-error” approach).

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/02%3A_Introduction_to_Quality_Principles/2.03%3A_Section_3-.txt

Dr. Armand Vallin Feigenbaum (1922-2014) Dr. Armand Vallin Feigenbaum was an American-born quality expert. He devised the concept of Total Quality Control, later coined as Total Quality Management (TQM) (Feigenbaum Foundation, 2016). TQM is an extensive, company-wide quality improvement program. It gets everyone involved in developing an agreed-on company-wide and plant-wide work structure documented ineffective, integrated technical and managerial procedures. The integration provides coordination to the actions of the workforce, machines, and information of the company in the most practical ways, ensuring customer quality satisfaction and economic costs of quality. To learn more about Feigenbaum, visit the Feigenbaum Foundation. Often a company quality control department only focuses on production. However, Feigenbaum realized that the customer might have a problem not only with the product but also with the call center, shipping, or records. TQM is a consumer-based improvement system, and all the workers need to participate and educated. He identified 10 product and service conditions that must be met or considered to satisfy customer requirements. The aim of these requirements is that quality establishes the proper balance between the cost of the product or service, and the ‘customer value' it renders (including safety). Feigenbaum's 10 Product and Service Considerations 1. Specification of dimensions and operating characteristics. 2. Life and reliability objectives. 3. Safety requirements. 4. Relevant standards. 5. Engineering, manufacturing, and quality costs. 6. Production conditions under which the product is manufactured. 7. Field installation, maintenance, and service objectives. 8. Energy utilization and material conservation factors. 9. Environmental and other side effects considerations. 10. The cost of customer operation and use and product service. Today quality involves a total company commitment to quality. The TQM approach states that every employee in the business is responsible for quality. Note that this is distinct from the old model of an adversarial relationship between labor and management and closer to the model of labor-management cooperation. “Total Quality Management (TQM) is a management approach that places emphasis on continuous process and system improvement as a means of achieving customer satisfaction to ensure long-term company success.” (Summers, 2010) TQM is not a temporary fix or used for short-term problem-solving. A long-term, deeply committed management style is dedicated to the improvement of the process of an unwavering commitment to meeting the customers' needs. Since their needs are continually changing, TQM must also be amenable to change. Later assignments will explore TQM as well as other management styles to help meet customer needs. The TQM philosophy influencing corporate culture: • leadership • information and analysis • strategic quality planning • human resource development and management • management of process quality • quality and operational results • customer focus and satisfaction Explore! Learn about Total Quality Management (TQM) at this website. It can be difficult to get employees on board with a new management style. What are some things you would recommend helping transition employees in a positive way to this management style? 2.05: Section 5- How to Change Culture in a Company Changing the culture within a company can be a long, daunting process. Even in the best of circumstances, the change will not happen overnight. Quality professionals are limited in their ability to alter the culture of a manufacturing organization. For real change to occur, everyone in the organization must be motivated to change. A successful company takes care of its employees' basic needs by cultivating a culture of respect, fairness, and rewards for a job well done. These key ingredients are powerful motivators that inspire employees to work hard and conscientiously for the company. Maslow’s Hierarchy of Needs Maslow’s Hierarchy of Needs is a psychology approach that was proposed by Abraham Maslow and first expressed in his paper "A Theory of Human Motivation," published in 1943 and was more fully formulated in 1954 in his book "Motivation and Personality." Very put, the further up the pyramid an employee can go, the more connected that employee feels to that company. Although Maslow himself never used a pyramid to describe this theory, it is still a good way to pictorially represent the message, which is that drive and motivation are highly correlated when describing human behavior. Maslow’s Hierarchy is a popular approach to understanding and approaching change management. To affect change management must understand where employees are in Maslow’s hierarchy, identify their needs, and facilitate and promote their involvement to help them move up the hierarchy. The original hierarchy states that a lower level must be completely satisfied and fulfilled before moving onto a higher pursuit. However, today, scholars prefer to think of these levels as continuously overlapping each other. This means that the lower levels may take precedence back over the other levels at any point in time. Another important point to note is that people’s perceptions are as important as their reality, and what people value differs from person to person. Learn more here about Maslow’s Extended Hierarchy of Needs motivational theory.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/02%3A_Introduction_to_Quality_Principles/2.04%3A_Section_4-.txt

Every company develops a routine way of doing things, but what happens when the way they are doing things no longer works for reasons out of their control? What if the market changes? What happens when the customer needs change? What about the needs of their workforce? How an organization adapts to a rapidly changing market and customer base is crucial to its survival. Process & Process Improvement A process collects inputs and provides value-added activities on those inputs to create an output. We do this every day without even realizing it. For example, we want to repaint our bedroom – what color to choose, the type of paint to use, the rollers, and who will perform the job? In our everyday life, most processes develop over time without any thought of their effectiveness, and the same happens with businesses. Companies must identify the processes and determine their effectiveness. Ineffectual or wasteful processes must be removed or changed for a business to stay successful. Variation Variation is a natural part of any process. Scientists have now discovered that even identical twins have small differences in their genetic makeup. Therefore, it goes with the production of a product. There are rarely two products exactly alike; there is always some small amount of variation. Companies interested in providing quality products use quality techniques to study the variation present in their process. When they discover the source of the variation, they can move toward a more consistently produced, higher quality product. Specifications Specifications are substantive requirements provided by the customer. There are many forms specifications can take depending on the product produced and its target customer. Specifications are descriptions that define and characterize properties that a product must possess for its intended use. There are specifications for both raw materials and products. As quoted from an FDA document (Guideline on General Principles of Process Validation, Food and Drug Administration, 1987): "The desired product should be carefully defined regarding its characteristics, such as physical, chemical, electrical, and performance characteristics…It is important to translate the product characteristics into specifications as a basis for description and control of the product." The table below provides an example of the broad range of specifications for the same chemical, in this case, sodium chloride. Notice the purity differences, the physical requirements, and additives – these specifications are based on the intended use. Sodium Chloride Specification table. Table by J. O’Grady, CC BY 4.0. Specification Road Salt Table Salt Analytical Grade Salt Chemical Purity minimum 95% minimum 97% minimum 99% Color clear to white, yellow, red, black clear to white clear to white Maximum Allowed in Contaminants not specified As 0.5 ppm Cu 2.0 ppm Pb 2.0 ppm Cd 0.5 ppm Hg 0.10 ppm Al < 0.0005% As < 0.0001% Ba < 0.0005% Ca < 0.002% Cu < 0.0005% Physical Requirement 90% of crystals between 2.36mm and 12.5 mm 90% of crystals between 0.3 mm and 1.4 mm 95% of crystals between 0.18mm and 0.3 mm Allowed Additives anti-caking agents of 5-100 ppm, Sodium Ferrocyanide, Ferric Ferrocyanide coating agents, hydrophobic agents not allowed Moisture 2-3% < 3% not specified These specifications illustrate several important points: 1. Properties that are necessary for that product based on its intended purpose. 2. The specifications for the same property may vary depending on the intended use. 3. Specifications always are associated with analytical methods. It is important, for example, that road salt is not used for cake salt. Table salt is stored in containers that are open to the air, so it is important to include agents that absorb moisture from the air instead of the salt. These hygroscopic agents must be excluded from the analytical grade salt. Additionally, analysis of the analytical grade salt shows that it is free of contaminating metals as it may be used in techniques that are ruined by metal contamination or in techniques where the instrumentation would detect the metals, thereby interfering with the intended measurements. Sodium chloride could be a raw material for a biomanufacturing company. It is important that specifications for it are determined, documented, and a contract between the supplier and the company based on those specifications is established. The Term "Establishing Specifications" Means: 1. Defining the characteristics of the product, material, or process 2. Documenting those specifications 3. Ensuring that the specifications are met It is very important to establish specifications during the development of the product, for the product itself, all raw materials, and the process as part of the application to the FDA. This is not a simple task. It requires knowledge of how the product, materials, or process will be used, the properties that will make it suitable for that use, and the allowable ranges. If the range for a specification is too stringent, then adequate materials might be rejected. On the other hand, if the range of values for the specifications is too broad, then the quality of the product is not protected. Because the setting of specifications is both a critical component of a quality program and a challenging task, the FDA scrutinizes specifications for products it regulates. The FDA will not accept specifications if they are not complete, if they are unsuitable for the product, if their range is too broad, if they are unsubstantiated by testing, or if suitable analytical methods to test them are not available. Tolerance Limits Tolerance Limits are the permissible changes in the specification. A product’s process is ‘under control’ when the specification is met within the tolerance limits provided by the customer. Out of Specification If samples do not satisfy specifications, then they are out-of-specification (OOS). If this occurs, operators may follow a procedure to correct the problem, or they may initiate an investigation. The FDA recognizes that from time to time, a batch of a product will be found not to meet all product release criteria. However, the FDA expects that the batch is not just thrown away but that the company must know why the batch did not meet requirements and determine if the “failure” is an isolated, explainable incident, or an indication of a significant problem associated with the manufacturing and control of a drug. This “explanation” must be in writing, supported by evidence, and reviewed by management and approved by at least QA. OOS laboratory data may be the result of lab error, non-process error or operator mistake (i.e., used wrong raw material or ingredient did not correctly follow manufacturing instructions) or process problem (i.e., equipment malfunction or process too variable or fundamentally flawed). Productivity Productivity may be defined as working effectively while best utilizing the available resources. Productivity is a little different from quality, which focuses on effectiveness – achieving goals while meeting customer needs. Improvements in productivity and quality come from managing the work activity regarding processes. Measuring the effectiveness of processes helps identify areas of increased productivity.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/02%3A_Introduction_to_Quality_Principles/2.06%3A_Section_6-.txt

Inspection, audit, and surveillance are three tasks conducted in the quality effort that may cause some confusion to a newcomer in quality. Similar in some ways, and unique in others, each has a different purpose. Inspection Various inspections are best used to gather data for a proactive approach to problem-solving. Not only should the inspection be used to identify a nonconforming product, but it should also collect the data needed to determine the root cause of the problem and to find and monitor the remedy. An inspection may involve: 1. Receiving inspection: Ensures items received from vendors meet order requirements 2. Source inspection: Review the vendor facilities to ensure quality standards 3. In-process inspection: Ensures quality during fabrication or assembly 4. Final inspection: Verify all steps were correctly performed, quality of materials were used, final tests were coordinated with the customer, inspect spare parts, and check shipping containers to assure safe delivery of a product Audit An Audit is an inspection of an organization's adherence to the established quality standards. In a small start-up company, it may be possible for one person to perform or at least supervise all the aspects necessary for the production and testing of a product. As the operation grows, however, it is no longer likely that a single individual is knowledgeable in all functions or confident of the level of quality employed during all operations. Therefore, systems must be set up for the accumulation of data and for the review of that data. Also, the systems themselves must be examined or audited to determine that they are still operating as originally planned. A company can do an internal audit (by people from the company itself) or hire an external auditor (people from outside the company) to make sure that they are following established quality standards. In some cases, an external agency, such as the Food and Drug and Administration (FDA), could audit a biotechnology company to ensure that they are following current good manufacturing practices (CGMPs). The quality audit should be designed to answer three basic questions about the organization being audited: 1. Quality System: Does the organization have a quality system? This is usually evidenced by a quality manual, operating manual, or quality procedures. 2. Adherence: Is the quality system being followed? An audit is conducted to determine whether the procedures are adhered to on an ongoing, consistent basis. 3. Effectiveness: Is the system effective? Are the results of following the procedures consistent and positive? The auditor does not carry the authority to make corrections in the procedures, so the results of the audit are given to upper-level management for further action. However, the auditor will follow up on findings and recommendations to ensure the recommended changes have been implemented. In the case of a regulated industry, the process and frequency of a quality audit may be defined by the regulating agency. In this case, the audit program of the industry is often subject to inspection by the regulatory agency. For example, an industry regulated by the U.S. Food and Drug Administration (FDA) must provide access to an FDA inspector to its audit procedures. The manufacturer may be asked to provide evidence that its audit program is functioning, is well-documented, and is instituting corrective measures when appropriate. A certification by an outside auditor or access to an internal audit log (or history) may be used to demonstrate that the system complies. Surveillance Surveillance is an alternate inspection process that uses some of the techniques of both the audit and inspection functions, although less precise than either of the two. Most commonly, surveillance is an objective evaluation to determine how well the quality procedures are being followed in day-to-day production, along with determining how well the procedures, when followed, maintain the quality of the product. Surveillance answers the questions, 1. Is the process of performing as planned? 2. Is the product of acceptable quality? 3. Have the recommendations of the audit been incorporated?

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/02%3A_Introduction_to_Quality_Principles/2.7%3A_Inspection%2C_Audit%2C_and_Surveillance.txt

1. Calibration is a process that compares a known (the “standard” device) against an unknown (the target device in question). During the calibration process, the offset between these two devices is quantified, and the target device is adjusted back into tolerance (if possible). A calibration report usually contains both "as found" and "as left" data. When a micropipette is determined to be out of calibration, it is typically sent to the manufacturer for recalibration. 2. Verification is simply the process of "verifying" that a device is within tolerance (within an acceptable range). Verification usually results in "as found" data. If the device is not within tolerance, it is sent for recalibration. 3. Validation is a detailed process of confirming that the instrument is installed correctly, that it is operating efficiently, and that it is performing without error. Validation in the pharmaceutical industry emerged from problems in the 1960s and 1970s and went together with the QA/QC philosophy that quality is built into the product not tested into the product. The FDA states that quality, safety, and effectiveness are designed and built into the product. Biomanufacturing Validation There are three main areas of validation for a biomanufacturing facility. You must validate your process, your equipment, and your methods. The planning of validation occurs throughout the development of the product. The actual validation process is usually performed before large-scale production and marketing of a product begin. Revalidation is required whenever there are changes in raw materials, equipment, processes, or packaging that could affect the performance of the product. Validation is important both in "traditional" pharmaceutical manufacturing and in the production of medical products using biotechnology methods. FDA's "Guideline on General Principles of Process Validation" (May 1987) is a general guide that applies to most manufacturing situations. There are also specific guidelines for the biotechnology industry, which is found on the FDA website. Validation is a major undertaking that is expensive, time-consuming, and requires extensive planning and knowledge of the system being validated. The advantage of validation is that it helps to assure consistent product quality, greater customer satisfaction, and fewer costly product recalls. 1. Process Validation. Process validation is the method by which companies demonstrate that their activities, procedures, and processes consistently produce a quality result. For example, process validation of a sterilization process might involve extensive testing of the effectiveness of the process under varying conditions, when different materials are sterilized, with different operators, and with various contaminants to make sure that the technique can "clear" the material of the contaminant. During this testing, the effectiveness of contaminant removal would be measured, the temperature and pressure at all locations in the sterilizer would be measured and documented, and any potential difficulties would be identified and recorded. Validation demonstrates that the process is effective. Validation and final product testing are recognized as two separate, complementary, and necessary parts of ensuring quality. The requirement for process validation comes from the text of the GMPs, Section 211.100, which states that “there shall be written procedures for production and process control designed to assure that the drug products have the identity, strength, quality, and purity they purport or are represented to possess." (fda.gov) Test Your Knowledge! Read more about Process Validation FDA Guidelines and refer to the PPT presentation. 1. Discuss the three stages of process validation. 2. What is the guidance on documentation? 2. Equipment Validation. For a process to proceed correctly, the equipment must be of high quality, must be properly installed, regularly maintained, and properly operated. Equipment must, therefore, be validated to ensure that it will function reliably under all the conditions that may occur during production. Equipment qualification may be and performed separately from process validation, but it is also a requirement for process validation. Equipment Validation is a detailed process of confirming that an instrument is installed correctly, that it is operating efficiently, and that it is performing without error. Equipment Validation is divided into three parts: 1. Installation Qualification (IQ). First, the equipment item is checked to be sure that it meets its design and purchase specifications and is correctly installed. Installation qualification includes, checking instruction manuals, schematic diagrams, and spare parts lists are present; checking that all components of the device are installed; checking that the materials used in construction were those specified; and making sure that fittings, attachments, cables, plumbing, and wiring are properly connected. IQ is documented proof that the equipment meets the design intention. 2. Operational Qualification (OQ). After installation, the equipment can be tested to verify that it performs within acceptable limits. For example, an autoclave might be tested to see that it reaches the proper temperature, plus or minus certain limits, in a set period; that it reaches the correct pressure, plus or minus certain limits, etc. The penetration of steam to all parts of the chamber, the pressure achieved at various settings, and so forth, would all be tested in the context of the operational qualification of an autoclave. OQ is documented proof that the equipment performs as specified. 3. Performance Qualification (PQ). Once all measuring instruments are calibrated, and all equipment is validated, process validation (or qualification) can be performed. The validation of the process will involve assessing the process under all the conditions that can be expected to occur during production. Testing includes checking the process endpoint(s) under these conditions and establishing that the process consistently meets its specifications. PQ also involves challenging the system with unusual circumstances. FDA speaks of the "worst-case" situation(s) that might be encountered during production. PQ is documented proof the equipment or systems operate as intended under challenge conditions. 3. Method Validation. Refers to the method of testing the raw materials, intermediates, and product. Unplanned Occurrences After these validation activities have been performed, the collected data is analyzed as described in the validation protocol, and a report is prepared. Successful validation demonstrates that a process is effective and reliable. With careful validation design, planning and implementation problems are easily avoided. Even in the most carefully designed facilities, unplanned occurrences happen. These unexpected events are called deviations, and every company must be prepared to deal with them. Typically, the validation plan will have a form for documenting the deviation. The supervisor and the quality department will review the deviation to determine the plan of action to correct the deviation.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/02%3A_Introduction_to_Quality_Principles/2.8%3A_Validation_of_Processes_and_Equipment.txt

When a process, product, or raw material is out of specification, it is called a nonconformance. Inspections, audits, and surveillance will occasionally uncover nonconformance or defects. Nonconformance problems are placed in one of three categories based on the product defect: critical, major, and minor. 1. Critical Defect: A defect that knowledge and experience indicate is likely to result in unsafe conditions for people utilizing, maintaining, or depending on the product. When Firestone found that their tires could blow out suddenly, causing accidents, this was a critical defect that triggered a massive recall effort. 2. Major Defect: A major defect is a non-critical error that is likely to result in either product failure (non-life-threatening) or a significant, material reduction in the usability of the product for its intended purpose. If the plastic used in a blender lid, for example, bends in hot water, so it no longer fits the blender and liquids splatter everywhere, the blender lid would be said to have a major defect. 3. Minor defect: "A defect that is not likely to reduce materially the usability of the unit of product for its intended purpose or is a departure from established standards having little bearing on the effective use or operation of the unit." (Summers, 2010). For example, plastic drinking glasses that turn cloudy in the dishwasher, but are structurally sound, is a case of a minor defect. It must be stressed that these three categories are not the only possible classifications, and a company may define their classes of defects or break these standards down into types of even finer detail. Still, it is important that an employee can determine the impact of a defect and classify it appropriately so that the correct level of response is taken. Test Your Knowledge! Read the following news article about a medical device recall. 1. What type of non-conformance was this? (Critical, major, minor). 2. What part of the process do you think failed at catching this manufacturing error? (Inspection, audit, surveillance) Why? Nonconformance Prevention Statistical quality control (SQC) is the use of statistical methods to solve problems. Data on the product is collected, analyzed, and used to solve product quality problems such as monitoring and control in the variation of the product. Also, statistics can be applied to analyzing process methods to prevent defects, called statistical process control (SPC). SPC is particularly important in identifying activities that may result in defects and product nonconformance. It's important to note that the use of statistical analysis is essential in moving away from inspecting quality into a completed product and toward making process improvements to manufacturing quality into the product. Hence, the responsibility for quality passes from inspectors to manufacturing design personnel. Statistical Process Control aids companies in achieving critical goals 1. Consistently manufacture products that meet customer quality expectations. 2. Reduce variability in product quality within and between manufacturing runs. 3. Improve processes by identifying inefficiencies. 4. Minimize production costs. 5. Be solution-oriented and implement changes based on scientific analysis of problems. 6. Assist with the problem-solving process. 7. Increase profits & productivity. Changing Control Procedures Deviations or OOS may not be a "negative" but a "positive." It is possible that change will result in improvement, but how is this change incorporated? In a highly regulated process, changes must be taken on conservatively and require the close collaboration of production personnel with quality assurance personnel. All changes must be carefully considered and thoroughly documented. A small change in one aspect of production may have an unpredicted change in another aspect of production or the quality of the final product. Rigorous testing must precede any changes that are instituted. General Guidelines for change control procedures 1. Review and approval of the (proposed) change by Manufacturing, Materials, Management, Engineering, Regulatory Affairs, QC, and QA. 2. Verification of completion of required studies, reports, etc., supporting the change. 3. Proper documentation of all events surrounding the change. 4. A change control file that includes documentation of approvals, a history of change for each official document, and records and data to support the change. A change in control procedures works best when it is planned and well thought out. One should ask how the change will affect process efficiency, worker safety, ease of equipment operation, and product quality to name a few. If a problem arises, employees should have the training and the autonomy to do what they deem necessary at the time to prevent significant equipment damage, product loss, or worker injury. Ideally, there is a plan that deals with such emergencies. This should be followed by a change control meeting as soon as possible to discuss and review the incident and follow the regular change control procedure from that point onward. Also, the company should document all activities done during the "emergency" period. The Future of Quality The Buddhist philosophy that “Nothing is Permanent” is quite apropos when addressing Quality. Quality systems and methodologies continue to evolve and embrace change along with the pace of new technology products. It is important to remember that the customer affects the future of quality. This is a new, savvy generation demanding value and satisfaction. For organizations to create value, they will need the clarity of the customer's point of view. Quality systems put in place, which are internal to the company, will need to be adaptable and sustainable while attempting to eliminate waste. Competition is the driving force that encourages companies to seek ways to get a competitive edge.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/02%3A_Introduction_to_Quality_Principles/2.9%3A_Nonconformance.txt

Objectives • Define a Quality Management System and outline its importance in quality • Discover various quality systems – both voluntary and mandatory • Understand what ISO is and how it helps a company with quality • Learn the basics of quality management; TQM, continuous improvement, Six Sigma, 5S, Lean, and ISO. • Explore how a company earns ISO certification and CGMP certification. Understand who audits/enforces either of these QMS. • Understand the motivation a company must follow a QMS if they are not required to have one by law. 03: Quality Management Systems Quality Systems in the Workplace “A Quality System is the organizational structure, responsibilities, procedures, processes, and resources that together ensure the quality of a product or service.” (Summers, 2010). The goal of all quality management systems is to encourage companies to: “…say what you are going to do, do what you say, be able to prove it and then improve it…” To meet the needs of the company, its customers, and the regulatory body, a quality management system needs to be accountable, dynamic, and efficient. It is important to note here; not all quality management systems are the same. The type of system in any given company will depend on the size of the business, the nature of the firm, and the product they are selling. In cases when a company is producing a federally regulated product, the company must follow Current Good Manufacturing Practices (CGMP) governed by the FDA. Other quality systems, such as the ISO9000 system, and 5S system, are voluntary and assist a company with its business and production processes to achieve increased competitiveness and customer satisfaction. In this chapter, you will be introduced to a few of the most prominent and influential quality management systems found in bioscience companies, both regionally and nationally. Quality Systems in Research Labs Academic research labs are usually self and peer-monitored in their quality systems. Government oversight is rare because these labs are not producing any product for public consumption. Instead, academic labs focus on the pursuit of knowledge. Furthermore, quality procedures in the university setting are based on following the empirically established, time-tested methods of “good science.” In this regard, a certain level of quality is inherent in academic research. Results are judged through peer-reviewed publications and grant funding. The poor-quality research will be rejected by the scientific community (peer-review publication), and unsuccessful nonproducing projects fail to gain funding or will lose funding. Research Labs Associated with industry These labs adhere to the regulations and standards related to the product they are researching. The research department of a pharmaceutical company must follow the guidelines set out by the FDA and frequently submit to FDA inspections of their process and records, which may include research laboratory notebooks and research & development reports. Companies not regulated by the FDA may choose to implement a voluntary quality system such as ISO9000, 5S, or Six Sigma. 3.02: Section 2- Quality Systems in Companies which are Regulated The goal of government regulation is to protect public health. Any company producing drugs or medical devices is governed by the FDA. Serious injury and even death can result from product contamination, deviation, failure, and errors in manufacturing and packaging. These types of events may be reduced or avoided altogether when a company follows federally mandated quality guidelines, known as Current Good Manufacturing Practices (CGMPs). These guidelines for product manufacturing and testing represent a formal quality system that describes the general principles that must be observed during manufacturing. It is the company’s responsibility to ensure GMP compliance and to do so efficiently and effectively. To this end, regulations are relatively flexible. It is up to the manufacturer to establish design procedures, processing methods, and testing procedures. This flexibility gives companies room to experiment and innovate. Additionally, it should be noted that CGMPs represent only the currently accepted minimum standards for manufacturing, testing, and packaging drugs and medical devices. Most companies go above and beyond minimum guidelines to assure a customer a high-quality product. They frequently employ multiple quality systems, including voluntary ones, which provide the consumer peace of mind and a level of trust in the safety of the product. GMP Guidelines Follow a Few Basic Principles: 1. Define, control, and validate all critical manufacturing processes. 2. Changes to the manufacturing process must be evaluated and approved. 3. Instructions and procedures must be written clearly and easy to understand. 4. Production operators must receive thorough training on all processes and documentation of processes. 5. The company must maintain accurate records demonstrating their adherence to guidelines and regulations. Any deviations in product quality or quantity must be documented and investigated. 6. Records must be comprehensive, complete, and easily accessible. 7. A recall system is in place so that any batch of a drug may be easily recalled 8. The company responds to complaints, quality defects are investigated, and appropriate measures are taken to prevent future defects. Explore! Explore the nutraceuticals company NuLab’s website. Watch the video on CGMP quality procedures: https://www.youtube.com/watch?v=kvICQiMFVi4 & https://www.youtube.com/watch?v=oRsZihZa4CQ In what ways has NuLabs incorporated quality principles into its manufacturing facility? Good Laboratory Practices (GLPs) In 1975, FDA inspection of several pharmaceutical testing laboratories revealed poorly designed and carelessly executed experiments on animals, inaccurate record keeping, poorly maintained animal facilities and a variety of other problems. These deficiencies led the FDA to institute the Good Laboratory Practices (GLP) regulations to govern animal studies of pharmaceutical products. GLPs require that testing laboratories follow written protocols, have adequate facilities, provide proper animal care, record data accurately, and conduct valid toxicity tests. GLPs regulate all non-clinical safety studies that support investigative new drugs and new drug applications, biologics that are drugs, veterinary drugs, and some food additives. GLP laboratories are organized in a particular manner in seven general areas: 1. Organization and personnel (study director, quality assurance unit) 2. Testing facility (there are specific requirements for animal care) 3. Testing facility operation (each laboratory must base its functioning on Standard Operating Procedures (SOPs) 4. Test and control article characterization 5. The protocol and the conduct of the nonclinical laboratory study (a document, a plan, which indicates objectives and methods for the conduct of the study) 6. Records and reporting (periodic audits and final report) 7. Equipment design (equipment must be appropriately designed and well maintained). Good Clinical Practice (GCP) Good clinical practice (GCP), for hospital & clinician’s clinical studies on new drugs in humans; regulations meant to ensure the quality of data submitted to the FDA on a new pharmaceutical to be marketed has been properly conceived and tested. These regulations also protect the welfare of human volunteers in clinical trials: 1. To protect volunteers participating in a clinical study, they must be informed about the study and treatment they are to receive so they can make an informed decision whether to participate. 2. To protect the rights and welfare of clinical subjects, the FDA requires that clinical trials be reviewed by a committee independent of the study sponsor called an Institutional Review Board (IRB). 3. Another regulation defines the responsibilities of the trial sponsors and investigators during the conduct of a trial. 4. The FDA “Guideline for the Monitoring of Clinical Investigations” also explains the monitoring needed during a clinical trial, and how to document the process. Enforcement The U.S. Food and Drug Administration (US FDA) enforces Good Manufacturing Processes under Section 501(B) of the 1938 Food, Drug, and Cosmetic Act (21USC351). Inspections are sometimes scheduled but may also occur unannounced as long as they are conducted at a “reasonable time” as outlined in Section 704(A) of the FD&C Act (21USC374). Any time the company is open for business is the accepted definition of a “reasonable time.” It is interesting to note that a product may be considered “adulterated” if the manufacturer failed to produce it by industry standards, even if the manufacturer did not violate any specific regulatory requirement. More on FDA enforcement in a later chapter! Quality Systems in Companies with Voluntary Standards Not all biotechnology companies produce regulated products. It makes good business sense for companies to impose some form of the established quality system. They may choose to follow CGMPs or certain federal guidelines – but what most of these companies do is voluntarily adopt quality systems that are not government regulated. International Organization for Standardization (ISO) One of the most prominent international quality systems is ISO. ISO is a quality system that can be applied to a wide range of products. Participation is voluntary, and oversight is conducted through outside auditors paid for by the participating company. ISO standards can apply to more than just product design and specifications. There are also standards that outline things such as design methods and production processes based on currently accepted ‘good practices.' The ISO system is so well-known and respected that most companies who can voluntarily follow it do follow it. Below we will dive into a more in-depth discussion of the ISO system and how it applies in bioscience and biotechnology companies. The mission of the ISO is: “to facilitate the international coordination and unification of industrial standards." (www.iso.org) Explore! Visit the ISO website: http://www.iso.org/iso/home.html and learn about The International Organization of Standards. 1. What is ISO? 2. Who is responsible for the ISO 9000 quality standards? 3. What’s new this year for ISO standards (hint: read their news!) The need for a global standard arose because of the uneven progress of industrial development throughout the world. As manufacturing technology spreads, many countries develop their standards. Different processes and even different methods of measuring and testing made for vastly different outcomes in quality. Recognizing these differences as a barrier to trade, a group of delegates from 25 countries met to create the ISO, and the organization officially began operation on February 23, 1947. Each member nation participates through its national standards organization. The United States is a member of the ISO through the American National Standards Institute (ANSI) (www.ansi.org). The collective efforts of ISO members have helped to make the development and production of products and services safer and more efficient. Explore! Visit the ANSI website: http://www.ansi.org. 1. What is the mission of ANSI? 2. Why is ANSI relevant to quality systems?

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/03%3A_Quality_Management_Systems/3.01%3A_Section_1-.txt

ISO 9000 Quality management is the primary concern of the ISO 9000 standard with its focus on product design, manufacturing, sales, and service. It is accepted in over 90 countries and applicable not only to product-focused organizations but service-oriented organizations as well (e.g., hospitals). This standard strives to involve employees at all levels to participate in the quality process. The guiding principle underlying the entire standard is transparency. Every member of an organization should be able to communicate what they intend to do to address a quality issue, do what they say they are going to do and, prove through documentation, they carried through the plan, and have a continuous improvement plan. ISO 9000 Management Categories 1. Scope. 2. Normative Reference. 3. Terms and Definitions. 4. Quality Management System. 5. Management Responsibility. 6. Resource Management. 7. Production Realization. 8. Measurement, analysis, and improvement. ISO 9000:2008 By the early 1990s, ISO 9000 was becoming increasingly outdated. The revision and improvement of the standard were a long, arduous process. The first round of major revisions was completed in 2000. The last round of additional revisions was finalized in 2008. Some of the features of the newly revised standard include the integration of the plan-do-check-act cycle as a system standard, stronger emphasis on customer feedback in analyzing the quality process, and a complete overhaul of the language the standard is written in (about an eighth-grade level) for improved readability. Eight Fundamental Principles of ISO 9001:2008 Standards: 1. Customer-focused. 2. Leadership. 3. Involvement of people. 4. Process approach. 5. Systems approach to management. 6. Continual improvement. 7. Factual approach to decision making. 8. Mutually beneficial supplier relationship. ISO 9000:2008 consists of three areas: 1. ISO 9000:2008, Quality Management Systems: Fundamentals and Vocabulary: Provides a standard of reference to the concepts and vocabulary used in ISO 9001:2008 and ISO 9004: 2008. 2. ISO 9001:2008, Quality Management Systems: Requirements: Intended for use by all organizations regardless of type, size, or industry. Specifies requirements for achieving ISO certification. (1) Management Responsibility: Discusses the impact of data analysis on an organization’s quality management system. (2) Resource Management: Detailed documentation of resource availability and deployment specified as a certification requirement. (3) Product and Service Realization: Specifies continual process improvement through self-assessment and customer requirements. (4) Measurement, Analysis & Improvement: Methods of a measuring system, processes, products or services. 3. ISO 9004:2008, Quality Management Systems: Guidelines for Performance Improvement: Not a requirement for certification. This standard specifies a means for those companies wishing to go beyond ISO 9001:2008 and develop a quality management system designed for continuous improvement of performance in all areas. Documentation A valid QMS requires rigorous documentation and disciplined record keeping. Some of the activities of record required by ISO 9000 include, but may not be limited to, training records, policies, procedures, instructions, protocols, purchasing records, test data, audit records, and calibration records. ISO 9001 requirements on documentation are published in Document: ISO/TC 176/SC 2/N525R2, October 2008. ISO 9001:2008 clause 4.1 General requirements require an organization to “establish, document, implement, and maintain a quality management system and continually improve its effectiveness in accordance with the requirements of this International Standard.” (www.iso.org) Clause 4.2.1 explains that the quality management system documentation shall include: 1. Quality policy and quality objectives. 2. A quality manual. 3. Documented procedures; established, documented, implemented, and maintained. 4. Documented processes; effective planning, operation, and control of its processes. 5. Records required QMS documentation differs from one organization to another relative to the size of the organization, the scope, and complexity of its activities in addition to many other factors, such as federal regulations. Quality Manual The Company establishes and maintains a quality manual that includes: 1. The scope of the quality management system, in detail. 2. Procedures established for the quality management system, documented or referenced. 3. A description of the interaction between the processes of the quality management system. Control of Records and Documents All documents formally describing the QMS must be strictly controlled. No changes can be made to these documents without first passing through an official change procedure as outlined within the company’s QMS. The company must establish a procedure to control everything from storage and retrieval of records to their identification, legibility, and disposal. A documented procedure is established to define the controls needed to: • Approve documents for adequacy before the issue. • Review and update as necessary and re-approve documents. • Ensure that changes to documents are traceable • Ensure that relevant versions of applicable documents are available • Ensure that documents remain legible and readily identifiable. • Prevent the unintended use of obsolete documents ISO 14000 "Environmental management" is the focus of the ISO 14000 standard. Environmental management can be loosely defined as the steps a company takes to minimize its impact on the natural environment and to continuously improve its environmental track by reducing harmful waste by-products from the manufacturing process. Initially, the issue of environmental management was addressed only briefly in ISO 9000. As social and political attitudes towards environmental safety changed, the ISO organization decided to address the issue by creating a complete set of guidelines and standards. This new environmental management system is not a regulation or law (none of ISO's standards are). However, it does mirror the kinds of steps a company must take to come into compliance with local legislation and regulations. In other words, it provides a useful framework for businesses to follow when planning and implementing their own EMS. Some companies will even go a step further by requiring partners and suppliers to come into compliance with them. For example, Ford and GM both require their suppliers to be ISO-14000 certified. To become ISO 14000 certified, a company must: 1. Implement an Environmental Management System. 2. Assure compliance with existing laws and regulations. 3. Demonstrate a commitment to continual improvement. 4. Minimize waste. 5. Prevent pollution. ISO 14001:2015 Anne-Marie Warris, Chair of ISO/TC 207/SC1, the technical committee that developed the standard and revision, believes "the new version helps with a stronger integration between environmental issues and an organization's strategic action planning and thinking.” ISO 14001:2015 key components include: • Factoring in both external and internal elements that influence their impact • A greater commitment from leadership • An increased alignment with strategic direction • Increased protection for the environment, with a focus on proactive initiatives • More efficient communication, driven by a communications strategy • Lifecycle thinking, considering each stage of a product or service, from development to end-of-life ISO/IEC Standards for Testing Laboratories Testing and calibration laboratories follow the ISO/IEC 17025 standard. This standard is very similar to ISO 9000 but addresses the additional issue of competence as it applies to create and maintain a quality system the laboratory to produce valid results. Greater emphasis on the responsibilities of senior management and communication with customers became a part of this standard in its 2005 revision. The Five Top Elements of ISO/IEC 17025: 1. Scope. 2. Normative References. 3. Terms and Definitions. 4. Management requirements. 5. Technical requirements. Further information, including other relevant laboratory testing ISO guidelines, are listed at the American Association for Laboratory Accreditation (www.a2la.org): • ISO/IEC17025 Testing/Calibration Laboratories • ISO/IEC17020 Inspection Bodies • ISO/IEC17043 Proficiency Testing Providers • ISO/IEC17065 Product Certification Bodies • Clinical Testing Laboratories • ISO 15189 • CLIA Requirements • CLIA and ISO 15189 • ISO Guide 34 Reference Materials Producers ISO Device Regulations ISO 13485 ISO13485 is the standard for a quality management system for the design and manufacture of medical devices. This standard (although a stand-alone document) is harmonized with ISO 9001 with the exception that 13485 need only demonstrate the quality system is implemented and maintained whereas 9001 requires a continual improvement aspect. ISO Clinical Practices and Devices The medical device industry is quickly becoming a major player in the medical biotechnology industry. Moreover, regulations governing them can be complicated due to their unchartered territory as well as their multi-disciplinary applications. For example, what regulations would apply to an ocular device inserted into the eye (medical device), which measures and responds to eye pressure (diagnostic) to release several drugs (drug)? As you can imagine, global regulations vary widely. To address this, ISO and the European Committee for Standardization (CEN) worked together to come up with comprehensive clinical study regulations governing devices. ISO 14155 addresses these procedures including, risk assessment, ethical issues, constructing protocols and scientific conduct to name a few. More on this ISO regulation in following chapters that delve into devices and clinical studies. ISO Certification The process of obtaining certification is expensive, complicated, and time-consuming. To receive certification, a company must hire an independent, certified auditor (registrar) to perform an audit of the company’s QMS. For a company to get the certification, they must first create a quality system (described in their quality manual), create all the systems and documents, and put them in place (implementation). The company then hires a certified ISO auditor that audits the business to ensure all their systems and documentation are in place. The company then must apply for ISO certification and maintain the process. The largest and most frequent obstacle for most businesses is coming into compliance with the documentation process. Eventually, however, certification pays for itself through the product quality benefits it provides. Processes can be streamlined and improved by coming into compliance. Additionally, consumer confidence in a product goes up with the ISO 9001 label and gives the company a definite competitive advantage. Test Your Knowledge! GMP versus ISO: Presented below is a table that compares the differences and similarities between regulations and ISO 9000 standards. Fill in the missing parts of the table GMP ISO Mandatory system Federal (US) Law Can apply to any industry Enforced by the FDA Standards are generic and broad in scope but apply to the pharma/medical industry only Standards rely heavily on testing and inspection; functional areas are clearly defined Standards rely on management commitment, systems, procedures, and documentation; the quality system needs to be only as comprehensive as necessary Compliance is monitored by outside auditors paid by the company Standards for Pharmaceutical Companies Published in March 2006, ISO 15378 is a standard specifically developed for suppliers of pharmaceutical primary packaging. The standard specifies the QMS requirements necessary to demonstrate an organization's ability to provide primary packing materials for medicinal products that meet customer requirements. It also defines the applications for design, manufacture, and supply of primary packaging materials. It also guarantees that the legal requirements and the standards of the pharmaceutical industry for medical devices are met and that the company operates on an effective and efficient quality management system. ISO 15378 Key Areas: 1. Risk analysis 2. Checking / qualification / validation 3. Manufacturing tools 4. Computerized systems 5. Contamination risk & cleanliness control 6. Traceability 7. Change control 8. Operators training in GMP practices Test Your Knowledge! 1. Since ISO 9000 certification and compliance are voluntary, what motivates companies to adopt these stringent quality standards? 2. In your own words, explain why you would want or need to have a voluntary standard such as ISO 15378 when the pharmaceutical industry is already following FDA-regulated CGMP. 3. In your own words, compare the issues addressed by the following standards. You may be brief (2-3 sentences) each. ISO Standard Issues addressed by this standard ISO 9001:2008 ISO 9004:2008 ISO 14000:2015 ISO/IEC 17025 ISO 15378 ISO 13485 ISO 14155

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/03%3A_Quality_Management_Systems/3.03%3A_Section_3-.txt

Six Sigma As products become more complex, so does the manufacturing processes to manufacture them. This high complexity resulted in higher failure rates in manufacturing. In the 1990s, Bill Smith of Motorola Corporation developed Six Sigma as a strategy to deal with these failures and improve profitability by reducing process and product variation. In 2005, Motorola attributed 17 billion dollars in savings from implementing the Six Sigma system! Six Sigma is a rigorous process improvement methodology encompassing a procedure of Define, Measure, Analyze, Improve, Control (DMAIC). The DMAIC method encourages employees at all levels in the company to accept feedback, utilize clearly defined metrics, collect and analyze data, and create an overall company culture built on trust. The overall goal of Six Sigma is to reduce variation in the process, and the product, and thereby defects by using a highly focused system of problem-solving. The term Six Sigma stems from manufacturing terminology using statistical process modeling. A sigma rating is the yield or percentage of a defect-free product; Six Sigma is a process in which 99.99966% of the products manufactured are statistically free of defects (3.4 defective parts per million). Several features set Six Sigma apart from other methodologies; there is a clear focus on measurable fiscal returns on a project, and there is an increased commitment to make databased decisions and statistical methods. The DMAIC Methodology • Define the project and goals of the project • Measure the current process using data • Analyze the data using cause-and-effect method to seek out the root cause of the defect • Improve the process based on the data and analysis; perform pilot runs • Control the process by ensuring deviations are corrected; implement statistical process control, continuously monitor the process 3.05: Section 5- Lean is a manufacturing philosophy focused on waste removal developed by Toyota Production Systems (TPS) and popularized by the book “The machine that changed the world.” Lean seeks ways to improve the production process to accomplish more with less time, space, and resources. Elimination of waste is the centerpiece of this quality approach. The lean approach recognizes seven forms of waste: 1. Defective parts 2. Producing more parts than needed 3. Excessive inventory 4. Unnecessary steps/activities 5. Unnecessary movement 6. Unnecessary handling of materials 7. People waiting 5S One important waste-eliminating quality system commonly implemented in biotechnology companies (such as Life Technologies) is the 5S system. This system relies on visual cues to achieve an orderly workplace, and eliminates waste in the form of unnecessary steps, activities, movements, waiting around, and excess inventory. The 5S system – Sort (Seiri), Set in Order (Seiton), Shine (Seiso), Standardize (Seiketsu) and Sustain (Shitsuke) - provides a system for organizing, cleaning, developing and maintaining the work environment to minimize waste. youtu.be/jPXYa3FQP8k The method encourages workers to participate in improving their workplace and process. Learn more about the 5S system here: http://leanmanufacturingtools.org/192/what-is-5s-seiri-seiton-seiso-seiketsushitsuke/ Explore! Watch the following video to learn more about the 5S system. Using the 5S system, how can you organize your home office area to minimize waste in your studies? Identify the 5S for improvement. What is the benefit of 5S? youtu.be/dDqmCJf0de0

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/03%3A_Quality_Management_Systems/3.04%3A_Section_4-.txt

Learning Objectives • Explore the origin of regulations in the U.S. • Discuss the role and organization of the Food and Drug Administration • Identify products the FDA has regulatory authority • Explore the various FDA offices & Centers responsible for product approval • Distinguish between CFR, Guidelines, and Points to Ponder • Demonstrate the use of the eCFR database to locate regulations • 4.1: Consumer Safety and Health The FDA's authority to regulate products has changed over time significantly. Advancements in science have provided new tools to protect the public health. At times, public health crises have compelled urgent changes, and at other times, reform has taken place slowly through a length and controlled administrative process. Through it all, FDA's steadfast commitment to protecting the public health has remained at the core of all regulatory action. • 4.2: The Food and Drug Administration (FDA) The FDA is an administrative agency created to regulate food and drug supplies in the United States for the safety and health of its citizens. FDA is an agency within the Department of Health and Human Services. While the FDA has traditionally focused on the US markets, with the global market growth (of imports and exports of products and raw materials) the FDA now manages over 2 trillion dollars of goods manufactured in over 150 nations worldwide (FDA, FDA Global engagement report, 2016). • 4.3: The Code of Federal Regulations (CFR) The CFR is a massive set of regulations, published annually, where all the federal agencies post their rules. It provides information (based on quality techniques) on quality systems in the laboratory (QSR), manufacturing practices, laboratory practices, and clinical practices. Due to the sheer volume of information available through the CFR, it is useful to know how it is organized. 04: The Food and Drug Administration The idea of protecting the safety and health of consumers isn’t new. From the beginnings of civilization, people have been concerned about the quality and safety of foods and medicines. In 1202, King John of England proclaimed the first English food law, the Assize of Bread, which prohibited adulteration of bread with such ingredients as ground peas or beans. Regulation of food in the United States dates from early colonial times. Federal controls over the drug supply began with inspection of imported drugs in 1848, although the first federal biologics law, which addressed the provision of reliable smallpox vaccine to citizens, was passed in 1813. The revolting condition of the meat-packing industry that Upton Sinclair captured in The Jungle (right) led to a meat inspection law and a comprehensive food and drug law, now known as the Food Drug and Cosmetic Act (FDCA) of 1906. In this chapter, we will examine some of the most significant regulations, explore how regulations come to pass, and discuss the role of the Food and Drug Administration (FDA) in regulations of consumer products. The FDA's authority to regulate products has changed over time significantly. The agency has inherited new product areas and lost others. New laws and court rulings have reshaped the FDA's powers over these product areas. Transformations in the marketplace have created new regulatory challenges. Advancements in science have provided new tools to protect the public health. At times, public health crises have compelled urgent changes, and at other times, reform has taken place slowly through a length and controlled administrative process. Through it all, FDA's steadfast commitment to protecting the public health has remained at the core of all regulatory action. History of Regulation in the Pharmaceutical Industry The aim of pharmaceutical regulation is to ensure objective characteristics such as safety, effectiveness, honesty in labeling, accurate reporting of side effects (if any). Regulations do not apply to subjective characteristics such as taste, color, or texture. There are no regulations, for example, that dictate all aspirin tablets to be blue in color. Most of us take quality for granted these days. It was not so long ago that substances such as cocaine could be used as ingredients in soda (Coca-Cola) or over-the-counter tonics (Wikipedia, 2016). The FDA outlines major milestones of product regulation: www.fda.gov/about-fda/fdas-evolvingregulatory-powers/milestones-us-food-and-drug-law-history Some of the better-known incidences and the regulations that arose, as a result, are as follows: • The original Food Drug and Cosmetic Act (FDCA) of 1906. The FDCA is intended to prevent the sale of unacceptable foods and drugs rather than regulate safety or effectiveness. • The Durham-Humphrey Amendment, passed in 1951, was the first federal law requiring a physician’s prescription for drugs “unsafe for self-medication.” • The requirement that drugs are proven to be both safe and effective and is supported by "substantial evidence" is the mandate of the Kefauver-Harris Amendments. • The Orphan Drug Act amended the FDCA as of January 4, 1983, is an act calling for incentives to companies producing orphan drugs (which may benefit only a small number). • The Drug Price Competition and Patent Term Restoration Act, passed in 1984, made generic drugs more readily available at the same time as providing a way for manufacturers to recoup some amount of pre-patent research costs by factoring research time into the patent life of the drug • ClinicalTrials.gov was founded in 1999 to provide the public with updated information on enrollment in federally and privately supported clinical research. Explore! Go here to explore more FDA law milestones. List any laws put in place after 2005. Why do you think they were put into law? Are there any unusual laws? What Causes the Enactment of Regulations? There are two major influences which trigger the enactment of regulations: 1. Consumer tragedy (serious injury, death) resulting from the use of a product 2. Advancements in science and technology Once alerted to either of the above conditions, our lawmakers respond through legislation, and enforcement is assigned to the appropriate government agency. The issue of enforcement is not always clear-cut. Several agencies may enforce regulations in certain sectors – for example, GMOs, which we will discuss in a later chapter. Authority for oversight and regulation of the pharmaceutical industry, however, is quite clear - the primary agency is the Food and Drug Administration (FDA). Explore! Go here to learn how consumers can report problems with FDA-regulated products. Look to the Q&A on the left-hand panel - what kinds of products *doesn’t* the FDA handle?

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/04%3A_The_Food_and_Drug_Administration/4.01%3A_Section_1-.txt

The FDA (www.fda.gov) is an administrative agency created to regulate food and drug supplies in the United States for the safety and health of its citizens. FDA is an agency within the Department of Health and Human Services. It should be noted that the FDA has traditionally focused on the US markets, however, with the global market growth (of imports and exports of products and raw materials) the FDA now manages over 2 trillion dollars of goods manufactured in over 150 nations worldwide (FDA, FDA Global engagement report, 2016). International Harmonization Efforts What happens when a biotechnology company based in the United States or any other country wants to expand to overseas marketplaces? Conflicting regulatory standards made trade difficult until an effort began in the 1990s to harmonize international standards so that important medical products could be bought and sold with less regulatory ‘red tape.' The FDA has been the leader in this effort both in the U.S. and around the globe. The FDA assists both foreign and domestic manufacturers in compliance with CGMP, CGP, GLP, Safe and Sanitary Processing, and other regulations. (http://www.fda.gov/ForIndustry/default.htm). Organization The FDA is vast and complex. A complete organizational chart (2017) is found on their website here. The FDA, like most organizations, change with changing the economy, world harmonization, and emerging technologies and products. The current hierarchy consists of the Office of the Commissioner overseeing five offices and directorates. Those offices oversee eight centers. Like the federal government, the FDA possesses the following powers: 1. Legislative: The FDA has the authority to create and issue rules. 2. Executive: The FDA has the power to conduct investigations. 3. Judicial: The FDA has the jurisdiction to review the evidence and make judgments on a product. The FDA has "product centers" headquartered, largely in the Washington, D.C. area, (the NCTR is in Jefferson, Arkansas). FDA "field offices" are located throughout the United States. The field offices are "the eyes and ears" of the FDA, and it is from these offices that operational personnel enforce the law. Explore! Visit the FDA website and select each tab at the top of the page. Each tab corresponds to each of the different types of products the FDA regulates. Briefly describe each. Product Description Drugs A substance intended for use in the diagnosis, cure, mitigation, treatment, or prevention of disease. The site includes drug approval, safety, availability, regulatory information, research and consumer information relating to drugs FDA Field Offices Office of the Commissioner: Leadership of the agency's scientific activities, communication, legislative liaison, policy and planning, women's and minority health. (fda.gov). www.fda.gov/about-fda/fdaorganization/office-commissioner Office of Medical Products and Tobacco: Provides advice and counsel to the Commissioner on all medical product and tobacco-related programs and issues. www.fda.gov/about-fda/office-medicalproducts-and-tobacco/patient-affairs-staff Office of Foods and Veterinary Medicine: Leads a functionally unified FDA Foods Program that addresses food and feed safety, nutrition, and other critical areas to achieve public health goals. Office of Global Regulatory Operations and Policy: Provides leadership for FDA's domestic and international product quality and safety efforts. www.fda.gov/about-fda/fda-organization/officeglobal-regulatory-operations-and-policy Office of Operations: Provides agency-wide services including information technology, financial management, procurement, library services, and freedom of information, FDA history, and facilities. www.fda.gov/about-fda/office-operations/office-ethics FDA Product Centers Now, let’s examine more closely the functions of several important product-oriented centers: CDER, CBER, CDRH, CVM, CTP, NCTR, and CFSAN. Center for Drug Evaluation and Research (CDER): The CDER oversees the regulation of drugs. The official definition of a drug is "an article intended for use in the diagnosis, cure, mitigation, treatment, or prevention of disease in man or other animals; articles designed to affect the structure or any function of the body of man or other animals." (FDA, 2016) CDER regulates over-the-counter and prescription drugs, including biological therapeutics (act as drugs), and generic drugs. This work covers more than just medicines. For example, fluoride toothpaste, antiperspirants, and dandruff shampoos are all considered "drugs." Why? More on this in a later chapter! Center for Biologics Evaluation and Research (CBER): The CBER oversees the regulation of biologics. The official definition of a biological product is ‘any virus, therapeutic serum, toxin, antitoxin, vaccine, blood, blood component or derivative, allergenic product, or analogous product’ (FDA, 2016). More information on a biologic in the following video. Note, therapeutic biologics are biologics that act like drugs and therefore are overseen by CDER instead. More on this in a later chapter! Center for Devices and Radiological Health (CDRH): Oversees the regulation of medical devices and radiation-emitting products, and also includes biotechnology products used in diagnostics, such as HIV or pregnancy tests. You will be surprised to learn about some unusual products that are considered medical devices. https://www.fda.gov/AboutFDA/Centers...dTobacco/CDRH/ Center for Veterinary Medicine, and (CVM): The CVM is a product center, which oversees the regulation of food, food additives, drugs and biologics for animals. They also conduct research that helps the FDA ensure the safety of animal drugs, food for animals, and food products made from animals. However, they do not oversee pre-clinical animal studies. Those fall under the purview of the product center of the product the pre-clinical studies are for. Here is a video on the CVM put out by the FDA. Center for Food Safety and Applied Nutrition (CFSAN): CFSAN oversees food safety and purity. It has the power to regulate all domestic and imported food except for meat, poultry, and eggs (USDA regulates those). They oversee the safety of food ingredients developed through biotechnology, dietary supplements, food additives, and proper labeling of food. CFSAN is also concerned with food contamination, such as biological pathogens and naturally occurring toxins. Center for Tobacco Products (CTP): The Center for Tobacco Products (CTP) oversees the implementation of the Family Smoking Prevention and Tobacco Control Act. Some of the Agency's responsibilities under the law include setting performance standards, reviewing premarket applications for new and modified-risk tobacco products, requiring new warning labels, and establishing and enforcing advertising and promotion restrictions. (fda.gov) National Center for Toxicological Research (NCTR): FDA's research center conducts peer-reviewed research and develops new scientific tools for FDA to improve public health. This research produces innovative tools to assist in solving complex health issues, anticipated toxicological problems, and enhances the science of regulatory decision-making at the FDA. The NCTR publishes an annual report outlining their projects and can be found here. Test Your Knowledge! Go to this website for a tutorial about the Food and Drug Administration. Scroll down and press on the sound icon to hear videos. At the very bottom of the page is a self-quiz. Briefly summarize the mission of the FDA and outline the primary duty of each of the following FDA offices: Center or Office Summary of Main Duties CFSAN CDER CBER CDRH CVM NCTR ORA CTP Rulemaking, Adjudication, Guidelines, and Points to Consider The primary administrative activities of the FDA are rulemaking and adjudication. • Rulemaking affects both the public and the drug and device manufacturers. When new rules are proposed, the FDA publishes them electronically in the code of federal regulations (CFR), which is available to the public at www.ecfr.gov. • Adjudication is the term used to describe how the FDA responds to requests for approval to investigate or market a product. The FDA reviews each submission as a separate case even if each submission refers to the same product. Upon conclusion of its review, the FDA responds with its disposition or order. Federal regulations are first published in the Federal Register (FR) by the executive departments and agencies of the Federal Government published every business day by the National Archives and Records Administration (NARA). The Federal Register is a legal newspaper where the public is given notice of proposed new rules and intended actions, allowing time for comment. When the FDA finalizes a rule, it publishes its response to public comments in a preamble to the rule. This bureaucratic process is quite time-consuming and, therefore, the FDA employs two additional methods of transmitting information to the public and industry: Guidelines and Points to Consider, which are published on the FDA website. Neither the Guidelines nor the “Points to Consider” represent any legal regulation and may be challenged by scientific or other types of evidence. • Guidelines represent the FDA’s formal position on long-standing issues. Guidelines also communicate procedures or standards of general applicability that are acceptable to the FDA. • Points to Consider are intended to disclose the FDA's current position on any area considered new or rapidly changing, such as some parts of the biotechnology industry. In other words, the FDA has not formulated a formal stance.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/04%3A_The_Food_and_Drug_Administration/4.02%3A_Section_2-.txt

The CFR is a massive set of regulations, published annually, where all the federal agencies post their rules. It provides information (based on quality techniques) on quality systems in the laboratory (QSR), manufacturing practices, laboratory practices, and clinical practices. Due to the sheer volume of information available through the CFR, it is useful to know how it is organized. CFR Organization 1. Titles represent broad areas subject to Federal regulations. 2. Titles are divided into chapters that are assigned to various federal agencies. 3. Chapters are divided into parts covering specific regulatory areas. 4. Each part or subpart is then divided into sections – the basic unit of the CFR. 5. Sometimes sections must be subdivided further into paragraphs or subsections. Part Regulatory Purview 100 series Food – 110 CGMPs; Dietary supplements – 111 CGMPs 200 & 300 series Pharmaceuticals – 210 & 211 CGMPs 500 series Animal feeds & medications 600 series Biological products – 606 CGMPs 700 series Cosmetics (limited regulations) 800 series Medical Devices 900 series Mammography quality requirements 1000 series Radiation emitting device 1200 series Non-FD&C Act Rulings other GLP-58; GCP-50,54,56; Electronic records-11 CFR Title 21 Chapter 1: Food and Drugs Title 21 Chapter 1 of the CFR contains all regulations concerning the safe production of food, drug, medical device, diagnostic, and biologic products for human and animal use under FDA supervision. The 21 CFR regulations can be accessed at the following: http://www.ecfr.gov Test Your Knowledge! Go into the eCFR database, in the pull-down menu, choose Title 21, and press ‘go.' Click on parts 200. 1. What is the part of labeling? 2. What is the subpart for labeling requirements for over the counter drugs? 3. What are the content requirements for OTC drug product labeling? Significant 21 CFR Regulations in the Biotechnology Sector • 21 CFR 11: Electronic Records; Electronic Signatures • 21 CFR 201: Labeling • 21 CFR 314: Applications for FDA Approval to Market a New Drug • 21 CFR 610: General Biological Product Standards • 21 CFR 803: Medical Device Reporting • 21 CFR 1271: Human Cells, Tissues, & Cellular and Tissue-based Products Current Good Manufacturing Practices (CGMPs) GMP regulations are included in Title 21 Chapter 1 of the CFR, in three regulations dealing with different types of manufactured products: • for drugs (21 CFR 211) • for medical devices (21 CFR 820) • for blood and blood components (21 CFR 606) The general principles of CGMP that all these regulations have in common: 1. Quality, safety, and effectiveness are designed and built into the product, not tested or inspected into the product. 2. Each step in the manufacturing process is documented and controlled to ensure that the finished product meets design and compendia specifications. 3. Process documentation provides evidence of compliance with CGMPs. Three primary criteria used by the FDA in the design of these CGMP regulations: 1. Regulations should contain objectives and not detailed specifications. They should allow latitude for different manufacturers to find a means of compliance. 2. Regulations should contain requirements that are considered feasible and valuable as recognized and considered by experts as assuring quality. 3. If a practice can be established to be achievable and useful, then it can be required even though it does not exist in the regulations. Setting standards for quality in the biotechnology industry is difficult due to the often new and complex manufacturing processes involved. How should the FDA set quality standards, for example, for chromatographic purification systems? These processes are difficult to validate and represent ‘gray’ areas where quality regulations are concerned. For this reason, companies frequently rely on regulations that the FDA has not yet finalized, and they comply voluntarily with CGMPs and Guidelines. 21 CFR 58: Good Laboratory Practices (GLPs) Animal studies of pharmaceutical products are regulated by Good Laboratory Practices (GLP) as covered in 21 CFR 58. These regulations came about in 1975 because of an FDA inspection of several testing laboratories where conditions were, frankly, appalling and animals treated inhumanely. Any laboratory wanting to run animal tests today must maintain clean, adequate facilities, provide proper care for the animals, and conduct valid tests. All non-clinical safety studies of new drugs and new drug applications, drug biologics, veterinary drugs, and some food additives fall under the purview of GLP regulations. Good Clinical Practices (GCPs) Good Clinical Practices (GCPs) are a similar set of standards that apply to human subjects of clinical trials and experiments. More to come in later chapters! Regulatory History of GCPs • By the 1980s, it became apparent that representative populations needed to be included in clinical trials - factors that may influence the effectiveness and side effects of drugs include age (children, older patients), sex, and even ethnicity! • In 1989, the FDA issued guidelines asking manufacturers to determine whether a drug is likely to have significant use in older people • In 1993, the FDA issued the Gender Guideline, which called for assessments of medication responses in both sexes. • In 1998, the FDA required that a marketing application analyze data on safety and effectiveness by age, gender, and race, called the Demographic Rule. • In 2002, the Best Pharmaceuticals for Children Act was passed to improve the safety and effectiveness of medicines for children. • In 2003, the FDA was given clear authority under the Pediatric Research Equity Act to require drug sponsors to conduct clinical research into pediatric applications for new drugs. Clinical Studies Although there is no regulation specifically entitled “Good Clinical Practice,” there are several regulations, which govern the conduct of clinical trials. • Volunteers participating in a clinical study must be able to give informed consent. Informed consent means educating each potential subject on the treatment they are to receive as a part of the study as well as any risks that may be associated with their participation. FDA regulations entitled "Protections of Human Subjects" (21 CFR 50) set forth the requirements for informed consent. • Clinical trials must be reviewed by a committee independent of the study sponsor called an Institutional Review Board (IRB) (21 CFR 50). The regulations specify the organization and personnel who make up this board, as well as the records and reports that are to be kept. • 21 CFR 312 Subpart D outlines the responsibilities of trial sponsors and investigators during a trial. Additionally, the FDA “Guideline for the Monitoring of Clinical Investigations” explains monitoring and documentation.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/04%3A_The_Food_and_Drug_Administration/4.03%3A_Section_3-.txt

Objectives • Differentiate between GMP, GCP, GDP, and GLP • Explore Good Laboratory Practices as they apply to animal testing labs • Describe how clinical studies ensure safe, effective, and ethical studies • Demonstrate the use of clinical studies website to research studies • Understand Current Good Manufacturing Practices • Understand what CAPA is and why it is so essential to the FDA and CGMPs. • Explore different quality documents used in biomanufacturing • Identify different types of documentation important to a QMS and CGMPs Good Guidance Practices Guidance documents (and guidelines) are used to relate the FDA's current regulatory principles and practices for the manufacturing of products. In the previous chapter, you were introduced to some of the good practices that the FDA regulates, along with their CFRs; Current Good Manufacturing Practices, Good Laboratory Practices, and Good Clinical Practices. In this chapter, we will extend it to Good Documentation Practices as well and discuss some of the more relevant documents to regulatory affairs. • 5.1: Good Laboratory Practices (GLPs) Good Laboratory Practices (GLPs) came about to improve the confidence of drug safety data for non-clinical laboratory studies. These regulations define the quality system used in non-clinical studies and are meant to ensure the integrity and accuracy of study data as well as the framework for the conduct and reporting of nonclinical laboratory studies. These studies are typically performed on animals and focus on the safety testing of drugs that intend to go through human clinical trials. • 5.2: Good Clinical Practices (GCP) Good Clinical Practices (GCPs) apply to the performance of clinical trials of drug safety and efficacy in human subjects. GCPs aim to protect the rights and safety of human subjects and ensure the scientific quality of the studies. Clinical trials are conducted in stages, and each stage must be successful before continuing to the next phase. Good Clinical Practices (GCPs) are a similar set of standards that apply to human subjects of clinical trials and experiments. • 5.3: Current Good Manufacturing Practices (CGMPs) These guidelines for product manufacturing and testing represent a formal quality system that describes the general principles that must be observed during manufacturing. It is the company's responsibility to ensure GMP compliance and to do so efficiently and effectively. To this end, regulations are relatively flexible. It is up to the manufacturer to establish design procedures, processing methods, and testing procedures. This flexibility gives companies room to experiment and innovate. • 5.4: Good Documentation Practices (GDPs) Regardless of the Guidance Practices being followed, they all exhibit the same philosophy of documentation practices, sometimes referred to as Good Documentation Practices (GDPs). The FDA uses the acronym ALCOA (attributable, legible, contemporaneous, original, and accurate) to describe the importance of GDPs. The key to ALCOA is thorough documentation to ensure reproducibility and traceability. 05: Good Guidance Practices (GXPs) Good Laboratory Practices (GLPs) came about in the 1970s to improve the confidence of drug safety data for non-clinical laboratory studies. These regulations define the quality system used in non-clinical studies and are meant to ensure the integrity and accuracy of study data as well as the framework for the conduct and reporting of nonclinical laboratory studies. Nonclinical studies are typically performed on animals and focus on the safety testing of drugs that intend to go through human clinical trials. Animal studies of pharmaceutical products are regulated by GLP and came about as a result of a 1979 FDA inspection of several testing laboratories were conditions were, quite frankly, appalling, and the animals were treated inhumanely. Any laboratory wanting to run animal tests today must maintain clean, adequate facilities, provide proper care for the animals, and conduct valid tests. All non-clinical safety studies of new drugs and new drug applications, drug biologics, veterinary drugs, and some food additives fall under the purview of GLP regulations. GLPs are regulated by the FDA through the FD&C Act in addition to the Public Health Service Act (PHS Act). Both acts work together to ensure the customer receives a product that is both safe and effective. Human clinical trials are not covered by GLPs as well as preliminary feasibility studies do not have to be conducted under GLP (unless they are performed in animals). Data obtained from non-clinical studies followed under GLPs will be submitted to the FDA to support a product’s overall safety claims. Most FDA centers provide additional directed GLP communication and guidance documents that are unique to the products they oversee. Currently, GLPs are provided by CDER, CBER, CDRH, CVM, and CFSAN. Bioanalytical specimen handling and analysis are not covered by CLIA. The FDA has provided guidance documents that outline bioanalytical testing, which must include the following validation parameters: accuracy, precision, selectivity, sensitivity, reproducibility, and stability. It’s important to note that these validation parameters should be sought for all GLP method validation practices. GLP Regulations and Guidelines In the drug development process, non-clinical studies are performed before an application to perform human studies is submitted. The key elements of a non-clinical study protocol include: 1. The facility where the study is conducted 2. Standard Operating Procedures (SOPs) 3. Personnel involved 4. Equipment used 5. Drug being studied 6. Biological system the drug will be tested 7. How you will plan to document the study 8. How you will retain the records GLPs are Regulated by FDA 21 CFR Part 58 and Include 1. Toxicology studies in laboratory animals 2. Medical device safety testing 3. Biochemistry, immunology & microbiology testing 4. Eye, dermal and muscle irritation studies 5. Pharmacology studies 6. Bioanalytical studies 7. Color and food additive safety 8. Validation of methods for sample analysis The FDA GLP Regulations • Subpart A: General Provisions: Type of products regulated (by agency) • Subpart B: Organization and Personnel: Personnel must have appropriate qualifications • Subpart C: Facilities: All facilities must be of appropriate size and suitable for study • Subpart D: Equipment: Equipment is designed appropriately, and function as intended • Subpart E: Testing Facilities Operation: Test methods, equipment calibration, maintenance, and operation, animal handling SOPs • Subpart F: Test and Control Articles: Chain of Custody • Subpart G: Protocol for and Conduct of a non-clinical Laboratory study: Formal study protocol, and study documentation • Subpart J: Records & Reports: What is needed in the final study report and how the study records will be stored Inspection and Enforcement of GLP Laboratories The FDA may inspect any GLP laboratory to ensure they are following GLP regulations, its physical capabilities in supporting the study, personnel qualifications and training, and equipment. They may perform a routine or surveillance inspection, or they may have a cause to inspect. The primary objectives are outlined in the Bioresearch Monitoring Compliance Program (BIMO) include, which verifies the integrity of data, inspects non-clinical laboratory every two years conducting safety studies, and audits safety studies. More on inspection and enforcement in a later chapter. It’s important to note that following GLPs does not inherently mean your results will not have errors, and your facilities will not have issues. The value of GLPs is setting up the framework to strengthen your study, and increase oversight, and thereby provide confidence in study results. Keeping excellent and retrievable records provide inspectors and auditors easy access to study data to ensure data is accurate, traceable, and complete.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/05%3A_Good_Guidance_Practices_(GXPs)/5.01%3A_Section_1-.txt

The government has an interest in protecting the public from defective products and drugs. Therefore, companies must demonstrate their effectiveness and safety before mass distribution. However, the only way they can actively do this is by having human subjects test out their products. If a potential new product appears safe in animal studies, then a plan is created to investigate the product in clinical trials using human volunteers. The company submits its plan to the FDA in an IND. The IND application includes a description of the product, the results of animal tests, and the plans for further testing. The FDA then decides whether the company’s materials are sufficiently complete that the company can begin testing the product in humans. Explore! Explore more about Good Clinical Practices & Clinical Trials: 1. http://fda.yorkcast.com/webcast/Play/477af877491747379c36c4ab1c7421b9 2. Watch this video on clinical trials youtu.be/pm1igf85uoA Good Clinical Practices (GCPs) apply to the performance of clinical trials of drug safety and efficacy in human subjects. GCPs aim to protect the rights and safety of human subjects and ensure the scientific quality of the studies. Clinical trials are conducted in stages, and each stage must be successful before continuing to the next phase. Good Clinical Practices (GCPs) are a similar set of standards that apply to human subjects of clinical trials and experiments. Regulatory History of GCPs: • The Nuremberg Code lists ten basic moral, ethical, and legal principles outlining medical research established in response to the Nuremberg doctor's trials in 1946. This tribunal launched criminal proceedings against physicians for crimes against humanity in WWI. • In 1964, the World Medical Association established ethical guidelines for biomedical research in humans called the Declaration of Helsinki. These guidelines include essential codes of conduct, including areas involving informed consent, confidentiality, research protocol review, the risk versus benefit analysis, publication and data access to the scientific community, and the importance of the subject’s health over the interest of study. • The Belmont Report (1979), established principles of ethical research emphasizing respect for persons, beneficence, and justice, leading to the Common Rule in 1981. • By the 1980s, it became apparent that representative populations are needed in clinical trials - factors that may influence the effectiveness and side effects of drugs include age (children, older patients), sex, and ethnicity. • In 1989, the FDA issued guidelines asking manufacturers to determine whether a drug is likely to have significant use in older people. • In 1993, the FDA issued the Gender Guideline, which called for assessments of medication responses in both sexes • In 1998, the FDA required that a marketing application analyzes data on safety and effectiveness by age, gender, and race, known as the Demographic Rule. • In 2002, the Best Pharmaceuticals for Children Act was passed to improve the safety and effectiveness of medicines for children. • In 2003, the FDA was given clear authority under the Pediatric Research Equity Act to require drug sponsors to conduct clinical research into pediatric applications for new drugs. Explore! Perform cursory internet research on Tuskegee Syphilis Study (1932-1972). Summarize why this incident would cause outrage and a public apology by a US President? In what ways did this violate the Declaration of Helsinki? What was the regulatory response? (Meaning, what law was passed?) What Are Good Clinical Practices? Although there is no regulation specifically entitled “Good Clinical Practice,” there are several regulations, which govern the conduct of clinical trials. 1. Volunteers participating in a clinical study must be able to give informed consent. This means educating each potential subject on the treatment they are to receive as a part of the study as well as any risks that may be associated with their participation. FDA regulations entitled “Protections of Human Subjects” (21 CFR 50) set forth the requirements for informed consent. 2. Clinical trials must be reviewed by a committee independent of the study sponsor called an Institutional Review Board (IRB) (21 CFR 50). The regulations specify the organization and personnel who make up this board, as well as the records and reports that are to be kept. 3. 21 CFR 312 Subpart D outlines the responsibilities of trial sponsors and investigators during a trial. Additionally, the FDA “Guideline for the Monitoring of Clinical Investigations” explains monitoring and documentation. Test Your Knowledge! Explore MedWatch on FDA website. Then, watch this FDA presentation on MedWatch: 1. What is MedWatch? Why are they important? 2. Look through the safety alerts for human medical products for this year. Discuss one safety alert you found alarming. Ethics of Clinical Studies Many believe that ‘informed consent’ is all that is required to satisfy ethical concerns for clinical studies. It is far more complex than that. In addition to Informed consent, one must consider Social and clinical value, Scientific validity, Fair subject selection, Favorable risk-benefit ratio, Independent review, and Respect for potential and enrolled subjects. https://clinicalcenter.nih.gov/recruit/ethics.html The goal of clinical research is to develop generalizable knowledge that improves human health or increases understanding of human biology. People who participate in clinical research make it possible to secure that knowledge. The path to finding out if a new drug or treatment is safe or effective, for example, is to test it on patient volunteers. However, by placing some people at risk of harm for the good of others, clinical research has the potential to exploit patient volunteers. The purpose of ethical guidelines is both to protect patient volunteers and to preserve the integrity of the science. The ethical guidelines in place today were primarily a response to past abuses, the most notorious of which in America was an experiment in Tuskegee, Alabama, in which treatment was withheld from 400 African American men with syphilis so that scientists could study the course of the disease. Various ethical guidelines were developed in the 20th century in response to such studies. The Belmont Report There are many guidelines in addition to rules and regulations that govern clinical study ethics. Some of the more influential ones include The Nuremberg Code (1947), Declaration of Helsinki (2000), Belmont Report (1979), CIOMS (2002), and US Common Rule (1991). Read the Belmont Report here: https://www.hhs.gov/ohrp/regulations-and-policy/belmont-report/index.html Informed Consent Any patient participating in a clinical study must do so under informed consent. Some exceptions to this rule include military operations or public health emergencies. Informed consent to the FDA does not just include patient authorization but an exchange of information between the subject and the individual obtaining this approval. The subject must have enough information about the study to make an informed decision about their participation in the study. Informed consent is outlined in the Informed Consent Form (ICF), allows the subject time to reflect, and has the information available to do so, and therefore, the ICF is submitted to the FDA for review. Institutional Review Board (IRB) A company must also get approval from an Institutional Review Board (IRB) to perform human testing. The IRB is a group responsible for protecting the rights, safety, and wellbeing of human subjects. It is typically composed of a minimum of five, gender-diverse members; at least one science and one non-science member. The IRB general standards are covered and described in 21 CFR Part 56. FDA has a comprehensive list of regulations that govern Clinical Studies (Clinicalstudies.gov). International GCP guidance documents, which the FDA has collaborated, and links to other sites relevant to the conduct of clinical trials, both nationally and internationally are also found here. Bioresearch Monitoring The overarching goals of the FDA's bioresearch monitoring (BIMO) program are to protect the rights, safety, and welfare of subjects involved in FDA-regulated clinical trials; to determine the accuracy and reliability of clinical trial data submitted to FDA; and to assess compliance with FDA's regulations governing the conduct of clinical trials, including those for informed consent and ethical review. The BIMO program performs on-site inspections of both clinical and nonclinical studies performed to support research and marketing applications/submissions to the agency. Office of Good Clinical Practice Mission Statement The Office of Good Clinical Practice is the focal point within FDA for Good Clinical Practice (GCP) and Human Subject Protection (HSP) issues arising in human research trials regulated by FDA. Clinical Study Initiation The following is needed by a sponsor to initiate a clinical study: 1. IRB 2. Documentation of the clinical investigator’s credentials 3. Financial disclosure (grant-sponsor) 4. GCP assurance statements 5. Verification of study protocol training Clinical Study Reporting The investigator must provide clinical study progress reports at specified intervals during the study. Clinical Study Design A clinical study is any research study that involves one or more human subjects testing experimental new drugs, devices, or biologics (or control). It is the investigator's job to design the clinical study protocol. There are two main types of clinical trials; clinical (interventional) studies, and observational studies. For certain medical devices, accuracy studies may also be appropriate. Within the clinical study type, there are several subtypes, which may include placebo-control, double-blind studies, and randomization controls. Test Your Knowledge! Beth is a 46-year-old post-menopausal mentally disabled woman with LCIS, meaning, she is predisposed to develop breast cancer later in life. Her caregivers with power of attorney for health care decisions, bring her to the clinic for enrollment in a clinical trial, which is a randomized trial of tamoxifen v. raloxifene for the prevention of breast cancer in high-risk women. She fulfills all entry requirements but cannot consent due to her mental disability. The IRB is considering, is it ethical to permit Beth’s power of attorney to enroll her in this study? *Remember, we are focusing on ethics here – not the law*. 1. What is an IRB? What is their function? 2. Using what you’ve learned in this chapter on GCPs and the ethics resources below, argue for OR against the IRB ruling to grant Beth’s power of attorney permission to enroll her in the study. Clinical Trials During a clinical trial, participants may receive a particular intervention, an investigational new drug, device or biologic, or even psychological treatment, for example, diet or quit smoking. These interventions may be a comparison of a current drug to a new investigational drug, a placebo with no active ingredient to an existing drug, to name a few examples. The trial may also be randomized, placebocontrol, and blinded to reduce study bias. The Four Phases of Clinical Trials 1. In Preclinical Studies, the drug is tested on animals for safety and efficacy. 2. Phase I clinical trials primarily test for the safety of the proposed drug in healthy humans. During Phase I trials, the drug is administered to 20-80 healthy volunteers who will report any unexpected side effects and help establish the dosage levels that can be tolerated. In addition to evaluating the safety of the drug, its metabolic and pharmacologic properties in healthy humans are determined. If a drug meets the safety requirements at this phase and appears to have the desired impact of treatment, then it enters Phase II clinical trials. 3. Phase II trials are performed on a small number of patients to determine the drug's efficacy. Between 100 and 300 patients that the drug is intended to treat are given various dosages. Clinical trial participants are carefully monitored for side effects as well as the consequences of the drug treatment. If there no detrimental side effects, and the drug has a positive effect, it goes to phase III. 4. Phase III trials involve between 1,000 and 3,000 patients in double-blind studies usually conducted across several hospital sites. For most new drugs, these tests will last three or more years to establish the drug's benefits, recommended dosage, and long-term safety. Additional data on drug-drug interactions and risks versus benefits are collected. 5. Phase IV trials are performed after the drug has been approved by the FDA. This post-market surveillance help gathers additional information on drug safety and efficacy by the general population. Medical Device Clinical Trials Not all medical devices undergo clinical trial testing. Minimal risk devices such as bandages (Class I) do not require clinical trials, where Class II devices of intermediate risk may depend on the device. Class III devices have a substantive risk and therefore undergo clinical trials. Another difference between medical device clinical trials is what is tested. For drugs, a dosage is tested; however, in devices the prototype is. Since there is an array of types of medical devices, we will further explore this in a later chapter focusing on medical devices. The NIH has a public-accessible registry of all clinical trials currently underway and includes the results, appropriately named ClinicalTrials.gov. Explore! Go to ClinicalTrials.gov and “search for a study” of something that interests you. For example, if you have been following the latest Ebola or Zika virus outbreak, you may wonder about the status of any current vaccine study. Write a 5-sentence summary of the study you selected.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/05%3A_Good_Guidance_Practices_(GXPs)/5.02%3A_Section_2-.txt

These guidelines for product manufacturing and testing represent a formal quality system that describes the general principles that must be observed during manufacturing. It is the company's responsibility to ensure GMP compliance and to do so efficiently and effectively. To this end, regulations are relatively flexible. It is up to the manufacturer to establish design procedures, processing methods, and testing procedures. This flexibility gives companies room to experiment and innovate. Published in 1963, the first set of Good Manufacturing Practices (GMP) was intended to prevent deaths and injuries from contaminated products. These regulations seek to ensure the quality and purity of drugs products from batch-to-batch and put a system in place to detect and reduce errors and variation in manufacturing. In 1990, the FDA revised CGMP regulation to add the design controls authorized by the Safe Medical Devices Act. The FDA believed that it would be beneficial to the public and the medical device industry for the CGMP regulation to be consistent with international standards ISO 9001:1994 and ISO/CD 13485 "Quality Systems--Medical Devices--Supplementary Requirements to ISO 9001.” After an extensive effort, the part 820 revision was published on October 7, 1996 (61 FR 52602), and went into effect June 1, 1997. Additionally, it should be noted that CGMPs represent only the currently accepted minimum standards for manufacturing, testing, and packaging drugs and medical devices. Most companies go beyond minimum guidelines to assure a customer a high-quality product. They frequently employ multiple quality systems, including voluntary ones, which gives the consumer peace of mind and a level of trust in the safety of the product. GMP Guidelines Follow a Few Basic Principles: 1. Define, control, and validate all critical manufacturing processes. 2. Changes to the manufacturing process must be evaluated and approved. 3. Instructions and procedures must be written and easy to understand. 4. Production operators must receive thorough training 5. The company must maintain accurate records demonstrating their adherence to guidelines and regulations. 6. Records must be comprehensive, complete, and easily accessible. 7. In the case of pharmaceuticals, quality is not diminished in any way by the distribution process. 8. A recall system is in place so that any batch of a drug may be easily recalled from sale or supply. 9. The company responds to complaints, quality defects are investigated, and appropriate measures are taken to prevent future errors. CGMP Regulations GMP regulations are included in Title 21 Chapter 1 of the CFR, in three regulations dealing with different types of manufactured products: 1. for drugs (21 CFR 211) 2. for medical devices (21 CFR 820) 3. for blood and blood components (21 CFR 606) The general principles of CGMP that all these regulations have in common: 1. Quality, safety, and effectiveness are designed and built into the product, not tested or inspected into the product. 2. Each step in the manufacturing process is documented and controlled to ensure that the finished product meets design and compendia specifications. 3. Process documentation provides evidence of compliance with CGMPs. Three primary criteria used by the FDA in the design of these CGMP regulations: 1. Regulations should contain objectives and not detailed specifications. They should allow latitude for different manufacturers to find their means of compliance. 2. Regulations should contain requirements that are considered feasible and valuable as recognized and considered by experts as assuring quality. 3. If a practice can be established to be reasonable and relevant, then it can be a required practice even though it does not exist in the regulations. Designing a GMP-Complaint Process 1. The purpose of the process must be defined; that is, the desired output must be determined. 2. An endpoint(s) that demonstrates the process is performed satisfactorily must be defined. 3. A method to measure the desired endpoint is required. 4. Raw materials and their specifications must be established. 5. The steps in the process must be determined, usually by experimentation. 6. The process must be scaled-up for production. 7. An analysis of potential problems must be performed, noting the "critical points." 8. Experiments must be carried out to determine how the process must operate at each critical point to make a quality product. 9. Methods to monitor the process must be developed. 10. Methods to control the process must be developed. 11. Adequate record-keeping procedures must be developed. 12. All SOPs required for the process must be written and approved. Corrective Action Preventative Action (CAPA) CAPA is an important part of any CGMP design and focuses on the systematic investigation of root causes of issues in the manufacturing process. CAPA is a way in which manufacturers can implement continuous improvement plans and Quality Management systems and have a large impact on FDA compliance. There are three main CAPA categories: Corrective actions that have never occurred, Corrective Actions of reoccurrences, and Preventative Action to prevent an occurrence. CAPA is mandatory for medical device manufacturing, and we will discuss CAPA more in the medical device chapter. Learn more about CAPA here: www.fda.gov/downloads/Drugs/DevelopmentApprovalProcess/Manufacturing/UCM334579.pdf Setting standards for quality in the biotechnology industry is difficult due to the often new and complex manufacturing processes involved. How should the FDA set quality standards, for example, for chromatographic purification systems? These processes are difficult to validate and represent ‘gray’ areas where quality regulations are concerned. For this reason, companies frequently rely on regulations that the FDA has not yet finalized, and they comply voluntarily with CGMPs and Guidelines. The CGMPs for Medical Device, Pharmaceuticals & Biologics will be further explored in those respective chapters. The commonality between the three products in CGMP regulations is that the regulations are intended to ensure the safety and efficacy of those products. Failure to abide by CGMP requirements may result in adulterated products and FDA enforcement repercussions (explored in a later chapter). As regulations change, manufacturers must learn and comply with the new regulations. Continuous improvement, CAPA, internal audits, and FDA inspections all work together to ensure Quality by Design, and not by testing.

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/05%3A_Good_Guidance_Practices_(GXPs)/5.03%3A_Section_3-.txt

Regardless of the Guidance Practices being followed, they all exhibit the same philosophy of documentation practices, sometimes referred to as Good Documentation Practices (GDPs). The FDA uses the acronym ALCOA (attributable, legible, contemporaneous, original, and accurate) to describe the importance of GDPs. The key to ALCOA is thorough documentation to ensure reproducibility and traceability. The FDA's (and most quality system’s) position regarding documentation is, ‘if it isn't written down, it wasn't done.' Proper documentation is essential in a regulated company from discovery through to the customer's hands. It provides regulatory bodies, lawyers, patent offices, and peer review publishers the information they need to validate the product’s manufacturing process. While regulatory agencies tell you what you must do, they don't tell you how. Current good manufacturing practices (CGMP), for example, is not a prescription for production manufacturing but guidelines. This chapter focuses on some common and important elements of documentation that is found in both regulated and non-regulated workplace. Documentation Serves Three Fundamental Purposes: 1. As a project-planning tool, documentation improves the communication of project goals and priorities. 2. Documentation provides a historical record of who-what-when-where-why-how; what was done, how it was done, what was changed, who did it, when it occurred, and why it was done. Accurate records are often a firm’s best defense in cases of litigation. 3. It is required by CGMP, ISO, QSR and GLP guidelines and regulations that clearly recognize that documentation makes good common sense. The phrase "documentation and traceability" is familiar to all companies that must comply with FDA regulations. A company must be able to provide records to demonstrate traceability of all the parts of a finished product, including but not limited to raw materials, intermediates, and final lot batches. A final product can be released only if the documentation that has traced it from start to finish is complete, the product has met all required product specifications, and it has been produced in compliance with the necessary regulations. Therefore, regulated companies have systems that ensure the work is recorded, that the appropriate documents are completed, and that the documents are stored in a secure and readily retrievable location. Documents that are archived must be easily retrieved in cases where customers question the quality of a product purchased, or when the company is being inspected or audited by a regulatory agency. In all cases, the consequences of missing documentation can be severe. Indeed, the company's very survival depends on these documents. Documentation is probably the first and most significant CGMP requirement needed in a new biotechnology company. The challenge is to establish, with limited resources and with a small staff who may have limited experience in CGMPs, the same degree of CGMP compliance as larger pharmaceutical companies. In some companies, as a new product is developed for production, the process of record-keeping is often viewed as inhibiting the progress of the project. Documentation slows down and burdens day-to-day operations due to the time spent filling out and signed off on forms and then carefully archiving them. There is no shortcut, however. Although cutting corners on record-keeping may seem advantageous at first, lack of documentation can cause delays by causing fundamental experiments and processes to be needlessly repeated or result in faulty conclusions. When a company manufactures a pharmaceutical, it produces two products: the drug and the enclosed documents that went into making the drug. In summary, documentation functions to: Record what has been done, establish ownership, provide workers specific instructions on how to perform a task, develop product specifications, demonstrate procedure was performed correctly, record experimental parameters, provide an evidence trail, ensures traceability, establishes a contract between a company and a consumer and establishes an agreement between a company and regulatory agencies. Types of Documentation Documentation is essential in all biotechnology work areas, although the specific types of documents and the systems for documentation vary according to the kind of workplace. Each company will have a set of documents to reflect their needs and requirements. There are three broad classes of documents. 1. Directive documents instruct employees on how to perform a task. Examples include standard operating procedures and protocols. 2. Data collection documents record data to provide evidence that the directive document was performed and performed correctly. 3. Commitment documents lay out the organization’s quality system; goals, and standards they commit to following. Mission statements, vision statements, and quality statements are all examples of commitment documents. Laboratory Notebooks This documentation enables investigators to reconstruct their work, solve problems, detect mistakes, and prove to the scientific community that their results were properly obtained and were accurately reported. Laboratory notebooks can be used to establish a patent claim, assign credit for an original discovery, document data integrity for publication, and troubleshoot problems. It is, therefore, essential that it is written with indelible ink and be legible, clear, and complete. Laboratory data can be subpoenaed in litigations. It can be examined by any regulatory agency that requests it. Notebook integrity is important even in non-regulated research labs. A notebook may be used to document data to support research publications that have used government funding, may support a patent application, or may support an investigational new drug application or a new drug application to the FDA. A messy lab notebook, or one not maintained with integrity, may result in losing a patent, having grant funding withdrawn, having to repay grant funding, having to pay fines, losing your job and being given probation and jail time. Explore! Read the following news article on the scientific misconduct of an HIV Scientist. What is Dr. Han accused? What are some of the ‘mistakes’ he made that he could have easily avoided? What are the ramifications he faces of being found guilty of scientific misconduct? www.desmoinesregister.com/story/news/crime-and-courts/2015/07/01/dong-pyou-hansentencing-iowa-state-scientist-aids-vaccine-fraud-case/29560297/ Learn more here: https://en.Wikipedia.org/wiki/Scientific_misconduct Standard Operating Procedures (SOPs) People in production facilities use documents other than laboratory notebooks. Standard Operating Procedures (SOPs) that describe how to perform a task are essential in production facilities. A procedure is a written document that provides a step-by-step outline of how a task is performed. Most production facilities (and many laboratories) use procedures to instruct personnel on how to perform procedures or tasks. Everyone follows the same procedures to ensure that tasks are performed consistently and correctly. SOPs must be written so that they are clear, easy to follow, and can accommodate minor changes in instrumentation. SOPs are typically written in command sentences rather than a narrative. The placement and distribution of SOPs are controlled and documented, and they are reviewed on a periodic basis. Standard Operating Procedures describe what is required to perform a task, what problems may arise and how to deal with them, how to document that the task was performed correctly, and, lastly, who is qualified or responsible for the work. SOPs are Important for Many Reasons 1. Provide consistency each time a procedure or process is performed. 2. Serve as reminders to ensure that work is done properly 3. Used to train new employees the correct way to perform the work 4. Reduce the possibility of failure by enabling the employee to complete any task Forms Forms are often associated with SOPs. These forms require an individual performing the task to monitor the process or procedure as it is performed. Filling in blanks and initialing the steps as they go along ensures that the steps are followed correctly. In production, the form often has blanks to record information about ID/lot numbers of raw materials, weights, times, temperatures, and other information necessary for quality control of the end-product. In some production laboratories, a witness must sign key steps. Protocols The term protocol may be used to refer to a procedure that will be performed one time and may apply to a task or experiment that is intended to answer a question or test a hypothesis. The protocol outlines the steps that are to be followed in performing the experiment. SOPs are not intended to lead to the answer to a question or test a hypothesis. Protocols in research questions are addressed continuously. In production facilities, issues related to product performance, effects of storage (both short and long-term) on the product, quality of the product under different conditions, etc. Reports A report is a formal document that describes the results of a completed task. The report summarizes what was done, by whom, why, the data (results), and the conclusions. A report is written in a narrative addressed to a particular type of reader, with enough background information and technical information to achieve an appropriate amount of information. For example, reports to upper-level management may not include as many specific details as reports addressing regulators. Some reports are published in scientific journals, such as reports of basic scientific research. Other reports, such as those of investigations performed in a company, may or may not be published, but must be made available to inspectors. Explore! Learn about the office of research integrity (ORI). What do they do? Go to: http://ori.hhs.gov/case_summary. Pick a case you find interesting and summarize the findings of the ORI and the punishment. Lab Reports and Scientific Papers Have Four Typical Functions 1. To persuade other people to accept your hypothesis based on the data you’ve presented. 2. To publish your data, methods, material, and results for other researchers 3. To become an accepted part of the scientific community by contributing to the body of knowledge 4. To provide a record of research for documentation, storage, and future reference Logbooks Logbooks are used to maintain information about the status and maintenance of equipment or instruments. Logbooks are usually bound notebooks. Whenever an instrument or piece of equipment is used, calibrated, preventative maintenance performed, and the instrument or item is repaired, that information is recorded in the notebook. Analytical Laboratory Documents Analytical laboratory documents contain data from analytical tests that measure some parameters in a sample. Clinical laboratories analyze blood for cellular components, ions, drugs, and enzyme levels. The product is the test result. Documentation includes the sample being tested and the test methodology. The elements of an analytical laboratory document differ from lab to lab and depend highly on regulations – such as CLIA (more on this in a later chapter!). Numbering Systems Identification numbers are used to identify items uniquely. Identification numbers are used for traceability purposes and are used for generalized inventory; raw materials, products, equipment, and even documents! Identification numbers should identify the item uniquely. Labels Labels identify instruments, raw materials, products or other items. Label format & contents are highly regulated by the FDA. Can you find the CFR for labeling drugs? Chain of Custody Forms Chain-of-custody is a term that refers to the maintenance of an unbroken record of possession of a sample from the time it is collected through delivery, receipt, storage, analysis, or disposition. Chain-of-custody documents are a method of organizing information about samples. The establishment of chain-of-custody procedures is necessary because the results of testing or analysis might be held as evidence in litigation proceedings. Each sample is assigned a unique identification number and logged in and out, as it is processed. To demonstrate the importance of chain of custody forms, consider, the O.J. Simpson trial verdict was based on inadequate documentation of the chain of custody of the DNA evidence. While the DNA fingerprinting science was sound and rigorous, poor documentation of who handled the blood samples, when, where, and how, led to the acquittal. Training Records The FDA requires a documented continuous training program for compliance with the CGMP regulations. It is the responsibility of Quality Assurance to verify that a CGMP training program is implemented and that it is an ongoing program. In addition to CGMP training, regulations require that all employees be adequately trained in their job functions, whether they are new hires or existing employees who are learning new methodologies or the operation of new equipment. Training is based on the company's own written and approved SOPs. It must be well documented and provides the necessary tools and expertise needed to train the employees. Regulatory Submissions Regulatory submissions are documents designed to meet the requirements of an outside regulatory agency. Pharmaceutical companies must apply to the FDA, showing their preliminary research on a drug, their plan for clinical trials and other relevant information before they can begin field-testing a new drug in humans. Batch Records (BPR) Batch Production Records (BPR) are a requirement of Good Manufacturing Practices. They are an accurate copy of the corresponding Master Production and Control Record. BPRs are carefully designed so that all appropriate process information is documented and demonstrated in writing. The BPRs must be reviewed for accuracy and must be signed and dated by a quality group before their use in manufacturing. A BPR is a combination of an SOP document and a form in that it directs operators in how to make the product and each step has blanks that are filled as the technician performs the action. For critical steps, a witness is required to watch and sign off on the BPR. Batch records are legal documents and are part of process validation compliance. The quality department officially issues the batch record to the production crew, and it is essential that blanks be filled in as procedures are performed. BPRs may be in a central location or distributed in different areas provided that they are easily retrieved and filed in a logical and orderly manner. BPRs must be kept for a minimum of 1 year after the expiration date of a corresponding lot of the product. Electronic Documentation The biotechnology field uses a diverse and complex mixture of both paper and electronic documentation. There are many advantages and disadvantages to both, but companies tend to choose the documentation process that best serves their needs while meeting regulatory requirements. In response to the extensive use of electronic documentation and demand for systematic regulation of such documentation, in 1997, the FDA issued regulation 21 CFR Part 11 Electronic Signatures; Final Rule, to address these concerns. In 2003, the FDA released its final “Guidance for Industry Part 11, Electronic Records; Electronic Signatures — Scope and Application”. The purpose of these regulations is to encourage pharmaceutical companies to adopt modern electronic documentation methods while requiring them to validate these electronic methods as secure, reliable, and as searchable as paper documentation practices. The following table outlines some vocabulary used concerning 21 CFR Part 11. 21 CFR Part 11 1. Audit Trail. Computer generated time-stamp trail. 2. Biometrics. Method to identify an individuals’ identity. 3. Closed System. Only accessible to people needing the system. 4. Electronic Laboratory Notebook. Computer software programs designed for use as a lab notebook. 5. Electronic Records. Text, graphics, data, audio information that is created modified, maintained, archived, retrieved, or distributed by a computer system. 6. Electronic Signature. Equivalent to a hand-written signature. 7. Encryption Software. Translates information into a secret code 8. Hybrid System. Uses both systems; paper and electronic. 9. Laboratory Information Management System (LIMS). Computer-based lab management system Explore! Read the following article on unintentional scientific misconduct in using paper laboratory notebooks. From what you learned in this article, what are some examples of unintentional scientific misconduct? How can an electronic notebook help avoid some pitfalls of scientific misconduct using electronic notebooks? Managing Change in Documentation It is necessary for a production facility to follow the same procedures to the letter with each batch of product produced, and it is important that all supporting laboratory analyses also support a single set of protocols to reliably produce a consistent result. This rigid adherence to carefully described procedures helps prevent inconsistent results, but it stifles improvements that might help to improve or streamline a process. When a change is made, the change is carefully agreed upon by all parties involved, and all involved must have a procedure for enacting the change. Typically, a request for changes to methods, sampling data sheets, or calibration instructions may be made by anyone impacted by the proposed change. The request is made in writing following the company established Change Procedure. A committee or Quality Assurance Manager usually approves such a request depending on the hierarchal structure of the company, and the change being made. The Quality Assurance department is usually responsible for seeing that all copies of obsolete documents are electronically archived, and printed copies are removed and destroyed. They are also responsible for monitoring activity to ensure that approved changes are incorporated into the laboratory's routine work activity, and the change has had no known deleterious effects. Document Storage and Retrieval It is crucial that all files relating to product manufacturing be kept securely and be readily accessed during quality system inspections (for example, by the FDA or ISO auditors). All records, when not in use, must be kept in locked (and fireproof) storage rooms. Computer data security will be maintained by data processing standard operating procedures for restricting entrance to computer data information. How long records are kept is determined by regulations, the product made, and company policies. Records that are originated and maintained as hard copies are retained for five years, and three years after the batch has been released. Many companies have moved to transfer paper to electronic format after five years and kept indefinitely. Records generated by computer will be retained in that form indefinitely, with due care to keeping them in safe, hazard-free storage. In summary, all materials received and used, and all procedures and processes followed by a firm are carefully described and followed, leaving a paper trail that is carefully archived. However, burdensome this might be to the company; it is essential in quality assurance and in protecting the firm from litigation. Furthermore, this paper trail is required by many regulatory agencies and is key to access international markets. Document Regulations Depending on the quality system used (and the regulations surrounding that quality system), there are many different types of quality system documentation requirements. Below is a very brief review of quality system regulations in the CGMP and ISO 9000 systems. 21 CFR 211 Title 21 Chapter 1 of the CFR contains all regulations concerning the safe production of food, drug, medical device, diagnostic, and biologic products for human and animal use under FDA supervision. (fda.gov) Documentation is under Part 211. Explore! Go to the CFR database and search for Part 211. What subpart covers records? How long do records have to be maintained? Briefly describe each of the Records & Reports 8 sub-parts cover. ISO 9001 Documentation A valid quality system, even a voluntary one such as ISO 9001, requires rigorous documentation and disciplined record keeping. Some of the activities of record-keeping required by ISO 9000 include, but may not be limited to, training records, policies, procedures, instructions, protocols, purchasing records, test data, audit records, and calibration records. This type of documentation is part of the proof required to show that the company is following ISO guidelines in its quality management system and as such, is a necessary component in maintaining its accreditation. Documentation processes in an organization may differ depending on the size of the organization, the scope, and complexity of its activities and many other factors. However, one thing is sure, for ISO 9001 certification, this documentation must be thorough, complete and up to date. The ISO 9001:2015 guidance's on documentation allows organization flexibility in the way it chooses to document its quality management system (QMS). ISO permits each company to determine what documentation is necessary to prove the effective planning, operation, and control of its processes, and continual improvement of the effectiveness of its QMS. ISO 9001:2015 clause 4.4 Quality management systems and its processes require an organization to "maintain documented information to the extent necessary to support the operation of processes and retain documented information to the extent necessary to have confidence that the processes are carried out as planned." (ISO, 2015). Guidance on the requirement for documented information for ISO can be found here: http://www.iso.org/iso/documented_information.pdf Test Your Knowledge! As the Quality Manager of Proteins ‘R Us, you oversee a pharmaceutical firm's Quality Department and have been given notice by a customer's lawyer that his client has suffered severe damage from your antibiotic product and intended to sue for damages. Explain in what way each of the following documents could play a role in protecting your firm from this litigation: 1. R & D laboratory notebooks 2. Monthly reports from R & D to upper-level management 3. Production equipment logbooks 4. Product label 5. Chain-of-custody forms 6. Production personnel training records 7. BPRs

textbooks/bio/Biotechnology/Quality_Assurance_and_Regulatory_Affairs_for_the_Biosciences/05%3A_Good_Guidance_Practices_(GXPs)/5.04%3A_Section_4-.txt