Datasets:

moukaii

/

Tuberculosis_Dataset

like 16

PMC3605086_01

Female

A 68-year-old nurse presented with new onset of floaters in both eyes in August 2009. She noted her symptoms to be painless without eye redness or discharge. She stated that her symptoms progressively worsened with decreasing visual acuity. She was initially seen by an ophthalmologist 2 months after her symptoms started and was diagnosed with bilateral panuveitis. She denied any trauma or injury to the eye, or having any previous ocular history. Her past medical history was significant for insulin-dependent type 2 diabetes mellitus, hypertension, and hypercholesterolemia. She has a history of being purified protein derivative (PPD) positive with a negative chest X-ray, for which she had never received treatment. Her visual acuity was initially 20/200 in the right eye and 20/200 in the left eye. Intraocular pressures were within normal range, and her pupils were equally reactive without the presence of a relative afferent pupillary defect. Slit-lamp examination showed 1+ anterior chamber cells in both eyes. Ophthalmoscopic examination of both eyes showed vitreous cells, optic disc edema, small amounts of subretinal hemorrhage, and punctate choroidal lesions throughout the fundus (Figure 1). A fluorescein angiogram showed blockage in areas of blood, significant staining in the location of the choroidal lesions without much leakage, and optic nerve hyperfluorescence bilaterally (Figure 2). Laboratory investigations revealed a white blood cell count of 11.7 x 109/L. Her erythrocyte sedimentation rate, angiotensin-converting enzyme, liver function test, serum urea and electrolytes, and chest X-ray were normal. Treponema pallidum particle agglutination assay was nonreactive, and Bartonella titers were negative. She was positive for QuantiFERON-TB Gold, but had a negative chest CT scan and normal brain MRI scan. After consultation with an infectious disease specialist, she was started on prednisone and antituberculosis medications to cover a possible infection given her positive QuantiFERON-TB Gold test result and prior positive PPD test. The patient developed severe nausea after starting her antituberculosis medications and immediately stopped taking these medications. By this time, her vision had decreased to between 6/200 and 20/500 in the right eye but remained 20/200 in the left eye. Given the need for immunosuppression along with the patient's intolerance to antituberculosis medications, a definitive diagnosis for the cause of her choroiditis was urgently needed. As a result, she underwent a pars plana vitrectomy and chorioretinal biopsy of the right eye to confirm whether the etiology of the patient's multifocal choroiditis was related to a possible extrapulmonary Mycobacterium tuberculosis infection. The biopsy (0.3 x 0.2 x 0.1 cm) was fixed in 4% formaldehyde and processed entirely in paraffin, and multiple sections were cut and stained with hematoxylin and eosin as well as Brown and Brenn tissue gram stain, Ziehl-Neelsen stain, and Fite's acid-fast stain for mycobacteria, and Grocott's modified Gomori's methenamine silver stain for fungal elements. Microscopic examination revealed a small fragment of uveal tissue expanded by inflammation (Figure 3A) comprised of densely infiltrative, benign-appearing lymphocytes surrounding noncaseating histiocyte clusters (Figure 3B) that are well circumscribed (Figure 3C) and contain occasional multinucleated giant cells (Figure 3D) indicative of granulomatous inflammation. No microorganisms were identified. Unstained biopsy sections were submitted for polymerase chain reaction (PCR) testing in which no AFB DNA was detected with 16S rDNA, rpoB, and hsp65 primer sets, no M. tuberculosis complex DNA was detected with hsp65-amplified probe, no Mycobacterium avium complex DNA was detected with hsp65-amplified probe, and no fungal DNA was detected with 28S rDNA and ITS primer sets. Chorioretinal results effectively ruled out an infectious cause for her uveitis. Following this negative biopsy, the patient was diagnosed with ocular sarcoidosis and was started on immunomodulatory therapy for sarcoid-related multifocal choroiditis. She was placed on long-term methotrexate and had resolution of her disc edema, inflammation, and retinal hemorrhages by 1-year follow-up, and stabilization of her chorioretinal lesions. Unfortunately, her visual acuity remained poor given the chronicity of her disease and continued to decline in her right eye secondary to cataract progression.

PMC3229087_01

Male

A 55-year-old previously healthy man was admitted with 12 days history of fever and fatigue. He was white, native of Argentina, and denied recent foreign travel, alcohol or drug abuse. He had no significant medical history. He had neither vomiting, nor abdominal spontaneous pain. Clinical examination showed temperature of 40 C and tenderness to percussion over the right upper quadrant of the abdomen. The remainder of the physical examination was unremarkable. Laboratory tests were remarkable for leukocytosis (41 900 cells/mm3), erythrosedimentation rate 73 mm/hour, C reactive protein 372 mg/L, and moderate elevation of alkaline phosphatase and g-glutamyl transpeptidase. HIV serology was negative. Fasting plasma glucose levels were normal. Abdominal computed tomography (CT) scan with double contrast showed a 15 cm hypodense lesion with internal septa in the liver Fig. (2a), and a hypodense tumour-like lesion with narrowing of the gastric lumen Fig. (2b). The latter was further investigated by endoscopy-ultrasound (EUS), which showed a 3-cm well-circumscribed hypoechoic submucosal mass suggestive of intramural gastric abscess Fig. (3a,b). Chest x-ray, transthoracic echocardiography and abdominal Doppler ultrasound were normal. Blood cultures were taken. A presumptive diagnosis of liver abscess was made. The patient was started on ceftriaxone plus metronidazole empirically. Sonography-guided percutanous drainage was placed yielding 60 ml of purulent fluid whose Gram stains showed gram-negative bacilli. Histological examination disclosed inflammatory cells and was negative for malignancy. Blood and abscess aerobic cultures yielded a gram-negative lactose-fermenting bacillus identified as Klebsiella pneumoniae, whose colonies were particularly sticky. Hypermucoviscous phenotype was confirmed by a positive string test: formation of viscous strings >= 5 mm in length when a standard bacteriologic loop was used to stretch the colony on agar plate Fig. (1). Antibiotic susceptibility testing was performed by Etest according to Clinical and Laboratory Standards Institute guidelines. The strains were only intrinsically resistant to ampicillin. Metronidazole was discontinued. Two weeks after admission the patient became afebrile and drainage was removed. The gastric lesion markedly decreased in size during hospitalization. He was discharged on oral ciprofloxacin to complete a 6-week course. A follow-up CT after antibiotic therapy was completed showed resolution of the abscesses. Patient turned to his usual state of health. Four isolates of K. pneumoniae from the patient (2 strains from liver abscess and 2 strains from blood) were sent to the National Health Research Institute of Taiwan for further molecular studies. Isolates were serotyped using capsule swelling reaction with antisera obtained from Health Protection Agency in UK and by PCR as previously described Table 1. In addition, one tube multiplex PCR for K1, K2 and K5 were performed according to previously published method. Since magA, rmpA and aerobactin are virulent genes associated with KLAS, PCR was used to target these genes. An overnight-cultured bacterial colony was added to 300 mul water and boiled for 15 min to release DNA template. Previously published primers used for PCR were listed in Table 1. The reaction mixture was kept at 95 C for 5 min, followed by 40 temperature cycles of 95 C for1 min, 50 C for 1 min, and 72 C for 2 min, and 72 C for 7 min. MLST was performed according to Turton et al., to characterize the genotype of the isolates, by determining the nucleotide sequences of seven housekeeping genes (gapA, infB, mdh, pgi, phoE, rpoB, and tonB). Sequences of these housekeeping genes were obtained for isolates from liver abscess patients and carriers. Sequences information was compared with those MLST web site () developed by Keith Jolley. Alleles and STs were assigned accordingly. Sequences of any alleles that were not on the database were submitted to the curator and obtained for the allele number. Difference in two or more alleles was considered to be unrelated. Bacterial DNA was prepared and subjected to PFGE as previously described. The restriction enzyme XbaI (New England Biolabs, Beverly, MA, USA) was used at the manufacturer's suggested temperature. Restriction fragments were separated by PFGE in 1% agarose gel (Bio-Rad, Hercules, CA, USA) in 0.5xTBE buffer (45 mmol/L Tris, 45 mmol/L boric acid, 1.0 mmol/L EDTA, pH8.0) for 22 h at 200 V at a temperature of 14oC, with ramped times of 2 to 40 s using the Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories, Richmond, CA, USA). Gels were then stained with ethidium bromide and photographed under ultraviolet light. The resulting genomic DNA profiles, or "fingerprints", were interpreted according to established guidelines . Virulence was determined by mouse inoculation: ten mice were used as a sample population for each bacterial concentration. Since all isolates were identical, one isolate was selected for lethal dose causing 50% death (LD50). A 10-fold serial dilution of CFU of K. pneumoniae was made and BALB/c mice were injected intraperitonially with 0.1 ml of each concentration. Symptoms and signs of infection were observed for 14 days. Survival of the inoculated mice was recorded and the LD50 was calculated using SigmaPlot version 7.0 from SPSS Inc. (Chicago, IL). The results obtained were as follows. All strains from different isolation sites were serotype K1 by PCR and had identical profile by PFGE Fig. (4). All strains were positive for rmpA, wzyKpK1 and aerobactin genes as revealed by PCR using specific primers Fig. (5), Fig. (6). By using MLST, all strains belonged to ST 23 (allelic profile: GapA: 2, Inf: 1, Mdh: 1, Pgi: 1, Pho: 9, rpoB: 4, TonB: 12). The LD50 of the isolate was <102 CFU.

liver abscess hipermucoviscous klebsiella pneumoniae, maga, rmpa

PMC3926763_01

Female

A ten year old female has been allowed in hospitalization for intense frontal headaches. Theses headaches were associated to a progressive loss of the vision and to tonic seizure of the lowers members. These clinical signs had evolved for four (4) months. The neurological examination was normal. The examination of the other devices was also normal and there was no fever. Computed tomography scan (CT Scan) revealed a nodular formation (19 mm high on 16.7 mm wide) in the anterior part of the third ventricle with an obstructive hydrocephalus (Figure 1). This lesion was enhanced by the contrast administration (Figure 2). The likely diagnosis of intraventricular tumor (colloid cyst) was evoked. A total removal has been performed using a subchoroidal approach. The patient left the hospital 8 days after surgery. Histological examination revealed the presence of central necrosis surrounded by a tuberculous like granuloma (Figure 3). A new clinical status of the patient did not show tuberculosis infection stigma, HIV serology was negative. The Tuberculin skin test and the lung radiography were also normal. The confirmation of the tuberculous etiology was obtained by the Polymerase Chain Reaction (PCR). The CSF examination showed only 3 cells (3 lymphocytes) and the bacteriological examination using the ziehl-nielsen staining was negative. Protein level in CSF was normal (0.4g/l). She was treated with antituberculous chemotherapy including Isoniazid, Rifampicin, Pyrazinamid and Ethambutol for six months. The patient is living normally and is following her secondary studies, six (6) years afterwards.

intraventricular tuberculoma, third ventricle, tuberculoma

PMC9553510_01

Male

A 49-year-old male underwent open cholecystectomy for acute calculous cholecystitis 8 years back. Intraoperatively, there were dense adhesions in Calot's triangle. Bile duct injury was detected and managed with T-tube placement. He was then referred to our center where he was continued on T-tube drainage and managed conservatively. T-tube was removed after 33 days, and he was kept under regular follow-up. His follow-up investigation report revealed a total bilirubin (TB) 337 umol/L, direct bilirubin (DB) 250 umol/L, serum glutamic oxaloacetate transaminase (SGOT) 56 U/L, serum glutamic pyruvic transaminase (SGPT) 65 U/L, and serum alkaline phosphatase (SAP) 1050 U/L, showing a cholestatic pattern. He was then planned for magnetic resonance cholangiopancreatography (MRCP) which revealed Bismuth type II stricture (Figure 1). For this, he was managed with PTBD and was planned for a definitive procedure. During his follow-ups, his bilirubin level gradually decreased. He underwent hepaticojejunostomy for biliary stricture after 5 months of his initial surgery, and his postoperative period was uneventful and was discharged on 5th postoperative day. He was on regular follow-up, and his liver function test came to normal (TB: 10 umol/L; DB: 2 umol/L; SGOT: 37 U/L; SGPT: 37 U/L; and SAP: 173 U/L). But after 9 months postoperatively, bilirubin level began to increase gradually. His investigations revealed TB 198 umol/L, DB 164 umol/L, SGOT 46 U/L, SGPT 33 U/L, and SAP 1176 U/L, and ultrasonography reported dilated intrahepatic bile ducts (IHBDs). He then underwent PTBD insertion for suspected HJ stricture (2013 March 03). However, his bilirubin level did not fall as expected, so he underwent re-positioning of the PTBD tube. Two weeks after this procedure, he presented with complaints of easy fatigability and passage of black tarry stool. His investigation revealed hemoglobin 7.4 gm/dl, platelet count 223000/uL PT/INR: 15 sec/1.07, TB 345 umol/L, DB 234 umol/L, SGOT 37 U/L, SGPT 22 U/L, and SAP 519 U/L. CT angiogram was performed to localize the source of bleeding, finding of which showed pseudoaneurysm of segment III hepatic artery of left lobe of liver (Figure 2). With the diagnosis of hemobilia due to segment III hepatic artery (HA) pseudoaneurysm which likely occurred during PTBD manipulation, selective transarterial coil embolization was done, after which he improved symptomatically and his Hb normalized. He was continued on PTBD through which HJ stricture was dilated gradually with balloon catheters of size ranging from 6Fr to 12Fr. Following adequate dilation, his PTBD tube was removed. Since then, he has been under regular follow-up.

PMC3972028_01

Female

A 58-year-old woman presented to the Coburg Clinic in February 2013 with dyspnea, loss of energy, slight edema of the lower extremities, and a 4 kg weight loss in the 4 weeks before presentation. A 3/6 systolic murmur with a left apical maximum point was noted on physical examination. Except for an appendectomy more than 30 years earlier, the patient had never been hospitalized or on any medication. She had never smoked. Family history was unremarkable, except for a sister who had experienced uncomplicated tuberculosis. She had worked as a seamstress until giving birth to a healthy daughter in 1973. From 1976 to 1980 and then again from 1985 to1997 she reported having worked in the ceramics industry, but her job was not associated with significant exposure to ceramic dust. During that time, living in the former German Democratic Republic, she had had annual chest X-rays without any abnormalities. During a second examination, she reported having felt dyspnea on exercise since 2003, but did not complain of loss of energy, and had been able to perform regular work. The electrocardiogram performed on admission showed sinus tachycardia at a rate of 109 beats per minute, incomplete right bundle branch block, and preterminal inverted T-waves in II, III, aVF, and V1-V6. Body plethysmography showed slight restriction with forced expiratory volume in one second being 68% predicted, inspiratory vital capacity 70% predicted, and a Tiffeneau index of 101%. Her diffusion capacity was reduced at 60%. Her respiratory insufficiency was managed with oxygen substitution therapy (pO2 60 mmHg and pCO2 33 mmHg under oxygen 3 L per minute). An initial transthoracic echocardiogram on February 1, 2013 demonstrated dilatation of the right ventricle to 38 mm and dilatation of the left atrium to 43 mm. Sclerosis of the aortic valve, minimal aortic insufficiency, first-degree mitral insufficiency, obvious tricuspid valve insufficiency with a diastolic gradient of 67 mmHg, and diastolic dysfunction of the left ventricle with a slightly pathological E/A ratio could also be visualized. Left ventricular ejection fraction was normal at 65%. The woman presented for the first time to the pulmonary consultant late on a Friday afternoon with dyspnea and spontaneous oxygen saturation of 83% on the bronchoscopy table (pO2 38 mmHg, pCO2 31 mmHg). She complained of rapid deterioration in the previous 2 days in comparison with her status on admission. Her weight was 58 kg, but she complained a 19 kg weight loss in the previous 2 months. Her height was 158 cm (body mass index 23.1 kg/m2). At that time, only a standard chest X-ray taken on admission was available, and showed a prominent bihilar region with a suspicious mass in the left apex of the lung (Figure 1). Standard serum analysis showed slightly elevated lactate dehydrogenase and uric acid levels, with a mild anemia. On fluoroscopy, the right hilum appeared to be enlarged compared with the X-ray taken on admission. No result suspicious for a central tumor or other infiltrative disease was seen on bronchoscopy. Endobronchial ultrasound revealed enlarged pulmonary arteries containing multiple thrombi, a few enlarged lymph nodes, and abnormal mediastinal tissue anatomy suspicious for mediastinal infiltration of a malignant process. We did not perform transbronchial needle aspiration before the weekend due to her dyspnea. She was put on low-dose low molecular weight heparin. The decision was taken to start her on radiotherapy over the weekend due to the suspicion of rapid progression of small cell lung cancer or lymphoma in the mediastinum. Computed tomography planning was done in the radiotherapy department on the following day and she received radiation with 4 Gy to the mediastinum including both hila over the weekend (2 Gy per day). After the weekend, we observed a mediastinal mass, abnormally enlarged central pulmonary arteries with tortuous peripheral branches, and a consolidation in the left upper lobe on the patient's computed tomography scan (Figures 2 and 3). At that point we stopped radiation therapy because it was clear that we were not dealing with a typical case of suspected small cell lung cancer or lymphoma. Repeat bronchoscopy and endobronchial ultrasound demonstrated partial compression of the central vessels by a mass located in the left mediastinum, and partial infiltration of the walls by this mass was suspected. Given that the lymph nodes in position 10 R (right) and 7 had a diameter of 15-20 mm, we took several biopsies from these sites in addition to biopsies of the mediastinal mass. Histologically, there was no suggestion of malignancy, but a strong suspicion for fibrosis was raised on evaluation of the magnetic resonance imaging (MRI) scans (Figure 4) but could not be proven. Two weeks later, an endoesophageal ultrasound was performed with a thicker needle in lymph node position 7. Again there was only a hint of fibrosis. A transthoracic lung puncture of the mass in the left upper lobe revealed thickened pulmonary arterial walls, activated pneumocytes, and fibrosis (Figures 5-7). Several endoscopic ultrasound consultants and endobronchial ultrasound examinations reported massive "smoke" (indicating prethrombotic formations) in the central pulmonary arterial vessels. Tuberculosis was ruled out by a negative interferon gamma release assay, several negative bronchial specimens examined by microscopy, polymerase chain reaction, and cultures for tuberculosis collected by bronchoscopy. Nontuberculous mycobacteria was ruled out by negative polymerase chain reaction, microscopy, and culture results, as was sarcoidosis, given the patient's normal serum soluble interleukin-2 receptor and angiotensin-converting enzyme levels. We could not find any histological suggestion of histoplasmosis, but this diagnosis was not ruled out by serum analysis as the patient appeared to be immunocompetent with normal immunoelectrophoresis and a negative human immunodeficiency virus test result. Cardiac MRI showed reduced right ventricular function, dilatation of the right ventricle and a hypertrophic wall, a flattened septum with paradoxical movement (Figure 4), and dilated pulmonary artery trunks. There was no suggestion of intravascular thrombus on pulmonary angiography during cardiac MRI. A sudden change in diameter of the pulmonary arteries could be seen in the peripheral regions. Small tortuous peripheral pulmonary arteries were seen on cardiac MRI and computed tomography (Figure 3). The aforementioned abnormal mediastinal mass and left upper lobe mass were also observed. Lung embolism was excluded using ventilation and perfusion scintigraphy. Combined ventilation and perfusion defects in the left upper and middle lobes were associated with the mediastinal mass. Precapillary PAH with a PAR of 1,360 dyn s cm-5 and completely normal wedge pressure was seen on right heart Swan-Ganz catheterization, coronary angiography, and dextrography (Figure 8). There were no definite criteria for reactive PAH on inhalation of iloprost. The right ventricle was hypokinetic especially in its anterior portion (Figure 8C and D) with an enlarged wall which, on echocardiography, was 8 mm thick (ie, thickness of right ventricular anterior wall in end diastole). The median right atrial pressure was 8 mmHg and borderline for right heart decompensation. The pulmonary arteries were shown to be dilated on angiography, but there was no indication of peripheral obstruction or chronic thromboembolic pulmonary hypertension. The left marginal artery and diagonal branch showed an angiographic stenosis of 70% (Figure 8A and B), and left ventricular ejection fraction was 70%. There was endothelial dysfunction with low flow phenomenon in different coronary arteries, besides the partly abnormal coronary anatomy with dilated cardiomyopathy (Figure 8A and B). There was no suggestion of vasculitis, coagulopathy, a thyroid or hepatic disorder, or collagenosis on serum analysis. No other predominant cardiopulmonary disease directly involved in the initially highly elevated PAH hemodynamics was found after working through the algorithm for PAH recommended by the European Society of Cardiology. A dobutamine MRI stress test was performed a week later without any suspicion for ischemia, so stenting of the abovementioned stenosis observed on angiography was not performed. Because thrombus was expected in the pulmonary arterial walls, transesophageal echocardiography was performed and supported the presumption of thrombus in the pulmonary arterial walls, including prethrombotic "smoke" in the central vessels. No shunt was observed. Phenprocoumon was started as oral anticoagulation therapy. Thoracic surgeons at the nearby Kutzenberg Hospital refused to do mediastinoscopy because of the diagnosis of PAH. Positron emission tomography at the University of Erlangen showed no suspicion of tumor or lymphoma in the mediastinum or elsewhere, and mediastinal fibrosis was again diagnosed. Lymphoma was ruled out in an oncologic ambulatory setting via peripheral lymph node biopsies from the groin, serum electrophoresis, urinalysis, and bone marrow puncture. Serum beta2-microglobulin was negative. At the end of April, the patient was presented for the first time at the National Pulmonary Hypertension Center of Excellence in Bad Nauheim/Giessen and a second time in May 2013 (Figure 9) with a differential diagnosis of idiopathic PAH. This was done because the referring cardiopulmonary consultant at Coburg Clinic, who is also an expert in the treatment of PAH and a member of the national guideline group, was surprised by this patient's abnormal anatomy and the massive extent of central smoke without any peripheral suggestion of embolism. Repeat pulmonary angiography showed no thrombus (Figure 9), and chronic thromboembolic pulmonary hypertension was excluded on ventilation/perfusion (V/Q) scintigraphy. Right heart catheterization revealed precapillary pulmonary hypertension with a PAR of 600 dyn s cm-5 and no reactive properties, which was quite striking given that our patient had not received any specific treatment in the preceding weeks. Cardiac MRI revealed the same pathologies in the pulmonary arterial walls as before, and functional and anatomic abnormalities of the right ventricle and mediastinal fibrosis were again reported. The diagnosis of idiopathic PAH was confirmed at several conferences with the team led by Ghofrani and Mayer (Professor Hossein A Ghofrani, Pulmonary Department, University Hospital Giessen, Giessen, Germany; and Professor Eckhard Mayer, Thoracic Surgery Department, Bad Nauheim, Germany). During discussion between the experts at both institutions, the question was raised as to whether a spontaneous dissection of the pulmonary arterial walls with secondary thrombus formation in the walls was possible, and a diagnosis of mediastinal fibrosis was accepted. Four months after her first admission, the patient was electively rehospitalized to initiate specific treatment in June 2013. In view of her coronary artery disease without evidence of ischemia, the decision was made to start treatment with bosentan instead of sildenafil. On this admission, an echocardiogram showed no signs of pulmonary hypertension, and no enlargement of the right ventricle or paradoxical septal shift was detectable by an experienced examiner. The patient had not had any complaints for at least 2 months, and was started on bosentan without any problems. The patient was evaluated 2 months later by Swan-Ganz catheterization of the right heart on full-dose bosentan 125 mg twice daily for 4 weeks. Again, precapillary pulmonary hypertension was reported and her PAR had dropped to 450 dyn s cm-5. Meanwhile, her spontaneous pO2 at rest had increased to 76 mmHg and her 6-minute walking distance was 360 m (Figure 10). As a proof-of-concept of our hypotheses, we interrupted her full-dose bosentan therapy for 2 weeks and again obtained invasive hemodynamic measurements via Swan-Ganz catheterization of the right heart. The results seemed to be only slightly different and obvious precapillary pulmonary hypertension was again demonstrated but, interestingly, her PAR was 400 dyn s cm-5, and therefore not elevated compared with the last measurement taken when the patient was on bosentan 125 mg twice daily. Seven and a half months after the initial diagnosis of idiopathic PAH with a PAR of 1,360 dyn s cm-5, we observed a reduction in PAR of at least two thirds without having established any specific treatment, except for low-dose radiation to the main stems of the pulmonary arteries (Figure 10).

denervation, pulmonary hypertension, radiation

PMC5833191_01

Female

A 46-year-old woman presented with a 2-year history of recurrent fevers up to 38.9 C, fatigue, and frequent urination. Her symptoms were intermittent with episodes of muscle weakness, joint stiffness, and extreme headache lasting approximately 30 hours. She had no chest pain, no abdominal pain, no change in bowel habits, and no recent weight changes. Her past medical history was significant for thalassemia, dermatographism, and three early miscarriages. Her past surgical history was notable for gastric sleeve and hysterectomy complicated by pelvic abscess that required an interventional radiology drain 4 months prior to the presentation. Family history was significant for autoimmune diseases such as gout, rheumatoid arthritis, and systemic lupus erythematosus. Her temperature was 36.6 C without any abdominal tenderness. Laboratory findings revealed a microcytic anemia with occasional schistocytes. Comprehensive metabolic panel, C-Reactive Protein (CRP), the erythrocyte sedimentation rate (ESR), HIV assay, Quantiferon tuberculosis, blood cultures, lactate dehydrogenase, anti-nuclear antibody, and serum protein electrophoresis were all within normal limits. Additional studies such as lupus anticoagulant, hepatitis virus profile, complement levels, Epstein-Barr virus acute infection, cardiolipin, rapid plasma reagin, DNA double strand, smooth muscle, Sjogren's extractable nuclear profile, beta-2-glycoprotein 1 antibodies, Smith, and ribonucleoprotein extractable nuclear were also normal. Spiral CT of the abdomen and pelvis, using a reconstructed slice thickness of 5 mm after oral and IV contrast administration, showed a misty appearance of the mesentery in the left hemiabdomen with multiple enlarged mesenteric lymph nodes measuring up to 1 cm in the short axis (Figure 1). The radiological findings likely represent chronic mesenteric panniculitis with early suggestion of it seen in previous CT abdomen 2 years a priori. The rest of the exam was significant for nonobstructing 2 mm calcification noted within the inferior pole of the left kidney. Mesenteric biopsy revealed fibroadipose tissue with focal fat necrosis with lymphohistiocytic inflammation and fibrosis. There was no evidence of malignancy. Flow cytometry did not reveal abnormal B or T cell populations, excluding a lymphoproliferative process. The patient was offered treatment with prednisone, but the patient was hesitant to start steroids, so methotrexate 15 mg by mouth once a week was started but had minimal response. Further treatment options are being explored.

PMC3032255_01

Male

An eight-year old boy, first born to third degree consanguineous parents, presented with right leg swelling for three months, with gradual onset, which progressed up to knee. There was no history of fever, injury, abdominal pain or contact with tuberculosis. He was treated with anti-filarial drugs elsewhere. At two years of age, he had frequent episodes of redness and constant rubbing of eyes and was then diagnosed to have double-rowed eye lashes involving all four eyelids and the extra rows of lashes were cauterized and removed elsewhere. The boy still continued to be symptomatic. None of the other family members had similar complaints. On examination, he had right lower limb edema, which was from the knee downward. [Fig. 1] There were no bony deformities or vertebral anomalies. Systemic examination was normal. He had mild congestion of both eyes. His visual acuity was 20/20; N6 in both eyes, and had no refractory error. Slit-lamp examination revealed distichiasis. [Fig. 2] A focal area of loss of eyelashes and depigmentation of skin was noted in the left upper eyelid. Fundus examination revealed an optic disc pit in the left eye and the macula was normal [Fig. 3]. Blood parameters were normal. Night smears for microfilaria were negative. Ultrasonography (USG) abdomen, echocardiogram, magnetic resonance imaging (MRI) spine, and vascular Doppler studies of both limbs were normal. Isotope lymphoscintigraphy confirmed the lymphedema. The parents were also screened and found to be normal. A clinical diagnosis of distichiasis-lymphedema syndrome (DLS) was made. Conservative management for symptomatic distichiasis, with lubrication and epilation was carried out, advice for Amsler test at home periodically and stockings for lymphedema were given. The parents were genetically counseled for prevention of secondary complications such as, cellulitis, foot infections, and varicose veins. Lymphedema in DLS typically appears in late childhood/ puberty. It is confined to the lower limbs, usually bilateral and often asymmetric, becoming evident between 5 and 20 years of age. Distichiasis presents from an early age, probably at birth, where accessory eyelashes occur along the posterior border of the lid margins in the position of the Meibomian gland orifices. It is associated with irritative ocular problems namely corneal irritation, recurrent conjunctivitis, and photophobia. The extra eyelashes can usually be seen on torch light examination, but in some cases slit lamp examination is required. DLS has an autosomal dominant inheritance pattern with marked variability of expression. Mutations in the Forkhead family gene FOXC2 located on chromosome 16q24.3 have been identified to be associated with this syndrome. Epidural cysts, cardiac abnormalities, short stature, ptosis, microphthalmia, strabismus, partial ectropion of the lower lid, pterygium coli, chylothorax, cleft palate, bifid uvula, micrognathia, scoliosis/ kyphosis, and cryptorchidism are the other occasional abnormalities reported with DLS. The optic disc pit is a congenital anomaly characterized by excavation of the optic nerve head and is usually unilateral. It is commonly found in the temporal part of the optic nerve head and the disc on the affected eye is larger than the fellow disc. Patients with optic disc pit may develop complications like serous macular detachment, macular holes, cystic changes in the macula, vision loss, and deterioration of the visual field, hence, requiring regular screening. Occurrence of optic disc pit in a patient with DLS has not been reported. These could be two different congenital anomalies of the eyes found incidentally in the same patient or there might be a possible unexplained association.

PMC4512590_01

Male

A 54-year-old male was referred to the Rheumatology Division of Fornaroli Hospital from the Infective Department. In February 2014, he was admitted to hospital because of interstitial lung disease of uncertain origin accompanied by fever with shiver, dry cough, and chest pain. Chest X-ray showed a right subclavicle interstitial consolidation. A lung/abdominal CT (Computerized Tomography) with contrast enhancement showed an interstitial consolidation with centrilobular branching linear structures with bronchial dilatation and multifocal areas of ground-glass attenuation at the right superior and medium lobe of lung in the posterior segment. There were pleura's thickening at the lingula and fibrotic lines with consolidation at the left superior lobe of lung in the anterior segment, also. Moreover, there were some mediastinic bilateral lymphadenopathies (Figure 1). Laboratory tests showed ESR 28 mm/h (cut-off value <=10 mm/h) and C-reactive protein 6.66 mg/dL (range of normality: 0-5). Antinuclear antibodies (ANA), cryoglobulin, extractable nuclear antibodies (ENAs), anti-DNA native antibodies, antiphospholipid antibodies, and antineutrophil cytoplasmic antibody (ANCA) were negative. Complementemia (C3, C4) was at range of normality. Rheumatoid factor (RF) was 24 UI/mL (range of normality <12) and anti-cyclic citrullinated peptide (anti-CCP) antibodies were 17 UA/mL (range of normality <5). Serum angiotensin-converting enzyme (ACE) levels were normal. Quantiferon-TB Gold was negative. Microbial agents were excluded (serology for Legionella, Streptococcus pneumoniae, Mycoplasma pneumoniae, and Chlamydia was negative). A restrictive defect on functional lung exams was excluded and diffusion capacity of the lung for carbon monoxide (DLCO) was normal. Smoking history was absent. A lung bronchoscopy with a bronchoalveolar lavage (BAL) was made. Bacterial BAL fluid cultures were negative. Culture and genome for Koch's bacillus were negative. BAL cytology excluded monoclonality disorders and showed increased numbers of neutrophils and eosinophils. Lung CT showed multifocal areas of ground-glass and we hypothesized a rheumatologic versus infective interstitial lung disease. So, lung biopsy was not performed in this patient because we think that it was excessive forasmuch as BAL was performed (including cultures and cytology) which supported inflammatory diagnosis. A positron emission tomography-computed tomography (18F-FDG PET/CT) showed an elevated glucometabolic activity at bilaterally axillary lymphadenopathies and at level of pulmonary consolidation seen at HR-CT; these abnormalities were hypothesized to inflammatory nature and possible rheumatic disease (such as vasculitis). Heart ultrasound, nailfold videocapillaroscopy, and superior abdomen ultrasound did not show abnormalities. After some weeks, painful swelling of right knee appeared. Doppler ultrasound (US) of low limbs excluded deep venous thrombosis. He received a large spectrum antibiotic therapy (before, at home he had assumed oral levofloxacin therapy and later oral amoxicillin clavulanate; during the recovery he received oral doxicilin and azithromycin at standard dosage) with reduction of fever but persistence of lung abnormities to radiologic exams. So, It was started a steroid therapy ex adiuvantibus with a clinical subjective improvement. In the suspect of rheumatologic disease patient was assigned to our division. During rheumatologic recovery painful swelling of right wrist, knee, and ankle appeared. We made an ultrasound (US) echographic of the lung (Figure 2). Commercially available echographic equipment with a 7.5 MHz linear probe was used (Mylab25, Esaote, Genoa, Italy). US of right lung, at the fifth posterior intercostal space, showed the presence of Ultrasound Lung Comets (ULCs) (as echographic sign of interstitial lung involvement). On the basis of clinical features and laboratory/functional/radiologic tests we made a diagnosis of NSIP in RA seropositive for RF. We started immunosuppressive therapy with intravenous cyclophosphamide 1 gr every 28 days for a cumulative dose of 6 gr (from 3 April to 10 September 2014) associated with steroid tapering therapy. We observed any adverse events during treatment with cyclophosphamide. At the end of intravenous infusion of cyclophosphamide, a lung high-resolution CT was performed. It showed a significant improvement of interstitial lung disease with disappearance of multifocal areas of ground-glass attenuation and consolidations (Figure 3). Also ultrasound evaluation at the end of therapy showed complete resolution of ULCs (Figure 4). So we decided to stop other infusions of cyclophosphamide and to start treatment with methotrexate 10 mg/weekly for arthralgia of right wrist as well as maintenance therapy associated with low dose of steroids (prednisone 5 mg/day tapering).

PMC5266196_01

Male

A 15-year-old male patient was admitted to a hospital due to a 4-week history of fever and intermittent, diffuse abdominal pain. The patient had first presented with diffuse, intermittent abdominal pain and diarrhea after eating barbecue many times over the course of 2 weeks. Two days after the first presentation of these symptoms, he had a high fever, with a maximum temperature of 39 C. His symptoms did not remit after 4 weeks. So he went to a local hospital and was treated with an unidentified antibiotic. His diarrhea was relieved, but the fever and abdominal pain did not improve. Approximately 10 days later, he was transferred to our hospital for further investigation and management of suspected inflammatory bowel disease (IBD). He was living in a village in Heilongjiang Province, a northern province in China where the incidence of human brucellosis has increased substantially. In addition, the patient had a history of eating barbecue. He denied having a history of exposure to contaminated water or going to epidemic areas. His mother had suffered from pulmonary tuberculosis about 10 years ago. He had lost approximately 5 kg of weight over the previous month and he was only 41 kg in weight and 174.5 cm in height (body mass index [BMI] 13.5) when admitted to our hospital. On physical examination, his temperature was 37.2 C, intestinal peristalsis had decreased to 2 to 3 times per minute, and suspicious tenderness was detected in the right and left upper quadrants of the abdomen. Other vital signs and elements of the examination were normal. The laboratory investigations revealed anemia, a high erythrocyte sedimentation rate, and an elevated C-reactive protein level; the laboratory test results are shown in Table 1. A stool specimen was positive for occult blood. A tuberculin skin test was negative, as was an interferon gamma release assay (T-spot. tuberculosis) for Mycobacterium tuberculosis. A Widal-Felix test was negative. Negative test results were found for antibodies to IBD, antinuclear antibody, and extractable nuclear antigens. A transabdominal US examination was performed to investigate the cause of the abdominal pain. The US showed a thickened hypoechoic bowel wall in the terminal ileum (0.55 cm), with thickening mainly in the mucosal and submucosal layers. The 5-layer structure of the bowel wall remained identifiable (Fig. 1). Additionally, color Doppler US showed increased flow signals in the bowel walls and luminal narrowing. The ileocaecal structure was intact. Notably, multiple hypoechoic lymph nodes (maximum diameter: 1.8 cm) with a thickened cortex were detected in the abdominal cavity, especially in the right lower quadrant; some of these lymph nodes were fused together. Furthermore, a spectral analysis of the Doppler signals of arteries supplying the gastrointestinal tract (i.e., celiac trunk and superior mesenteric arteries) was performed. The results showed a dramatically increased flow velocity (peak systolic velocity: 643 cm/s) in the origin of the superior mesenteric artery (SMA) and celiac artery (CA) (Fig. 2), which suggested significant stenosis. A computed tomography (CT) scan of the intestine confirmed the above findings; the scan showed a thickened bowel wall in the ileocaecal area and terminal ileum, with an abnormal enhancement of the mucosal surface (Fig. 1) and remarkably enlarged lymph nodes near the iliac vessels in the right lower quadrant of the abdomen. An aortic computed tomographic angiography showed moderate narrowing in the beginning of the SMA and slight narrowing in the beginning of the CA (Fig. 2). Incidentally, the CT scan revealed an enlarged spleen with multiple wedged areas of low attenuation under the membrane (Fig. 3), and a similar lesion was also found in the inferior pole of the left kidney; these were suspected to be areas of infarction. The patient underwent an endoscopic examination. The examination revealed many irregular ulcers in the narrowed lumen of the terminal ileum. Additional pathological features of the terminal ileum included inflammatory exudate, granulation tissue, and mucosal lymphoid hyperplasia, which collectively suggested severe acute and chronic inflammation of the intestinal mucosa. Due to the patient's signs and symptoms, he was considered to be suffering from an intestinal infection rather than from IBD. Subsequently, additional history was obtained. He had eaten undercooked roast lamb and beef many times during the 2 weeks before he began to feel uncomfortable. No pathogenic microorganism was found in endoscope biopsy tissues of the patient. Cytomegalovirus DNA and IgM antibody were negative on multiple blood tests. In addition, cytomegalic inclusion body was not present in the tissue sample from endoscopic biopsy. Brucellosis was suspected because the patient came from Heilongjiang Province, which is a northern province in China where the incidence of human brucellosis has risen substantially. A blood sample was sent for serological testing, and the Brucella standard tube agglutination (STA) test was twice positive at a dilution of 1:160. In addition, the Rose-Bengal plate test was positive for brucellosis. Two Brucella spp. blood cultures were collected and all results were negative. According to his symptoms (i.e., fever, abdominal pain), imaging results (i.e., splenomegaly, splenic and renal infarction), history of eating undercooked roast lamb and beef, and STA continuously twice positive at a dilution of 1:160 and Rose-Bengal test results, Brucellosis was highly suggestive. Unfortunately, multiple Brucella spp. blood culture were undertaken and turned out to be negative. Neither Brucella Coombs test nor PCR analysis was further undertook. For the suspicion of that the abdominal artery stenosis was caused by embolism from endocarditis, a transthoracic echocardiogram was performed. There was no sign of endocarditis. No cardiac murmur or sign of embolism was found in physical examination. The patient received minocycline (doxycycline was unavailable) plus rifampicin to treat brucellosis and there was a significantly improvement after 4 weeks treatment. Further transesophageal echocardiogram has not been arranged. Finally, the patient was diagnosed as brucellosis. The narrowing of the SMA and CA was suspected to be vasculitis secondary to the brucellosis. Doxycycline is considered as the first-line therapy for Brucellosis; however, it is currently unavailable in Beijing. Minocycline combined with rifampicin were used instead. The patient was given oral minocycline and rifampicin for 12 weeks totally. After 3 weeks of treatment, he had no fever or abdominal pain. After another 7 weeks, follow-up CT and US examinations showed remarkable improvements in the bowel. Positron emission tomography (PET) was used for further investigation of the intestine inflammation. The results showed mildly increased metabolic activity in the terminal ileum and adherent lymph nodes (Fig. 1), which was indicative of an inflammatory disease instead of a malignancy. The areas of splenic infarction were smaller than they were previously, and renal perfusion appeared normal (Fig. 3). The CT results showed that the narrowed lumens of the SMA and CA had not improved. However, the Riolan artery, a collateral circulation between the SMA and inferior mesenteric artery (IMA), had opened (Fig. 2). Two months later, the splenic and renal lesions were barely perceptible. Due to the suspected secondary vasculitis, he was treated with minocycline and rifampicin for another 8 weeks, but there was little improvement in the noted arterial stenosis (Fig. 2). Additional laboratory test results are shown in Table 1.

PMC8022819_01

Male

A 46-year-old male presented to the emergency room with subjective fevers, severe global headache, right-sided upper and lower extremity weakness, blurred vision, difficulty swallowing and unsteady gait. Fever and headache began 1-week prior. He initially went to an urgent care clinic, was diagnosed with sinusitis and given a prescription for oral azithromycin. A worsening headache and neurological symptoms prompted a visit to the emergency room where he developed respiratory failure and was emergently intubated. His past medical history was significant for dermatomyositis for which he received weekly methotrexate. His most recent dose of methotrexate was 3 weeks prior to presentation. He was employed as a coach for a local high school football team and had no history of recent travel. Pertinent findings on physical exam included a temperature of 100.8 F, heart rate of 115, pinpoint pupils, deviation of left eye upwards and laterally, deviation of right eye downwards, left facial palsy and right hemiparesis. Speech and gait was not tested. Laboratory findings included leukocytosis of 15,000 with 88 % neutrophil predominance, mild elevation of alanine aminotransferase (ALT) at 82 U/L and aspartate aminotransferase (AST) at 87 U/L. HIV test was negative. Blood cultures remained negative for bacterial growth. Magnetic resonance imaging (MRI) of the brain showed a ring enhancing lesions in the lateral medulla (Fig. 1). Lumbar puncture revealed an opening pressure of 20 cm of water. CSF analysis showed glucose of 44 mg/dL, protein of 115 mg/dL, 67/mm3 white blood cells (48 % polymorphonuclear cells) and 13/mm3 red blood cells. The patient was empirically treated for meningitis with intravenous (IV) vancomycin, (IV) ceftriaxone, (IV) ampicillin and (IV) acyclovir. CSF cultures grew Listeria monocytogenes. Antibiotic therapy was modified to (IV) ampicillin and (IV) gentamicin. Despite appropriate antibiotic therapy, the patient's condition continued to worsen. Repeat MRI of the brain on fourth day of admission showed progression to multiple ring enhancing lesions in the brain stem (Fig. 2). The patient became unresponsive on eighth day of admission. Computed tomography (CT) of the head showed extensive brainstem hemorrhage with resultant hydrocephalus (Fig. 3). He underwent ventriculostomy without significant improvement. He was transitioned to comfort care measures and died on the tenth day, following terminal extubation. While extremes of age, pregnancy, immunosuppression and malignancies are thought to major risk factors for developing CNS listeriosis, rhombencephalitis is known to primarily affect healthy adults. The term rhombencephalitis refers to the initial rhombencephalon or hindbrain. Rhombencephalitis or brainstem encephalitis is an unusual form of CNS listeriosis first described in 1957. It has a characteristic biphasic course consisting of a prodrome of headache, nausea, vomiting and fever lasting for a several days followed by progressive asymmetrical cranial-nerve palsies. MRI is crucial for early diagnosis and mortality remains high at 51 %. Hemorrhage and hydrocephalus are also rare complications of CNS listeriosis. Treatment of choice for CNS listeriosis is ampicillin or penicillin G with the addition of an aminoglycoside such as gentamicin. For patients with penicillin allergies, meropenem or trimethoprim-sulfamethoxazole may be used. This patient developed all three rare manifestations of neurolisteriosis namely rhombencephalitis, hydrocephalus and brainstem hemorrhage and did not survive despite initiation of antimicrobial therapy within hours of hospitalization. While this patient was on weekly methotrexate, the perceived risk of serious infections related to methotrexate therapy is seen to be lower than previously thought to be.

brain stem abscess, listeria monocytogenes, rhombencephalitis

PMC5308532_01

Male

Patient is a 30-year-old single, heterosexual male who presented to the Family Medicine clinic with a 5-day history of sore throat and a painful right-sided neck mass; he denied cough, sneezing, rhinorrhea, fever and exposure to tuberculosis. Further investigation revealed participation in unprotected oral sex with his partner for 1 year, who had recently been diagnosed with vaginal trichomoniasis and was prescribed metronidazole. Patient presented with an enlarged right anterior cervical lymph node, measuring 4.5 cm x 3 cm, and was non-tender at the time of the examination; patient states that he had been taking acetaminophen for the pain. Examination of the oral mucosa revealed good oral hygiene, with pharyngeal and right tonsillar exudates. Rapid streptococcal test and throat culture were negative for group A Streptococcus. Pharyngeal and tonsillar exudates using a Gen-probe Aptima Unisex Swab Kit (blue swab) tested positive for T. vaginalis by nucleic acid amplification test (NAAT). Screening was negative for HIV, syphilis, chlamydia, gonorrhea and tuberculosis. Our patient's symptoms resolved with oral metronidazole 2 g. We are reporting this case because there is no known case of oral infection from T. vaginalis reported in the literature.

trichomoniasis, male, oral sex, sore throat

PMC6437814_01

Female

A 11/2-year-old female child reported for swelling in thoracolumbar region and inability to walk and stand without support. She was a firstborn child of nonconsanguineous parents of low socioeconomic status. The clinical examination of the child revealed coarse facies, broad mouth, and short neck with no organomegaly. Initial blood work-up on Sysmex XN 1000 showed a flag of WBC abnormal scattergram and lymphocytosis. The scatter plot on White cell nucleated channel (WNR scattergram) showed an abnormal scatter when compared with normal patients [Figure 1]. Her complete blood count showed a hemoglobin of 111 g/l, red blood cell count of 4.37 x 1012/L, mean corpuscular volume of 83.1 fl, mean corpuscular hemoglobin (MCH) of 25.4 pg, MCH concentration of 30.6 g/dl, red cell distribution width 14.8%, total WBC count of 14.08 x 109/L with lymphocyte predominance (Absolute lymphocyte count: 10.38 x 109/L), platelet count of 242 x 109/L. On peripheral examination, almost all the neutrophils showed dense blue/purple black granules in the cytoplasm partially obscuring the nucleus; these were resembling toxic granulations [Figure 2c and d]. On intricate observation, similar granules although lesser in number were seen in many of the lymphocytes and also were appreciated in an occasional monocyte. The presence of these granules in the leukocytes was raising a suspicion of AR anomaly and underlying MPS. Her ophthalmic examination revealed corneal haziness and mild increase in corneal size. On radiological evaluation, spatula-shaped ribs, tapering of proximal metacarpal, thickening of skull bones with J-shaped sella turcica were also observed [Figure 2a and b]. MPS excretion spot test was positive on the urine sample (Toluidine blue spot test). The indexed patient was suffering from MPS Type IV (Morquio's syndrome). The case describes that abnormal WBC scatter plot on WNR channel and AR granules are the hematological findings that can be seen in a case of MPS.

alder-reilly anomaly, morquio syndrome, automated blood counters, mucopolysaccharidosis

PMC5428180_01

Male

A 30-year old Nepalese man presented to emergency department with 2 weeks' history of fever, abdominal pain, and fatigue. Physical examination revealed fever, pallor, jaundice, and hepatosplenomegaly. Peripheral blood analysis revealed moderate normochromic normocytic anemia (hemoglobin, 9 g/dL; normal, 13-17 g/dL), severe thrombocytopenia (platelets, 25 x 109/L; normal, 150-400 x 109/L), and marked leukocytosis of 164 x 109/L (normal, 4-10 x 109/L). Peripheral blood smear showed many blast cells with left shift and increased monocytic cells with a differential count of neutrophils 7%, lymphocytes 3%, eosinophils 1%, monocytes 16%, promyelocytes 8%, promonocytes 23%, and blasts 42%. The blasts were medium to large in size with fine chromatin and prominent nucleoli, some with irregular/convoluted nuclear contour (Figure 1A). Initial bone marrow (BM) aspirate stained with Wright stain was hypercellular with 39% blasts, 13% promonocytes (blasts equivalent), and increased monocytes (17%). No Auer rods were noted. Maturing myeloid cells comprised (28%) severe dysplastic features and included 2% eosinophils (Figure 1B). Bone marrow biopsy showed markedly hypercellular BM with diffuse infiltration by blasts (Figure 1C), positive for CD34, lysozyme, myeloperoxidase, and CD68, with partial positivity for CD117. There were prominent eosinophilic cells, scattered and in small groups with marked suppression of normal trilineage hemopoiesis. Multicolor flow cytometry (FCM) analysis was performed on BM aspirate using CD45-gating strategy to identify the immunophenotype of the blasts. Acute leukemia panel of 28 antibodies in a 4-color combination (FITC/PE/ECD/PC5 fluorescent conjugates) was used, as follows: (1) CD34/CD117/CD45/CD19, (2) CD14/CD13/CD45/CD64, (3) HLA-DR/CD7/CD45/CD5, (4) CD34/CD33/CD45/CD56, (5) CD19/CD10/CD45/CD3, (6) CD15/CD33/CD45/CD2, (7) CD9/CD19/CD45/CD4, (8) CD20/CD10/CD19/CD45, (9) cMPO/cCD79a/cCD3/sCD45, (10)TdT/sCD19/sCD3/sCD45, (11) CD36/CD11c/CD45/CD11b, and (12) CD41/glycophorin A/CD45/CD61(PC7). Flow cytometry analysis revealed approximately 56% myeloid blasts with moderate CD45 and expressing CD34, cMPO, CD33, CD13, and CD9, and the majority was positive for CD117 and HLA-DR, with partial expression of CD15 (on approximately 35% of the cells) (Figure 2). The blasts were negative for CD56, CD14, CD64, CD11b, CD11c, CD36, CD61, CD41, glycophorin A, TdT, and B-cell and T-cell markers. Monocytic cells increased (23%) expressing CD64, and the majority was positive for CD14. Cells in the granulocytic gate comprised approximately 17% showing loss of CD10 expression (features of dysmaturation). The morphology and FCM findings were consistent with the diagnosis of AML with increased monocytic cells. Cytogenetic analysis by fluorescent in situ hybridization (FISH) using a probe for CBFB (BAR) gene revealed an abnormal hybridization signal pattern, indicating rearrangement in 56% of the cells. This was confirmed by conventional karyotype which showed inv(16)(p13.1q22), concluding the diagnosis of AML with inv(16)(p13.1;q22) CBFB:MYH11 (Figure 3). Patient initial laboratory workup revealed elevated total bilirubin of 82.6 micromol/L (normal, 3-20 micromol/L), mainly direct bilirubin of 55.8 micromol/L (normal, 0-8.6 micromol/L), and high liver enzymes, with alanine transaminase (ALT) of 187 IU/L (normal, 0-40 IU/L), aspartate transaminase (AST) of 87 IU/L (normal, 0-37 IU/L), and alkaline phosphatase of 378 IU/L (normal, 40-150 IU/L). Renal function tests were normal with creatinine of 94 micromol/L (normal, 70-115 micromol/L). Hepatitis serology screening showed hepatitis E virus IgG and IgM with evidence of past hepatitis B virus infection, for which lamivudine was given before starting chemotherapy. Magnetic resonance imaging of the liver and magnetic resonance cholangiopancreatography done to exclude biliary obstruction revealed hepatomegaly with no focal lesion, multiple porta hepatis, peripancreatic, mesenteric, and para-aortic lymph nodes with no evidence of biliary obstruction. All septic workup and quantiferon testing proved negative. The patient was started on cytarabine (100 mg/m2) for 7 days. Anthracycline was omitted from the first induction because of elevated direct bilirubin. The patient had persistent fever during the neutropenia phase despite treatment with broad-spectrum antimicrobial and antifungal drugs. Miliary tuberculosis (TB) was suspected, for which liver biopsy was performed and was consistent with cholestatic hepatitis with the absence of granulomas or leukemic infiltration. The patient had no clinical findings, suggesting central nervous system (CNS) involvement; however, intrathecal chemotherapy was planned upfront as the patient was considered to be at high risk due to CNS involvement. Examination of cerebrospinal fluid was delayed as the patient was critically ill; it was done just before the first consolidation and revealed few blasts confirmed by FCM analysis. The patient was treated with triple intrathecal chemotherapy twice weekly for total of 8 doses. Bone marrow examination post first chemotherapy cycle showed cellular aspirate with approximately 19% blasts, and BM biopsy showed interstitially increased primitive cells. Immunohistochemical stains showed increased CD34 positivity roughly estimated at 20% to 30% and overall increased positivity for CD68 with focal collections of CD117-positive cells interpreted as persistence of the leukemic process. After recovery of neutropenia, the patient was started on second induction 3+7 protocol. The hospital course was complicated with massive pleural effusion. Therapeutic pleural tapping was done and showed white blood count of 1000/microL with 65% lymphocytes, no blast cells, glucose of 6.2 mmol/L, protein of 50.6 g/L, lactate dehydrogenase of 104 IU/L, pH 7.5, and negative for acid-fast bacilli and TB by polymerase chain reaction (PCR). The patient was treated empirically with anti-TB drugs and steroids. Few days later, fever subsided, jaundice resolved, and the patient's condition improved. Evaluation of BM after second induction showed cellular BM with 3% blasts, indicating remission. However, the BM aspirate showed the presence of morphologically atypical MC comprising approximately 2% of the total cells, mostly with irregular nuclear contour (kidney-shaped, bilobed, or multilobed nuclei), pale cytoplasm with cytoplasmic hypogranulation or irregular metachromatic granule distribution, some with fine nuclear chromatin (promastocyte morphology), together with some cells showing eccentric nucleus or spindle shape (Figure 4A and B). Examination of the BM biopsy revealed multiple perivascular and randomly distributed focal collections of MC (in clusters of >15 cells) with some interstitially increased MC with spindle forms and some with lobed nucleus. Eosinophils were prominent around few of the MC aggregates. The MC were positive for tryptase, CD117, CD68, and CD25. CD2 immunostain appeared negative (Figure 5A to C). These findings established the diagnosis of SM with AML. When reexamining the BM at diagnosis, MC were not impressive in the aspirate; however, re-evaluation of the marrow biopsy with the aid of tryptase and CD25 immunostain revealed many scattered and multiple dense clusters of cells positive for CD117, tryptase, and CD25, indicating that mastocytosis was present from the start but masked by the extensive infiltration by blasts. Serum tryptase was elevated at 38.5 microg/L (negative <11 microg/L), and allele-specific oligonucleotide polymerase chain reaction (ASO-PCR) for KIT Asp816Val gene mutation was performed on peripheral blood and proved to be negative. First consolidation with high-dose cytarabine 3 g/m2 on days 1, 3, and 5 along with idarubicin 12 mg/m2 was given. The course was complicated with pleural effusion recurrence which required therapeutic thoracentesis. Cytology showed no blast cells. Subsequently, the patient received 2 further consolidation courses with high-dose cytarabine that was complicated with febrile neutropenia with Enterobacter cloacae bacteremia on third cycle that required intensive care admission and antimicrobial treatment with meropenem. Bone marrow evaluation after completion of therapy revealed no increase in blast cells, but there was persistence of mastocytosis. As there was a high risk of relapse, allogeneic stem cell transplant was planned. However, it was not done as the patient traveled back to his home country.

kit mutation, systemic mastocytosis, acute myeloid leukemia with inv(16)(p13q22)

PMC4939201_01

Female

A 26-year-old female of Hellenic ethnicity was admitted to our outpatient clinic, reporting a 10-day history of low grade fever, chills, nausea, headache, urge to vomiting, and a dull pain over the right kidney area. Her past medical history was free of any chronic or acute infection or systemic disease, except for a prior admission to our hospital 1 year ago due to diarrhea not associated with any specific microorganism. Her physical examination revealed temperature of 38 C, normal blood pressure (110/70 mmHg), and tachycardia (HR = 160 bpm). During palpation, a slight pain in right upper abdominal area was revealed with no other specific signs and symptoms. The respiratory examination was remarkable for dullness to percussion with decreased breath sounds over the lower right lung base. The remainder of the physical examination was unremarkable. Initial laboratory findings revealed a polymorphonuclear leucocytosis of 13.700/mm3 with 72% neutrophils and 18% lymphocytes, ESR of 29 mm/hr, and C-reactive protein of 5.31 mg/dL. No other pathological findings were indicated from the biochemical testing. Detailed investigations did not reveal any predisposing factors or evidence of an underlying immunodeficiency. More specifically, there was no evidence of malnutrition, no history of therapy with glucocorticoids or other immunosuppressive drugs, and no indication of immunoglobulin excess or deficiency through quantitative serum immunoglobulin tests, and blood tests were negative for chronic infections (HIV, viral hepatitis, etc.) or autoimmune disorders (antinuclear antibodies and other autoantibodies). Chest X-ray examination showed pneumonic infiltration in the lower one-third of the right hemithorax and laterally located dense appearance resembling left pleural effusion. Based on this evidence, the patient was diagnosed as having community-acquired pneumonia and after blood cultures were taken, antimicrobial treatment was initiated with intravenous ceftriaxone 1 gr/day + azithromycin 500 mg/day. Sputum, protected specimen brush (PSB) material of bronchial secretions, and three sets of blood specimens were also taken on admission for cultures which did not yield any pathogens. Within the following two days, the patient's fever rose to 40 C despite the administration of antimicrobial therapy, and her condition deteriorated by developing dry cough, chest pain, total absence of breath sound during auscultation in right hemithorax, and dyspnea. Additionally, a strong right lumbar pain appeared. Three additional sets of blood cultures, taken while the patient was febrile, were negative. On the third day, computed tomography (CT) scanning of the chest was performed and revealed a lung thick-walled abscess formation in the right lower lobe, with a surrounding inflammatory infiltrate, extended atelectasis, and pleural effusion to the right lower lobe. Figures 1(a) and 1(b) exhibit the size and morphology of the lung abscess. A subsequent ultrasound examination of the patient's liver, carried out in order to examine whether there was any subdiaphragmatic extension or origin of the infection, did not reveal any relevant evidence. The combination of ceftriaxone + azithromycin was consequently discontinued and replaced by moxifloxacin 400 mg/day + tazobactam plus piperacillin (0.5 + 4.0) gr x 3/day + clindamycin 600 mg x 3/day. PCR for tuberculosis was performed and anti-Echinococcus IgG and IgM antibody titers were measured; however all the results were negative. The next days, her fever did not subside, CRP levels rose gradually to 16.85 mg/dL, and the pleural effusion continued to rise. Blood cultures remained all negative for any bacterial growth. On the sixth day of admission, the patient underwent lobectomy, owing to the lack of response to antibiotic therapy, the deterioration of symptoms, and the difficulty in approaching the specific lobe area by thoracentesis. Approximately 700 mL of pleural fluid was collected and sent to laboratory for biochemical analysis, Gram stain, cultures, and antimicrobial profile. Biochemical analysis of the pleural fluid showed the following: glucose of 74 mg/dL, lactate dehydrogenase of 730 U/L, total protein of 3.9 g/dL, and white blood cell count of 15.400/mm3 with 80% polymorphs. Gram staining and cultures of the pleural fluid were negative. In addition, the aspiration of the abscess revealed yellowish pus (about 45 mL) that was also sent for laboratory analysis the same day. Cultures of the pus sample collected from the abscess yielded a Gram-negative aerobic rod identified as Salmonella enterica subsp. enterica serovar Abony. Salmonella isolate was identified to the genus level by both the automated Vitek-2 System (bioMerieux, Inc., Hazelwood, MO) and the API 20E (bioMerieux, Inc., Hazelwood, MO). Serotyping of the isolate was performed using the somatic O and flagellar H antisera according to the Kauffman-White classification scheme (Difco Laboratories, Detroit, MI, USA). Molecular confirmation of Salmonella serotyping was carried out using the DNA microarray system Premi-Test Salmonella (DSM Nutritional Products, Check-Points, Wageningen, Netherlands). Antimicrobial susceptibility testing was initially performed by the Vitek-2 System, according to the recommendations of the National Committee for Clinical Laboratory Standards and confirmed by E-test (bioMerieux, Inc., Hazelwood, MO). The isolate was susceptible to commonly used antibiotics (ampicillin MIC of 0.75 mug/mL, ceftriaxone MIC of 0.085 mug/mL, cefotaxime MIC of 0.082 mug/mL, ceftazidime MIC of 0.115 mug/mL, ciprofloxacin MIC of 0.032 mug/mL, moxifloxacin MIC of 0.016 mug/mL, and trimethoprim-sulfamethoxazole MIC of 0.064 mug/mL). Based on the laboratory report, the antimicrobial therapy was changed on the eighth day after admission, to sulfamethoxazole/trimethoprim (800 + 160) mg x 2/day, moxifloxacin 400 mg/day, and clindamycin 600 mg x 3/day, along with supportive therapy. The postoperative clinical condition of the patient improved noticeably. Six days after surgery, the patient's symptoms resolved and she was discharged on sulfamethoxazole/trimethoprim (800 + 160) mg x 2/day and ciprofloxacin 500 mg x 2/day, for 20 days.

PMC9846320_01

Female

The 79-year-old female patient was admitted to the hospital due to a black mass on the bigger toe of the right foot for more than 4 years, the radical excision of the skin lesion after completing a relevant investigation was done and diagnosed postoperatively pathologically as a freckled malignant melanoma. Amputation of the toe was performed after 10 days. she was admitted to the hospital again one month after surgery for adjuvant therapy. There have been no special symptoms such as loss of appetite, fatigue, shortness of breath, palpitations, and weight loss since this onset. The patient has had hypertension for over 40 years with no history of diabetes, coronary heart disease, or tuberculosis; the most severe hypertension is 160/90mmHg, which is well controlled by oral antihypertensive medications. Underwent resection of bone tumor in left-hand middle finger 45 years ago, cholecystectomy for gallbladder stones 39 years ago, and resection of bladder malignant tumor followed by adjuvant chemotherapy15 years ago, the exact pathological diagnosis and systemic treatment are unknown at that time. Since then, the patient has lived in a good state without clinical manifestations of tumor recurrence and metastasis. Denying a family history of malignancy. There were no yellow stain, rash, or bleeding spots on the skin and mucosa of the whole body, and superficial lymph nodes were not touched. Surgical scars were seen on the right abdomen and the fingers of the left hand. The first metatarsophalangeal of the right foot was missing with a well-healed surgical incision. Serum tumor markers were detected as follows: CEA 184.00 ng/ml, CA125 778.00U/ml, CA199>1000.00U/ml, CA72-4 22.10U/ml, NSE 16.10ng/ml and CY211 11.0ng/ml. No significant abnormalities were found in other laboratory tests. Prior to postoperative adjuvant therapy, a PET/CT ( Figure 1 ) scan revealed a mild hypodensity mass with a maximum SUV value of 12.0 in the lateral segment of the left hepatic lobe, which was diagnosed as a malignant tumor. In addition, enlarged lymph nodes were visible in the left parotid gland, hilar hepatic and retroperitoneal regions, and FDG metabolism is elevated, which was considered as metastasis. CT scan showed a wedge-shaped and slightly hypodense mass in the lateral segment of the left hepatic lobe. MRI revealed an irregular soft tissue mass in the lateral segment of the left hepatic lobe with a slightly low signal intensity on T1WI and a heterogeneous slightly high signal intensity on T2WI, as well as dilated adjacent bile ducts. The resected mass of the right toe was submitted to undergo histology and immunochemistry. Histologically, the freckle-like tumor tissue invaded the superficial dermis with a 0.6 cm of maximum diameter and 0.2 mm Breslow thickness, which was identified as grade Clark IV without residual tumor cells in transverse and longitudinal margins. Pathological diagnosis of acral freckle-like malignant melanoma. Immunoperoxidase stains were performed on a Ventana NEXES Automated Immunohistochemistry System (Fuzhou Maixin Biotech Co., Ltd., Fuzhou, China) Vimentint, HMB45 and Melan A were positive in the tumor cells, while CKp, S-100, SOX-10, and CD68 were negative. Ki-67 was reactive in approximately 40% of the tumor cells ( Figure 2 ). Pathological diagnosis is a freckled malignant melanoma of the extremities. Immunohistochemical features of liver aspiration biopsy tissue are as follows ( Figure 3 ): CK19, CK7, CKp, and MUC5AC were positive in tumor cells, while Hepatocyte, CDX-2, TTF-1, HMB45, Melan-A, S100, and SOX10 were negative. The pathological diagnosis of a liver tumor is intrahepatic cholangiocarcinoma. Serum NGS testing suggested a potentially clinically significant missense mutation in exon 2 of the KRAS gene, namely P.G12V. Based on medical history and double Primary Cancer confirmed this time, four primary tumors were comprehensively diagnosed, including bone tumors, bladder malignancies, malignant melanoma, and hepatic cholangiocarcinoma. Based on NGS (P.G12V) and coexisting Acral melanoma(AM) and intrahepatic cholangiocarcinoma as well as systemic lymph node metastasis, there is currently no sensitive Class A targeted drugs. 6 cycles of GP (gemcitabine hydrochloride 1.5g, d1,8/cisplatin 40 mg, d1, 8) combined with anti-PD-1 inhibitors (Camrelizumab 200 mg, d1) system therapy From April 2021 to August 2021, Followed by 3 cycles of Camrelizumab (200 mg, q3w) maintenance therapy during September to October 2021, and efficacy evaluation (RECIST version 1.1) as SD throughout treatment. she was re-admission because of mild yellowing sclera in December 2021, laboratory tests showed abnormal liver function indicators such as DBIL 40.1 umol/L, IBIL 48.1 umol/L, ALT 205 U/L, and AST 181 U/L. MRCP indicated ( Figure 4 ) multiple liver metastases and biliary obstruction, and tumor progression was considered, so the 4th cycle of immune maintenance therapy was suspended. To improve liver function, endoscopic retrograde cholangiography (ERCP) and biliary stenting were also carried out. The tumor continued to progress 1 month after ERCP surgery, and the patient and family refused to continue anti-tumor therapy. Infectious shock and multiple organ failure caused the patient's death in March 2022. The patient had a satisfactory curative effect and lived for up to a year after being diagnosed with double primary cancers.

kras germline mutations, ngs, literature review, multiple primary tumors, systemic therapy

PMC9353035_01

Male

A 40-year-old male farmer without any underlying condition was admitted to the hospital because of fever, night sweats, and pain in the lower back. The patient had reportedly been well until 3 weeks earlier, when back pain developed. He reported no associated trauma or injury, and no treatment was administered. On the 10th day of illness, he began to have fever with a temperature as high as 38.3 C, along with night sweats, fatigue, and weakness. He took antipyretics, but the fever and back pain persisted. The patient was sent to this hospital for further evaluation. The patient had occupational exposure to livestock. He was married and lived with his wife and children, who were well. There was no history of tuberculosis (TB), recent travel, transfusions, alcohol consumption, smoking, or intravenous drug use. The patient took no medications and had no history of drug allergy. There was no family history of disease. Upon admission to the hospital, his core body temperature was 39 C, and he had severe pain in the L4-L5 area. Other vital signs and the remainder of the physical examination were normal. The erythrocyte sedimentation rate (ESR) was 70 mm/h. The levels of C-reactive protein (CRP) and interleukin-6 (IL-6) were slightly elevated to 28.93 mg/L and 10.88 pg/ml, respectively ( Figure 1A ). A human immunodeficiency virus (HIV) test was negative, and other blood parameters, including routine blood parameters, liver enzyme concentrations, procalcitonin and creatinine levels, and antinuclear antibody concentrations, were normal. Blood culture was negative. Magnetic resonance imaging (MRI) showed abnormalities suggesting inflammation in the L4 region ( Figure 1B ). An enzyme-linked immunosorbent assay (ELISA) for the detection of Brucella antibodies was performed on plasma, and the results were positive, with an IgM concentration of 12.88 U/ml and an IgG concentration of 89.15 U/ml. To confirm the diagnosis, vertebral tissue aspiration was performed on the second day after admission. The aspirate was sent for bacterial culture and molecular TB detection. An automated blood culture system was used for bacterial culture. Five days later, the bacterial culture result was positive for Brucella, which is a very small, faintly stained Gram-negative coccobacillus that microscopically looks like "fine sand". Polymerase chain reaction (PCR) was negative for Mycobacterium tuberculosis (MTB) DNA. With a confirmed diagnosis of Brucella-related complicated infection, triple therapy including intravenous ceftriaxone (2.0 g qd) and oral rifampin (0.6 g qd) and doxycycline (0.1 g q12 h) was administered. After 2 weeks of treatment, the patient's body temperature returned to normal. The pain in the lower back was also relieved. However, 1 week later (3 weeks from the beginning of anti-Brucella therapy), the patient's symptoms recurred; he had a moderate to low fever (top temperature up to 38.5 C) accompanied by lower back pain. On physical examination, the pain in the L4-L5 area was significantly worse than before. The results of laboratory re-examination showed a normal white blood cell count (8.11 x 109/L), with 62.1% neutrophils, and a highly elevated ESR (86 mm/h) and CRP level (79.75 mg/L). The level of IL-6 increased to 53.91 pg/ml. Liver enzymes, creatinine levels, and antinuclear antibodies were within normal ranges. The second MRI ( Figure 1C ) scan of the spinal cord showed lesion expansion involving the lower posterior part of L4 and focal abscess formation. Due to the recurrent clinical symptoms and imaging findings, abscess puncture and drainage were performed. Cytology showed inflammatory infiltration (of which 65% were neutrophils) without neoplastic cells. Abscess fluid culture results were negative. Despite drainage for 5 days, the symptoms of fever and lower back pain persisted. Because the patient had been hospitalized since the beginning of treatment, poor treatment adherence could be excluded. Other infections and drug side effects were also ruled out. Accordingly, brucellosis-associated IRIS was suspected. There is no clinical consensus on the definition of infection-associated IRIS, and there is no treatment standard. With reference to the regimen for TB-IRIS treatment, the triple-agent anti-Brucella regimen was continued, and 200 mg of celecoxib twice a day was initiated. However, the patient's symptoms remained after 1 week of treatment. Anti-inflammatory treatment was changed to 0.5 mg of prednisone per kilogram bodyweight (35 mg). Within 3 days, the patient's body temperature returned to normal, and the back pain significantly improved. Both the ESR and CRP level also gradually returned to within normal ranges. Steroid therapy was tapered over a 2-month period. The triple-agent anti-Brucella therapy was continued for 2 weeks, followed by sequential treatment with oral doxycycline (0.1 g q12 h) and rifampin (0.6 g qd). After the overall 14-week treatment course, the third MRI scan ( Figure 1D ) showed that the lower edge endplate of L4 had been damaged, the paravertebral abscess had disappeared, and the lumbosacral soft tissue edema had significantly improved. At the last follow-up visit 2 months after completing the anti-Brucella therapy, the patient had no complaints, and the physical examination was normal.

iris, case report, human brucellosis, immune reconstitution, infection

PMC4237689_01

Male

In this case report we present a case of 54 years old male patient of Chinese descent who presented to the clinic with a complaint of mobility restriction on right lower extremity for 40 years. Upon investigation, the patient was found to have a history of right sided hip joint TB at the age of 14. The patient had increasing pain on his right lower extremity with restriction of movements especially abduction and external rotation. After seeking medical consultation, a battery of tests were conducted that led to the diagnosis. The Tuberculin purified protein derivative (PPD) test was conducted in the clinic which was positive as was demonstrated by the size of the induration formed at the site of infiltration. The patient had received anti- TB chemotherapy with isoniazid, rifampicin, pyrazinamide and ethambutol along with prophylactic antibiotics to prevent the secondary infections. The patient was not clear about the exact duration of the therapy. A progressive restriction on the right hip joint had ensued after a short time post therapy. But further intervention however was not sought since there was a certain degree of alleviation in patient's condition. After a few years the movement restrictions had grown even more severe accompanied by pain while maneuvering the joint. On presentation, the patient had 0 degree abduction, internal and external rotation. Recent radiological findings showed right hip joint fusion along with deterioration of the articular surfaces [Figure 1]. The patient didn't suffer from any other systemic condition. After admittance to the Qilu Hospital of Shandong University, all the required tests were carried out that included blood work, microbiological assessment, chest and spine X-rays, CT scans, in order to exclude the persistent tuberculosis lesions in any other organ thus ultimately omitting any contraindication for the total hip arthroplasty. Sputum and urine cultures were negative. The routine blood work showed an elevated Erythrocytic Sedimentation Rate (ESR 87 mm/hr) and C-reactive protein (CRP 75 mg/L). The diagnosis was made from the patient's history, clinical symptoms, radiological data and the histopathological reports from the surgically extricated tissue that showed granulomatous inflammatory tissue with strains of acid-fast bacilli which was confirmed as M. tuberculosis bacilli by the microbiological testing. However a prior attempt to aspirate the synovial fluid for culture was unsuccessful. The patient was put on anti-tuberculous drug regimen including isoniazid, rifampin, pyrazinamide and ethambutol for a period of 3 months before arranging the surgical procedure. Total hip arthroplasty was performed during which an excessive callus formation was observed around the femoral neck which was chiseled out from the intact bone cortex as far as possible. The inter-operative tissues were preserved for a histopathological analysis. An acetabular cup of optimal measurement was set along with a high cross linking polyethylene sleeve, then a metallic traditional femoral component was set. After reduction, the joint movements were evaluated where a flexion of 90 , abduction of 30 was attained. The X-rays taken post-surgery showed proper prosthetic alignment [Figure 2]. The postoperative recovery was unremarkable for any complication and the patient was discharged in 15 days after the surgery. Regular follow-ups were arranged to monitor the patient's condition and he was counseled to refrain from activities that put extra strain on the weight-bearing joints. No aberrant lesions were detected in lungs or bladder or genital organs. Chest [Figure 3] and spine X-rays were devoid of any lesions thus excluding the co-existence of a pulmonary or any other extrapulmonary TB. The same regimen of anti-TB drugs as mentioned earlier was continued for one year postoperatively. Timely follow-ups were conducted for a period of 24 months during which the patient presented with a normal gait and no complaint of pain at the affected side. OATs are the most common forms of extrapulmonary TB (El Titi et al.). However; the obscurity of the symptoms puts many hurdles on the path to its early diagnosis. Most patients only present with joint swelling and pain. According to a recent case study presented by Mohammed J et al. only 38% of the patients reviewed showed some systemic symptoms of tuberculosis like low-grade fever and night sweats while there was no systemic signs in the rest of the cases thus there was an average of 2 years of delay in diagnosis (Al-Sayyad & Abumunaser). The delay in diagnosis in the forms of extrapulmonary TB involving sacroiliac joint might be caused by the examination traditionally carried out with patient in the supine position and also due to the physicians failure to perform the sacroiliac joint pain provocation maneuvers (Babhulkar & Pande; Laslett & Williams). OAT usually manifests as a monoarticular arthritic condition rather than affecting multiple joints (Grosskopf et al.). Frequently Mycobacterial infection of the sacroiliac joint may present as psoas abscess and may not be diagnosed till the spontaneous drainage into the groin (Feldmann et al.; Kim et al.; Richter et al.). Total hip arthroplasty or total hip replacement has now emerged as one of the most common orthopedic procedures performed for debilitating lesions of the hip joint that lead to restriction of joint movement, pain and deteriorates the patient's living standards. The therapeutic outcome of THA has been substantial in the treatment of the osteoarthritis in comparison to the conventional techniques with obvious alleviation in pain symptoms, joint movements as well as the patient's living standards. THA is also the established method of treatment in cases of dormant TB of hips (Tulsi; Kim et al.). The implementation of THA in the cases of active tuberculous coxitis has been a debated concept. There are certain risks involved with THA on patients with tuberculous arthritis which can't be undermined. There is a potential risk of reactivation of the TB infection postoperatively. Many orthopedic surgeons argue that the risks outweigh the benefits thus they suggest that anti-TB drug therapy should be started preoperatively for an optimal duration (Babhulkar & Pande; Kim et al.; Sidhu & Singh; Xun-wu et al.). In a study presented by Sidhu AS et al., the recurrent case of tuberculous arthritis was attended with a three month course of preoperative drug therapy followed by total hip replacement after which an extended duration of drug therapy was continued postoperatively (Sidhu & Singh). There have been few reports which demonstrated various cases of peri-prosthetic tuberculous infection post surgery. M Kaya et al. presented a case of peri-prosthetic tuberculous infection in the patient with history of THA for osteoarthritis performed 9 years earlier (Kaya et al.). Walczak P et al. presented a case report of a patient with a history of tuberculous hip in 58 years earlier who underwent THA 9 years before (Walczak et al.). Thus proper prophylactic measures are crucial while undertaking this treatment method. The limitation of our paper is its being a single patient case-report however we believe that there are very few case-reports on the recurrence of the TB of hip after a considerably long duration. Although detailed history was collected from the patient regarding compliance to the medication, it can however still be one of the fators for the recurrence of TB after a considerably long duration of time. TB is considered quiescent after 10 years of remission while some authors prolong the duration to 20 years (Kim et al.; Hardinge et al.). In our case the TB had relapsed after 40 years of purported remission. The therapeutic approach was extrapolated from the techniques chosen for an active TB infection of hip and there was no relapse of the disease for as long as 12 months after cessation of a year-long postoperative anti-tuberculous drug therapy although a longer follow up is still crucial.

anti-tuberculosis chemotherapy, arthritic tuberculosis, total hip arthroplasty

PMC3037994_01

Male

A 74-year-old man was diagnosed with pulmonary tuberculosis via an abnormal chest X-ray and acid fast bacilli sputum smear (fig. 1). Antitubercular agents, including isoniazid (400 mg/day), rifampicin (600 mg/day), pyrazinamide (1,500 mg/day), and ethambutol (800 mg/day) were administered. Four months after initiation of antitubercular treatment, the patient complained of intermittent loose stool, tenesmus, and lower abdominal discomfort. Fifteen days later, his diarrhea became bloody and mucoid with a jelly-like appearance, and he suffered from aggravating lower abdominal discomfort. By the time the patient presented to our hospital, he was experiencing bloody diarrhea 5 to 6 times per day. On physical examination, the patient was febrile, and his vital signs were within normal limits. His bowel movements were very frequent and his abdomen was soft and flat. Tenderness was noticed in the left lower quadrant of the abdomen without rebound tenderness. The patient's white blood cell count was 5,300/mm3, but serum C-reactive protein and erythrocyte segmentation rate were markedly elevated at 4.41 mg/dl and 57 mm/h, respectively. Sigmoidoscopy revealed multiple yellowish plaque lesions from the rectum to the sigmoid colon (fig. 2a), and mucosal biopsy from the sigmoid colon showed small collections of neutrophils between crypts at the summit of the mucosa with tufts of damaged surface epithelium (fig. 3). The patient was diagnosed with PMC. We discontinued antitubercular agents and started oral metronidazole 250 mg twice per day with intravenous fluid and electrolytes. The patient's symptoms ameliorated slowly over 2 weeks of metronidazole treatment, during which he completely recovered from diarrhea, tenesmus, and abdominal pain. We restarted antitubercular agents, replacing rifampicin with levofloxacin. The patient experienced no recurrence of diarrhea by the end of antitubercular treatment, and his general condition recovered. Follow-up sigmoidoscopy did not show any evidence of PMC (fig. 2b).

pseudomembranous colitis, rifampicin, tuberculosis

PMC8375276_01

Female

A 74 year old woman was diagnosed with generalized MG 44 months prior to initial SARS-CoV-2 vaccination. Serologic testing showed elevated antibodies to acetylcholine receptors. For 18 months prior to and including the vaccine time course, treatment with 1440 mg mycophenolate sodium and prednisone 11 mg daily resulted in clinically stability. There was a remote history of ductal carcinoma in situ and Hashimoto's thyroiditis, and no history of opportunistic infection. Peripheral blood monitoring showed 8700 leukocytes and 800 lymphocytes per microliter (9%), consistent with mild lymphopenia. Three months prior to initial vaccination, the patient began treatment with eculizumab, an anti-C5 monoclonal antibody with activity in MG. Eculizumab was given weekly and then biweekly per US labelling. The indication was adjunctive therapy to bridge elective surgery, which was uneventful. Eight weeks after surgery, BNT162b2 vaccination was started and two doses were administered 21 days apart. Eculizumab administration time points included 10 days prior to dose 1 of BNT162b2 and 3 days prior to dose 2, with the last dose given 11 days later. Blood was initially tested 71 days after the second dose of BNT162b2. The SARS-CoV-2 RBD binding antibody level (Abbott Architect IgG II) was 19 arbitrary units (AU)/ml, with values below 50 considered negative (https://www.fda.gov/media/146371/download). QuantiFERON SARS-CoV-2 RUO (Qiagen), an S-peptide-based interferon-gamma release assay (IGRA) similar to the QFT-Plus assay for Mycobacterium tuberculosis-specific T cells, was performed per the manufacturer. SARS-CoV-2 S peptide pool S1 and S2 net values of 0.02 international units (IU)/ml and 0.03 IU/ml were summed to 0.05 IU/ml to provide a single metric. Negative (nil) and positive (mitogen) control values were 0.02 IU/ml and >10 IU/ml, indicating negligible background lymphocyte activation and intact activation potential. Amongst 14 healthy controls (HC) studied a median of 58 days (range, 10-107) after completing BNT162b2 (10 persons) or M1273 (4 persons), median net summary response to S was 1.27 IU/ml (range, 0.34 IU/ml-2.60 IU/ml). HC median nil was 0.03 IU/ml (range, 0.02 IU/ml-0.06 IU/ml) and each mitogen control was >10 IU/ml. After tests for vaccine immunogenicity returned negative, the patient sought repeat vaccination. At 85 days after completing BNT162b2, they received M1273, with a second dose 29 days later. Side effects were minimal. Immune response were tested 16 days after the second dose of M1273. The serum anti-SARS-CoV-2 RBD IgG level was 2999 AU/ml, considered positive. IGRA re-test 32 days after completing M1273 showed a net summary response to S peptides of 0.38 IU/ml IFN-gamma, with nil and mitogen responses of 0.03 IU/ml and >10 IU/ml.

corticosteroid, eculizumab, myasthenia gravis, mycophenolate sodium, sars-cov-2, vaccine

PMC8096542_01

Male

A 17-year-old male sustained right midshaft tibia and fibula fractures in a high school football game. The patient had previously been healthy without significant past medical history. The patient was transported to a local hospital where radiographs demonstrated a short oblique fracture of the tibial diaphysis with mild comminution (AO/OTA classification 42-B2) (Figure 1). At the outside emergency department, the patient was placed in a long leg splint and discharged home with planned definitive fixation the following morning. Following discharge, the patient experienced a syncopal episode at home and returned to his local emergency department. On arrival, he was found to be hypoxic, requiring 1-3 L/min of low flow nasal cannula (LFNC) oxygen to maintain saturation. A chest radiograph demonstrated mild bilateral interstitial and alveolar opacities (Figure 2). CT of the chest was notable for scattered ground-glass opacities. The patient tested negative for COVID-19. Given the patient's fracture history, respiratory symptoms, and chest imaging, the pulmonology department at this hospital recommended the patient be transferred for a higher level of care for suspected FES. The patient was admitted to the pediatrics service at our level I pediatric trauma center at approximately 2000, 24 hours postinjury. He was febrile to 38.0 C and requiring 3 L/min LFNC to maintain saturations. Otherwise, vital signs were within normal limits. The patient was at his baseline mental status. The orthopaedic surgery service was first notified about the patient once he had arrived in the hospital, and the orthopaedic resident on-call was present at the bedside at approximately 2100. On exam, the patient was now requiring 10 L/min via simple mask to maintain oxygen saturation in the mid-90s. Examination of the right lower extremity demonstrated diffuse swelling about the lower leg without concern for open fracture or compartment syndrome. The patient's splint wrapping was taken down and re-wrapped during the examination, but the splint was not removed. A rapid response was called one hour after orthopaedic examination due to deteriorating respiratory status and new mental status changes. The patient was transferred to the pediatric intensive care unit (PICU) in acute hypoxic respiratory failure requiring continuous positive airway pressure (CPAP) at 50% FiO2 to maintain saturations. Repeat chest radiograph demonstrated worsening interstitial opacities (Figure 2). The orthopaedic service was not notified about the patient's transfer to the PICU and found out the patient had been transferred when the resident on-call presented to the patient's original hospital room in order to reassess the patient. After discussion with the PICU team, who forecasted that the patient was likely to be intubated regardless of whether or not emergent operative intervention was pursued, the decision was made to provisionally stabilize the patient's fracture in an attempt to prevent further fat embolization. The patient was taken to the operating room emergently approximately 6 hours after arrival to our hospital and 3 hours after mental status changes and respiratory distress. After the patient had been intubated on his hospital bed, he was carefully transferred to the operating table with his splint in place. With attention to minimize movement at the fracture site, the right lower extremity splint wrappings were removed with scissors. The anterior tibia was prepped with chlorhexidine and draped while keeping the splint in place and without manipulating the leg. A uniplanar external fixator was then applied with fluoroscopic guidance (Figures 3 and 4). Following surgery, the patient was transferred to the PICU intubated. He was extubated approximately 12 hours postoperatively. His mental status had returned to baseline at the time of extubation. He was weaned from supplemental oxygen by the evening of postoperative day 3. He underwent intramedullary nailing using a reamer/irrigator/aspirator graft harvesting system (RIA 2, Synthes, West Chester, PA) to minimize fat embolization during definitive fixation on the afternoon of postoperative day 4. He was discharged from the hospital in good health on postoperative day 5. Three months postoperatively, the patient had returned to full activity and was without complaint. Three-month postoperative radiographs demonstrated fracture union (Figure 5).

PMC6875186_01

Male

A 46-year-old man was attended in the dental clinic complaining of symptomatic oral lesions with two months in duration. The intraoral physical examination revealed diffuse, friable, vegetative areas on the right upper alveolar ridge, hard palate, and left inferior alveolar ridge (Figures 1(a) and 1(b)). His medical history revealed a diagnosis of tuberculosis about a month ago in which the expectorated sputum smears were positive for bacteria and acid-fast bacilli. In addition, at the time of diagnosis of tuberculosis, the patient had a significant weight loss and asthenia. The patient was under antibacterial therapy (oral isoniazid (INH) 225 mg/day, rifampicin (RFP) 450 mg/day, pyrazinamide 1,200 mg/day, and ethambutol (EB) 825 mg/day). Testing for human immunodeficiency virus (HIV) infection was negative. Furthermore, the patient confirmed smoking and chronic alcoholism. He worked as a night flow controller on the side of a highway and lived very close to the countryside. After knowing the patient's medical history, the main hypothesis for oral lesions was tuberculosis. An incisional biopsy of the right upper alveolar ridge showed connective tissue with intense inflammatory infiltrate with a granulomatous pattern, consisting of giant multinucleated inflammatory cells and vacuolated macrophages, with innumerable fungi suggestive of H. capsulatum (Figures 2(a) and 2(b)). Staining slides with periodic acid-Schiff (PAS) (Figures 2(c) and 2(d)) and Grocott-Gomori methenamine silver were positive for the morphological characteristics of H. capsulatum. In addition, the immunohistochemical reactivity to Histoplasma using polyclonal antibody was positive; for polyclonal P. brasiliensis, Leishmania spp. and Calmette-Guerin bacillus were negative. The diagnosis of oral histoplasmosis was established. We did not search for fungi in other biological samples. Initially, the drug was maintained for tuberculosis and prescribed fluconazol (400 mg/day) for seven months for treatment of oral histoplasmosis. During the follow-up, when a gradual increase in body weight was noted, fluconazole was substituted for itraconazole 200 mg/day for eight months with the resolution of oral histoplasmosis lesions. The clinical control one year after initiation of itraconazole treatment can be seen in Figures 3(a) and 3(b). One year after the initial treatment of tuberculosis, the patient was cured.

PMC3299074_01

Female

A forty-two-year-old female PLHIV (people living with HIV) not on antiretroviral treatment (ART) was admitted with the history of sudden onset left hemiplegia and altered sensorium for 4 days. There was no history of fever, headache, vomiting or convulsion. She received antituberculosis treatment for pulmonary tuberculosis 6 months back. On examination she was afebrile, pulse was 54 per minute regular and blood pressure was 140/90 mmHg. Pallor and oral candidiasis were noted. There was no evidence of lymphadenopathy. Central nervous system examination revealed GCS of 5/15. Right pupil was dilated and nonreacting, no papilledema on fundoscopy. Left upper motor neuron facial palsy present. Patient had left hemiplegia. Other systems examination was normal. On investigations, her hemoglobin was 9 gm%, total leucocytic count was 8000/cumm. Metabolic lab was normal. Her CD4 count was 14/cumm and chest X-ray was normal. CT scan brain showed large 5x4x4.5 cm abscess in right frontoparietal region with severe mass effect and leptomeningitis. [Figure 1]. Urgent drainage of intracranial abscess was done by neurosurgeon. Approximately 50 cc pus was drained. Patient became ambulatory by fifth postoperative day with marked improvement in sensorium. Acid fast bacilli were seen on ZN staining of pus. Pus was inoculated on Lowenstein Jensen's medium. Single white colony was grown by second week which was not rough and dry as seen in typical myocobacterium tuberculosis growth, but was smooth and wet in appearance and nonpigmented. Smear was strongly positive for acid-fast bacilli which were long and slender. Further confirmation was done by niacin test which was negative which favored the infection by NTM. The organism was further identified as MAI by standard biochemical tests. Patient was started on tab Clarithromycin, tab Ethambutol, and ART. Repeat CT scan brain after 1 week, showed reduction in the size of abscess with perilesional edema [Figure 1].

brain abscess, mycobacterium avium intracellulare, non tuberculous mycobacterium

PMC8650847_01

Female

A 28 year old female, known to have type I DM presented to the emergency room (ER) with history of backache and lower limb weakness. Contrast MRI of the lumbosacral region demonstrated loss of disc space with paraspinal collection at L3-4 extending into bilateral iliopsoas muscle suggesting tuberculosis. After work up, the patient was started on four anti-tubercular drugs (ATT) regime of HRZE as per the protocol. After initial improvement in clinical and neurological status, the patient returned with relapse of back pain after 5 months of therapy. The repeated radiology demonstrated re-collection of organised pus. The needle aspiration of pus along with Xpert MTB/RIF and liquid culture (MGIT) both showed the presence of MTB resistant to rifampicin. Under USG guidance, a malecot catheter was inserted for drainage of the abscess. Patient was started on modified ATT and planned for surgical intervention and fixation in case of non-improvement or deterioration. After 2 months, the patient presented with high grade fever and discharge from the abscess site for which she was brought to the emergency department. MRI lumbosacral spine revealed infective pathology at L3/L4 segment with associated intra and extra-spinal abscesses causing neural compression in comparison with that of previous scans report (Fig. 1). Suspecting secondary infection, pigtail insertion was done to drain the abscess and cultures were sent for two consecutive days. Aerobic culture of the sample did not show growth of any bacteria and anaerobic culture showed growth of bacteria sensitive to metronidazole. The latter was identified as Peptoniphilus asaccharolyticus in both the samples by MALDI-TOF MS. Antibiotic sensitivity was put up by agar dilution method according to CLSI guidelines M11-A8 2012 which was sensitive to clindamycin, cefoxitin, metronidazole, imipenem and piperacillin-tazobactam with MIC breakpoints of 0.25, 4, 0.25, 0.031 and 0.125 (mg/L) respectively. With the culture report, the patient was started on metronidazole I/V 500 mg TDS and the patient's clinical symptoms like discharge of pus and fever drastically improved. Metronidazole was continued for a period of 14 days along with ATT. At the end of 14 days, patient had no signs of active pus discharge and there was complete resolution of fever. Follow up MRI after 14 days also revealed significant reduction in the loculated abscesses in the right iliopsoas muscles while the rest of the findings grossly remained the same (Fig. 2). Patient was discharged with continuation of oral metronidazole for five more weeks along with anti-tubercular drugs and insulin and surgical intervention once the secondary infection settled.

peptoniphilus asaccharolyticus, multidrug resistant tuberculosis, paraspinal abscess

PMC3914253_01

Male

Mr DJ is a 26-year-old student, a male, who was diagnosed with SCA in childhood. He was adherent to his routine medications and regular to follow up. He presented with 2 weeks history of oliguria and passage of frothy urine. This was preceded by swelling of the leg and face a week prior to presentation. This was associated with anorexia, weakness of the body, early satiety, abdominal fullness, and nausea. There was no fever, vomiting, jaundice, or change in bowel habit. He had cough productive of frothy sputum but no haemoptysis or chest pain; however, he had dyspnoea, orthopnoea, and paroxysmal nocturnal dyspnoea. He has had few bone pain crises, and these were usually treated with rehydration, opiate analgesic, antimalarial, and/or antibiotics. He was transfused on 2 occasions as a result of the crises and twice during the course of this illness. He is not a known hypertensive or diabetic and no family history of same or kidney disease. There no positive history of use of herbs, mercury, alcohol, or tobacco. He is the only sickler in a family of 3 siblings; both parents are alive and well. He was conscious but in respiratory distress. He had anasarca, pallor, and asterixis but no cyanosis. The pulse was 108 beats/minute, full volume, and regular, the blood pressure was 160/90 mmHg, the praecordium was hyperactive, and apex beat was displaced and heaving. The heart sound heard were S1, S2, and S3 gallop with pansystolic murmur maximal at the apex. He had bilateral basal fine crepitations, distended abdomen with firm smooth hepatomegaly and ascites. He was conscious and had no asterixis. He was admitted as a case of sickle cell cardiomyopathy in congestive cardiac failure, with sickle cell nephropathy as a differential diagnosis. Investigations results revealed that urinalysis showed proteinuria 3+. PCV was 14%, blood film hypochromia, polychromasia, anisocytosis, and fragmented cells. The total and differential white blood cell count was normal, and ESR was 94 mm/hr. The serum sodium was 132 mmol/L, potassium was 4.1 mmol/L, bicarbonate was 13 mmol/L, creatinine was 645 mumol/L, urea was 35 mmol/L, calcium was 2.3 mmol/L, total protein was 59 mg/dL, albumin was 28 mg/dL, total cholesterol was 5.2 mmol/L, LDL was 3.2 mmol/L, and HDL was 1.1 mmol/L. The abdominal ultrasound showed bilateral shrunken kidneys, hepatomegaly, and ascites. Other viscera were normal. Chest X-ray showed marked cardiomegaly, pulmonary oedema as abnormality. Echocardiography revealed marked 4-chamber dilatation and biventricular failure. The diagnosis was then changed to sickle cell nephropathy with congestive cardiac failure. He was comanaged with the cardiologist. He was advised on low salt diet, care on protein intake, and was commenced on tabs Ramipril, hydrochlorothiazide, frusemide, digoxin, erythropoietin, folic acid, proguanil, vasoprine, and erythropoietin. He was also on twice weekly haemodialysis. He was transfused with 2 units of packed red blood cell. The haemodialysis including ultrafiltration and medication was regular; however, the breathlessness and ascites persisted. Weekly therapeutic abdominal paracentesis for symptomatic relief was then instituted while awaiting result of other investigations. Results of further investigations revealed sterile exudative ascitic fluid. Chest CT scan revealed enlarged heart, mild pericardial effusion, and prominent main pulmonary artery. Abdominal CT scan revealed bilateral small kidneys, gross ascites, hepatomegaly, cholelithiasis, dilatation of the portal vein, and prominent collaterals seen at the porta hepatis. BACTEC blood culture was positive for tuberculosis. Other investigations were consistent with previous results as documented above. The managing team then was expanded and included nephrologists, infectious disease physician, cardiologist, gastroenterologist, and haematologist. The frequency of haemodialysis was increased to daily, antituberculous therapy was commenced, and tabs Sildenafil were added to the medications above. He improved remarkably within 2 weeks of these regimens. The patient improved progressively, and 4 weeks later he had a successful and live-related kidney transplant. There was no operative or immediate postoperative complication. He is 1-year posttransplant, there was complication, and he has remained stable clinically, biochemically, and haematologically. His present blood pressure was 120/70 mmHg, PCV was 25%, sodium was 137 mmol/L, potassium was 4.1 mmol/L, Serum creatinine was 96 umol/L, serum urea was 5.3 mmol/L, and tacrolimus level was 4.8 ng/L.

PMC5139797_01

Male

A 32-year-old South Asian man initially presented to a gastroenterologist after abnormal liver function tests and mild anemia were detected on a routine physical examination. A colonoscopy and sonogram of the liver were performed. The colonoscopy was normal and the sonogram showed fatty liver. The patient remained asymptomatic afterwards except for occasional heartburn. At this time he was seen in our Gastroenterology (GI) clinic and further evaluation was initiated. A thorough history and physical examination were performed. The patient denied any diarrhea or history of recent travel, though his past travel history included a six-year period of stay in the Caribbean Islands five years prior to this presentation. Family history was not contributory. The patient denied any toxic habits. Physical examination was normal. With a clinical suspicion of Celiac disease laboratory work was requested which showed anti-gliadin IgA, IgG, anti-endomysial and tissue transglutaminase antibodies to be positive. Initial aminotransferases tests showed aspartate aminotransferase (AST) of 111 U/L and alanine aminotransferase (ALT) of 120 U/L. Esophagogastroduodenoscopy (EGD) was performed which showed a partial Schatzki ring in the lower third of esophagus and a diffuse granular mucosa with fissuring in the second and third part of the duodenum. Biopsy of the second part of the duodenum showed villous atrophy with crypt elongation, replacement of surface epithelial cells by cuboidal cells with loss of brush border and increase in lymphocytes relative to the number of epithelial cells. Lamina propria showed increased plasma cells, lymphocytes and polymorphs consistent with celiac disease. Bone scan revealed osteoporosis involving lumbar spine and osteopenia involving both hips. T and age matched Z scores are shown in Table 1. The patient was started on a strict gluten free diet, vitamin D, calcium and alendronate 10 mg orally every day. Subsequent endoscopy done 6 months later showed grade I esophagitis, erythematous non-bleeding gastropathy and granular mucosa in the third part and bulb of the duodenum. Repeat biopsies of the duodenum showed regeneration of villous height and regression of crypt hyperplasia. The surface epithelium showed increased columnar cells with basal nuclei and brush borders consistent with partial restoration and improvement in celiac disease. Repeat bone scan eighteen months later showed osteopenia with significant improvement of BMD (Table 1). No significant symptoms related to side effects of alendronate were reported during the 18 months treatment period. Repeat aminotransferases revealed AST of 26 U/L and ALT of 42 U/L.

alendronate, celiac disease, osteoporosis

PMC8080464_01

Male

A 45-year-old male patient, truck driver by occupation, was admitted to our hospital with intense right-sided upper abdominal pain and right-sided chest pain of 10-days duration. He also complained of accompanying fever of the same duration. Prior to his admission, he had consulted another hospital and had received some non-specific medication without any relief, for which he was referred to our hospital. The patient gave a history of alcohol intake (moderate amount) since the last 10 years; however, he was otherwise apparently healthy prior to this episode of current illness. He was not diabetic or hypertensive and there were no other significant medical or family history, including history of contact with tuberculosis. On physical examination, the patient was conscious and oriented. He was febrile and recorded a temperature of 37.8 C. His pulse rate, respiratory rate, blood pressure and oxygen saturation were recorded to be 109/min, 22/min, 130/90 mm of Hg and 94 % respectively. On abdominal examination, tenderness was elicited in the right hypochondriac region. Respiratory system examination revealed a right-sided pleural effusion with reduced air entry in right lung and basal crepitations in left lung. Rest of the systemic examination was normal. Laboratory investigations revealed a raised alkaline phosphatase level of 363 IU/L, a slightly raised total bilirubin level of 1.6 mg/dL (raised direct bilirubin 0.76 mg/dL, normal indirect bilirubin 0.8 mg/dL), and a low albumin level of 2.5 g/dL. Hemogram reports showed an extremely high total leucocyte count of 38.09 x 109/L, neutrophilic leukocytosis with shift to left (polymorphs 90.4 %) and a low hemoglobin level of 117 g/L. Other parameters such as, total red blood cell count (4.85 x 1012/L) and platelet count (545 x 109/L), respectively were within normal limits. Serum electrolytes, random blood sugar level, and lipid profile were also within normal limits. The patient tested negative for anti-HIV-1/2 antibodies, anti-Hepatitis C virus antibodies, and for Hepatitis B surface antigen. An ultrasonogram of the abdomen revealed a well-defined hypoechoic mass of size 10.7 x 8.5 x 7.2 cm in the right lobe of liver suggestive of an abscess and confirmed by an abdominal computed tomography scan. Subsequently, pigtail catheterization was carried out under local anesthesia which drained approximately 350 mL of thick purulent brownish material which was submitted for various microbiological investigations. The patient was started on parenteral antibiotics (piperacillin-tazobactam and metronidazole) pending culture results. Other supportive management such as maintenance of oxygen saturation, correction of anemia and drainage of pleural fluid was provided as per protocol. A Gram-stained smear of the abscess material showed plenty of polymorphs (50-70 per low power field) with lots of gram negative bacilli scattered in arrangement (Fig. 1A). Culture on MacConkey agar after 24 h of incubation yielded pure growth of non-lactose-fermenting colonies (Fig. 1B) consisting of oxidase-negative, motile, gram-negative rods identified as Stenotrophomonas maltophilia by the VITEK-2 automated microbial identification system (bioMerieux, Marcy l'Etoile, France). Antibiotic susceptibility testing of the isolate by the standard disc-diffusion test performed as per the Clinical and Laboratory Standards Institute guidelines showed the isolate to be susceptible to chloramphenicol, levofloxacin, minocycline and trimethoprim-sulphamethoxazole, but resistant to ceftazidime and ticarcillin-clavulanate. The individual minimum inhibitory concentrations of the various antibiotics by EzyMIC (HiMedia, Mumbai, India) were as follows - chloramphenicol (1 mug/mL), levofloxacin (1 mug/mL), minocycline (0.75 mug/mL), trimethoprim-sulphamethoxazole (0.25 mug/mL), ceftazidime (>=256 mug/mL) and ticarcillin-clavulanate (32 mug/mL). Other investigations including modified Ziehl-Neelsen stain for acid-fast bacteria, cartridge based - nucleic acid amplification test for Mycobacterium tuberculosis, wet-mount for motile trophozoites and culture for fungi were non-contributory. Culture of accompanying pleural fluid specimen as well as blood culture did not reveal any growth. Antibiotics were changed to a combination of levofloxacin (750 mg once a day intravenous) with trimethoprim-sulfamethoxazole (160 mg + 800 mg two times a day orally) administered for 3 weeks. Simultaneously, drainage with pigtail catheterization was also continued for 2 weeks. Significant clinical and radiological improvement was noted after one week of therapy, with decrease of abdominal pain, remission of fever and significant resolution of abscess and pleural effusion. The laboratory findings also improved gradually. The patient was discharged on the 22nd day of admission, with advice to continue oral trimethoprim-sulfamethoxazole in the same dosage for a further duration of 2 weeks. Clinical examination at 2 months follow-up revealed complete resolution of symptoms without any fresh complaints or any recurrence of infection.

hepatic abscess, liver abscess, pyogenic liver abscess, stenotrophomonas maltophilia

PMC9382239_01

Female

A 60-year-old woman presented with fatigue and weight loss, along with pain in the proximal interphalangeal joints of both hands, wrists, elbows, shoulders, knees, and metatarsophalangeal joints. She was diagnosed with RA at a local clinic six months ago. Her symptoms were not relieved with six months of continuous treatment of DMARDs, and the patient had fever. When the patient referred to our hospital, she experienced severe pain in the small- and medium-sized joints throughout the body and significant swelling in the interphalangeal joints of all painful joints. She described her joints as having a burning sensation, accompanied by significant morning stiffness. She was positive for antinuclear antibody and negative for RF. Additionally, she had a high titer of anti-cyclic citrullinated peptide antibody, an erythrocyte sedimentation rate of 48 mm/h, and a CRP level of 13.3 mg/L (Table 2). Using the 28-Joint Disease Activity Scale (DAS28), her diagnosis of RA was confirmed with a disease activity score of 6.04, suggesting a high degree of disease activity. Next, we initially administered methotrexate (MTX), tofacitinib, and etoricoxib because of the ineffectiveness of multiple DMARDs, for which the patient experienced insignificant joint pain relief. The patient experienced vomiting after MTX administration. For several reasons, the patient refused low-dose steroids to relieve pain. As this patient was resistant to first-line DMARDs, we initiated adalimumab (40 mg subcutaneously every other week) (Hisun Biopharmaceutical Co., Ltd.) therapy after screening the patient for hepatitis virus infection, LTBI, and other infectious conditions according to the British Society for Rheumatology DMARDs safety guidelines. Compared to DMARDs, the patient responded better to adalimumab therapy. Unfortunately, the patient had a concealed history of a sexual partner with HIV/AIDS. However, her DAS28 score decreased to 4.9 after two weeks of ADA treatment, and symptoms such as joints pain and weakness were significantly relieved. Nonetheless, after RA was in control, HIV was detected in her blood, with a quantitative HIV-1 RNA test revealing values of 1.31E+5 IU/mL, accompanied by a decreased CD4+ lymphocyte count. Considering that she had difficult-to-treat RA combined with HIV/AIDS, her swollen and painful joints were uncontrolled. In addition, the patient was ineffective against DMARDs. Steroids may have accelerated the replication of HIV-RNA and induce other infections. After discussion with the patient, adalimumab therapy was continued, and HAART was initiated. HIV-1 RNA viral replication was controlled, and the CD4+ lymphocyte count continued to increase (Figure 1). After one year of ADA therapy, LTBI and other infections did not occur. She had no fever, and her fatigue had significantly improved. Her case was considered as RA remission, with a DAS28 score of 1.40.

aids, tnf, adalimumab, human immunodeficiency virus, rheumatoid arthritis

PMC8259459_01

Female

A 5-year-old female was admitted to the department of pediatrics with a fever of 39.0 C, fatigue and chest pain. The symptoms appeared 3 days prior and were not preceded by an infection. The patient otherwise appeared healthy and did not require any specialist medical care. A SARS-CoV-2 infection was excluded by PCR test, that was negative for both the patient and her mother. Because of tachycardia (150 bpm) and a silent murmur over the heart, echocardiography was ordered, which revealed a thin layer of fluid in the pericardial sac (3.8 mm thick). Additionally, there was a sinus tachycardia with diffuse ST elevations in precordial and limb leads (Figure 1). Laboratory evaluation revealed elevated C-reactive protein (CRP) level of 90 mg/ml (0-5 mg/ml normal range), while troponin (TnI), procalcitonin and complete blood count results within normal range. The tests for borreliosis, tuberculosis and HIV infection were negative as well as blood cultures for multiple organisms. The results of complex autoimmune diagnostics, including anti-nuclear antibodies (ANA), anti-neutrophil cytoplasmic antibodies (ANCA) and anti-Scl-70 antibodies were unremarkable. Since the fever continued, with no satisfactory response to oral paracetamol and ibuprofen, empirical broad-spectrum antibiotic therapy was started. In the following days, as the changes on electrocardiogram disappeared and the layer of pericardial effusion appeared stable, the daily dose of ibuprofen was reduced. Despite that, the patient remained dysphoric and sleepy, with continuous low-grade fever. On her 15th day of admission to hospital, CRP increased to 115 mg/ml, TnI raised to 7 ng/L (0-2.5 ng/L normal range) and echocardiography revealed fibrinous adhesions between the pericardial laminae. High dose ibuprofen was re-administered and continued for another 9 days with the addition of colchicine. On the 24th day, the patient was discharged home with CRP reduced to 25 mg/mL and 2.2 mm thick layer of fluid in the pericardial sac. Ibuprofen (2 x 100 mg per os) and colchicine (1 x 0.5 mg per os) were prescribed until the next out-patient review. The girl and her mother presented 10 days later at the Emergency Department in a different town with relapse of fever (38.6 C). Once again, the PCR test for SARS-CoV-2 RNA was found to be negative. Considering the patient's past medical history, current symptoms and elevated inflammatory markers, she was transferred to the Clinic of Pediatric Cardiology. An echocardiogram was performed, which revealed a 4.5 mm thick layer of fluid between pericardial laminae. Moreover, a thickened parietal lamina was connected to the visceral lamina with hyper-echogenic fibrous adhesions (Figure 2A). At the time of examination, the girl did not complain of chest pain or dyspnea. On auscultation, there was a pericardial friction rub over Erb's point and inverted T-waves were recorded on the ECG (Figure 3A). The medical interview taken at that point revealed some additional information. Three days prior to the first episode of fever, the girl underwent a significant blunt force trauma to the chest while playing outside. Initially, she reported superficial pain of her ribs and thoracic spine. She attended the family doctor, who did not find any musculoskeletal lesions. Two days later, the fever appeared, and the location of the pain changed to deep inside the chest. Considering all the above, the patient was diagnosed with incessant pericarditis and administered ibuprofen (3 x 200 mg daily). The girl was visited by specialists in pediatric rheumatology, hematology, and immunology, however the etiology of her pericarditis remained unknown. Chest CT showed no pathological features over the lungs or mediastinum, and no additional abnormalities in laboratory tests appeared. After 4 days of treatment, the girls' overall condition improved considerably, however fibrinous pericardial effusion persisted, as did the elevated CRP. Steroid therapy with oral prednisone 1 mg/kg daily was initiated, which improved her condition considerably. On the 7th day of hospitalization (after four doses of prednisone), not only did the CRP level decrease, but the ECG improved (Figure 3B) and the effusion resolved completely (Figure 2B). The patient was discharged home and after 2 weeks of therapy (prednisone, high dose ibuprofen and colchicine) with a satisfactory echocardiographic and clinical effect, the dose of ibuprofen and prednisone were gradually reduced. After 4 weeks, the patient was only receiving colchicine, which was continued for another month. In a 5-month follow-up, she remained asymptomatic, with physiological amounts of pericardial fluid (Figure 2C) and a normal ECG for her age (Figure 3C). Considering absence of other factors likely to cause pericarditis as well as an immediate response to steroids, we presume that a post-traumatic inflammatory reaction was the most probable etiological mechanism for patients' condition.

case report, chest pain, pericarditis, prednisone, thoracic injuries

PMC3422279_01

Male

A 46-year-old man originating from Morocco, with a medical history of end-stage renal disease secondary to type 2 diabetes mellitus presented with chills during haemodialysis (HD) sessions on January 2011. The patient was on HD since 2007, and in 2009, he was included in a prospective study to evaluate the utility of HBHA-IGRA, compared to TST for the detection of LTBI in HD patients (Dessein et al, manuscript in preparation). The QFT-G-IT was highly positive (13.58 IU/ml) as were the PPD- and HBHA-IGRAs with respectively 18,972 pg/ml and 7,287 pg/ml IFN-gamma. These results, especially the high IFN-gamma response to the latency antigen HBHA, indicated that the patient was latently infected with Mtb. During a January 2011 HD session, the patient presented with chills and fever, but no abnormalities were noted upon physical examination, except a weight loss of 4 Kg over the previous weeks. Blood cultures remained negative. A chest radiography revealed no infiltrates, cavities or calcifications. The patient denied prior exposition to Mtb, but the QFT-G-IT was still positive, with values similar to those found two years earlier (14.36 IU/ml), whereas the HBHA-IGRA had become totally negative. However, depletion of the CD4+ regulatory T cells from the PBMC, performed as described previously and based on CD25high T cell depletion by positive immunomagnetic selection, resulted in the re-appearance of a low but positive IFN-gamma response to HBHA stimulation (134 pg/ml). At that time, the IGRA values to rESAT-6 were very high (3,855 pg/ml) so that the HBHA/rESAT-6 ratio was 0.001. Since these results strongly suggested that the patient had progressed from latent Mtb infection to active TB disease, a PET Scan analysis was done demonstrating a strong metabolic captation of cervical and mediastinal lymph nodes. A jugular lymph node was surgically removed and revealed the presence of a granuloma with caseous necrosis. Anti-tuberculosis treatment was immediately initiated (Nicotibine, Rifadine, Tebrazid, Myambutol) and resulted in progressive clinical improvement. Thirty-two days later, the lymph node culture was positive for drug-sensitive Mtb.

PMC4672623_01

Female

A 46-year-old Caucasian female was referred to our institution in December 2012 following a CT-pulmonary angiogram performed to investigate left sided pleuritic chest pain, which revealed a large apical cavity with surrounding consolidation (Fig. 1). The patient reported daily cough productive of brown sputum. There was no associated dyspnoea, malaise or fatigue and no anorexia or weight loss. The patient was Australian born and worked as a computer programmer. Her only overseas travel was to Malta and United Kingdom 30 years prior. She smokes cigarettes and had a past history significant for bilateral pleurodesis for recurrent pneumothoraces as well as an anxiety disorder, for which she took paroxetine. She did not report recurrent infections through childhood or exposure to M. tuberculosis. A chest radiograph 6 years prior to presentation showed 'fibrocalcific lesions in both lung apices'. Physical examination revealed a thin woman (BMI 19.6 kg/m2) with normal vital signs. There was no clubbing or palpable lymphadenopathy. Respiratory examination revealed coarse breath sounds in the left upper zone upon auscultation. Examination was otherwise unremarkable. Blood work revealed normal electrolytes, renal function and liver function tests. Complete blood picture showed mild thrombocytosis only. C-reactive protein and ESR were normal. Quantiferon-gold, serum Aspergillus precipitins and HIV antibody were negative. Serum immune-globulins revealed a mild increase in IgA (5.73 g/dL, range 0.85-3.50), but were otherwise normal and alpha-1-antitrypsin was normal. Pulmonary function testing revealed a mild obstructive ventilatory defect and moderately reduced diffusion capacity. The patient underwent a bronchoscopy, which revealed inflammed left lingular segment airways with no endobronchial lesions seen. Cytological analysis of the bronchial specimens did not show any evidence of malignancy. A non-tuberculous mycobacterium was isolated on culture of bronchial washings, which subsequently identified as M. kyorinense. Between 20 December 2012 and 7 November 2013, seven pulmonary specimens were collected for analysis (two bronchoscopy and five sputum). Small numbers of acid fast bacilli not resembling M. tuberculosis were seen on direct smear from the first bronchial wash specimen. All specimens grew in Bactec MGIT 960 at an average of 13 days (range 7-30 days). MPT 64 TB antigen (BD MGIT TBc Identification Test) testing was negative on the first isolate and all positive broth culture isolates were submitted to Mycobacterial Reference Laboratory, Victorian Infectious Diseases and Reference Laboratories for further testing (MRL, VIDRL). The MRL identified the non-tuberculous mycobacterium as M. kyorinense by 16S ribosomal RNA gene sequencing. The MRL was unable to perform sensitivity testing of the isolate. Smoking cessation was encouraged however no anti-mycobacterial treatment was instituted initially due to uncertainty about the significance of the M. kyorinense isolate, and the patient's symptoms deteriorated over the following 3 months. Repeat CT chest showed an increase in the size of the cavity as well as the development of widespread tree-in bud opacities in the left and right upper lobes (Fig. 2). A second bronchoscopy was performed which once again yielded M. kyorinense. Clarithromycin, ethambutol and moxifloxacin were commenced empirically and consideration was given to initiating an injectable aminoglycoside given the extensive cavitation present. Follow up after 7 months of therapy was completed although the patient had continued to smoke and her adherence with medication was uncertain. The patient continued to cough and M. kyorinense was repeatedly isolated from the expectorated sputum. Repeat CT imaging performed at 7 months showed partial improvement of the lung infiltrates but persistence of the cavity.

m kyorinense, mycobacterium kyorinense, non-tuberculous mycobacterium, pulmonary cavitation, pulmonary infection

CT chest at presentation showing a left upper lobe cavity with areas of consolidation and background changes of centrilobular emphysema.

PMC9622764_01

Male

A 16-year-old male was hospitalized due to jaundice for 8 days and right lower abdominal pain for 2 days. He had thrombocytopenia, hypoalbuminemia and abnormal clotting. His liver was palpable 3 cm under costal margin, while the spleen edge was palpable 2.5 cm below the left costal margin. He had abnormal results in laboratory examinations: total bilirubin level (TBL) 393.5 micromol/L (normal range 0.0-26.0 micromol/L); direct bilirubin level (DBL) 206.7 micromol/L (normal range 0-6.8 micromol/L); alkaline phosphatase (ALP), 288.9 U/L (normal range 45.0-125.0 U/L); gamma-glutamyl transpeptidase activity (GGT), 113.2 U/L (normal range 10.0-60.0 U/L); total bile acid (TBA), 348.4 micromol/L (normal range 0.0-10.0 U/L); serum aspartate aminotransferase (AST), 120.3 U/L (normal range 15.0-40.0 U/L); alanine aminotransferase (ALT), 50.8 U/L (normal range 9.0-50.0 U/L); platelets (PLT), 35 x 109/L (normal range 100-300 x 109/L); serum albumin, 25.5 g/L (normal range 35-51 g/L); prothrombin time (PT), 25.1 s (normal range 12-14 s); activating partial thromboplastin time (APTT), 39.4 s (normal range 31-43 s); and prothrombin activity (PTA), 34% (normal range 75%-100%).Urine porphyrin concentrations were determined and considered within normal limits: hepta-carboxyprophyrin, 1.2 mcg/g creat (normal range 0-2.9 mcg/g creat); uroporphyrin I, 10.8 mcg/g creat (normal range 4.1-22.4 mcg/g creat); and coproporphyrin III, 26.8 mcg/g creat (normal range 4.1-76.4 mcg/g creat). Parameters suggestive of autoimmune or viral hepatitis, such as cytomegalovirus antibody, Epstein-Barr virus, antinuclear antibodies, antimitochondrial antibodies, hepatitis B surface antigen, and hepatitis C virus antibodies, were negative. Serum levels of copper, ceruloplasmin and tumor markers showed no abnormalities. CT documented irregular dilatation of intrahepatic bile ducts, cirrhosis, splenomegaly, collateral veins, ascites and gallbladder wall edema. He was allergic to dust, pollens, fish and seafood with reactions of pruritus. He had a medical history of eczema from around the age of 10 years, treated with topical steroid therapy for several years. Three months ago, he had stopped military training due to itching, tingling and redness on his skin from exposure to the sun. Because of his slow interval growth, he was given a course of growth hormone treatment, which resulted in increased growth velocity. At 16 years, he was 159 cm tall (3rd percentile in the Chinese Centers for Disease Control and Prevention growth charts) and had discontinued growth hormone treatment. There were no risk factors for liver injury, such as drug use, toxins or alcohol abuse. The patient had no similar episodes when he was a child and there were not any factors triggering the clinical onset of disease. His parents were non-consanguineous, and there was no family history of similar symptoms. After hospital admission, the patient was given symptomatic treatment with liver protection, infusion of plasma, albumin, vitamin K1 and anti-inflammatory therapy. A week later, the patient's blood coagulation indexes were corrected, abdominal pain disappeared, and inflammatory markers returned to normal. However, the patient still had severe cholestasis associated with pruritus and jaundice. Accordingly, we adopted a policy of low-dose dexamethasone treatment, and the patient's bilirubin levels had slightly decreased after 3 days but no significant effects after 1 week. Examination of the bone marrow revealed no significant abnormality and primary hematologic dysfunction, or malignancy was excluded. Genetic metabolic diseases were considered, and we performed whole-exome sequencing (WES) and Sanger sequencing with the permission of the patient and his families. Targeted next-generation sequencing, involving 61 genes responsible for genetic disorders of hepatic cholestasis and we detected pathogenic variant in ABCB4 gene: c.959C > T (p.S320F)/c.1429C > A (p.Q477K) (Figure 1A). c.959C > T (p.S320F) has been reported previously in the literature, while c.1429C > A (p.Q477K) is a novel heterozygous pathogenic variant. ABCB4 c.959C > T (p.S320F) variant was identified in his father and c.1429C > A (p.Q477K) variant was identified in his mother. His parents are heterozygous carriers. Pedigrees for the patient are shown in Figure 1B. The patient was treated with ursodeoxycholic acid (UDCA) 15 mg/(kg x d). Sadly, he was insensitive to UDCA and progressed to end-stage liver disease. Multiple liver failure complications plagued him, including jaundice, edema, ascites, spontaneous bacterial peritonitis, splenomegaly, esophageal varices, coagulopathy, and hepatic encephalopathy. At age 17, the patient underwent liver transplantation successfully. The postoperative pathological diagnosis showed intrahepatic cholestasis with progression to cirrhosis (Figure 2). Negative liver tissue immunohistochemistry of BSEP and MDR3 was found in the bile duct membrane. Immunohistochemistry showed absent MDR3 staining, confirming the diagnosis of MDR3 deficiency. The patient was discharged after one month with stable vital signs. Notably, during the 1-year follow-up visit, the patient's liver function was almost in complete remission. Dynamic changes of his liver test are shown in Table 1.

abcb4, c1429c>a, multidrug-resistant protein 3, novel mutation, progressive familial intrahepatic cholestasis type 3

PMC8261161_01

Male

A 25-year-old physiotherapist, who had previous trouble with anterior ankle impingement that was treated with arthroscopic surgery, presented with PAIS. He was a recreational football (soccer) player but did not report any single significant sporting injuries. He described chronic pain and had noted a bony swelling in the posteromedial aspect of his ankle. The plain radiograph of the ankle demonstrated an os trigonum; however, due to the orientation of the medial tubercle, this was not clearly seen and he was incorrectly diagnosed as having os trigonum syndrome (see Figure 1). The MRI scan reported mild inflammation associated with the os trigonum but also confirmed the presence of bone fragments posteromedially between FHL and the flexor digitorum longus (FDL) with marrow oedema affecting the medial tubercle of the talus (see Figure 2). After failure of conservative treatment, he underwent surgery. Due to the position of the medial bony fragments, an open rather than an endoscopic excision was performed to avoid injury to the posterior tibial neurovascular bundle. The os trigonum was felt not to be contributary to the symptoms and was left alone. Surgery was uneventful and at final review reported resolution of the preoperative symptoms.

PMC8261161_02

Male

A 32-year-old male architect was referred to the orthopaedic service with right PAIS. He described an injury to his right ankle several years ago as he went to kick the ball when playing football. He did not seek immediate medical attention, and the initial symptoms settled. He then went on to develop pain and medial-sided ankle swelling when he tried to carry out vigorous sporting activities some years later. On examination, there was a bony swelling behind his medial malleolus, and pain was exacerbated with plantar flexion and inversion of the ankle/foot demonstrating signs of PAIS. The MRI scans demonstrated a bony fragment with surrounding oedema associated with the medial talar tubercle. The fragment was between FDL and FHL tendons representing an "unusually located os trigonum," and there was also associated FHL tenosynovitis (see Figure 3). Interestingly lateral X-rays did not show any abnormality as this patient did not have a conventional os trigonum. He underwent operative intervention with an open excision of the bony fragment (see Figure 4). The FHL tendon was found to have a split, and this was also repaired. The postoperative course was complicated with superficial wound infection which was successfully treated with a course of oral antibiotics. At the 6-week follow-up, the patient was pleased and described that their PAIS symptoms were improving.

PMC8261161_03

Male

A 39-year-old male construction worker presented to the foot and ankle orthopaedic clinic with posteromedial left ankle pain following a minor football injury 6 months ago. He described a football tackle to his left ankle; subsequently, the ankle became swollen and painful. He did not seek immediate medical attention after the injury. Due to ongoing pain symptoms of PAIS, he was unable to carry on with sporting activities. On examination, his ankle was not swollen, and he had a palpable posteromedial lump that was tender. His pain film radiograph demonstrated a prominent posterior process of the talus that was fractured and displaced, but this had been misdiagnosed as an os trigonum (see Figure 5). He underwent an MRI to evaluate this lump and determine the relation to the medial neurovascular structures. The scan demonstrated a posteromedial tubercle fracture fragment medial to the FHL tendon. There was also an associated os trigonum. Interestingly, the MRI report did not describe the posteromedial tubercle fracture fragment that was the palpable mass (see Figure 6). This fragment was painful and restricted his mobility. He underwent operative intervention with open excision of the posteromedial fracture fragment and os trigonum. This was achieved through a posteromedial ankle incision where the neurovascular bundle and FHL tendon were seen and protected. He was followed up in 6 weeks where his PAIS symptoms had improved, and he was commenced on physiotherapy.

PMC8261161_04

Male

A 31-year-old male who works as a sports physiotherapist sustained a right ankle pronation injury whilst playing football. He did not seek immediate medical attention. He then presented 5 weeks later to the orthopaedic clinic complaining of deteriorating pain associated with ankle swelling and anterolateral ankle pain. He underwent an MRI that was reported with a small intra-articular effusion, a prominent os trigonum, lateral collateral ligamentous attenuation/fibrosis, and features of chronic posterior impingement. At the time, he was managed nonoperatively with a walking boot for 2 weeks and protected weight bearing. In 2018, he noted persistent posterior ankle pain. He did not sustain any new trauma. A right ankle CT scan demonstrated a malunion/partial union of the medial margin of the talus and secondary degenerative changes (see Figure 7). There was also still the presence of a prominent os trigonum with sclerotic changes associated with it. He was again managed nonoperatively with a walking boot and protected weight bearing during periods of exacerbation. He was able to return back to sporting activity once pain symptoms improved.

PMC8486406_01

Male

The subject of this case is a 22-year-old NCAA Division I football defensive back who experienced extreme left hip pain following contact with another player with his hip flexed during an early season game. The subject was informed that data collected regarding the case would be submitted for publication. The on-field medical team transported the subject to a nearby emergency room where plain film radiographs revealed a posterior left hip dislocation (Figures 1A-B), negative for fracture, along with mild pre-existing femoral head CAM deformities bilaterally, thus, the diagnosis was consistent with a type 1 dislocation. The left hip was reduced (Figures 2A-B) and the subject was instructed to be non-weight-bearing on the left lower extremity with bilateral axillary crutches for two weeks, followed by adding 25% weightbearing each week thereafter to weight bearing as tolerated while maintaining standard posterior hip precautions (no hip flexion greater than 90 , no hip adduction, no hip internal rotation) for a total of six weeks. Magnetic resonance imaging was also performed of the left knee and findings indicated a "low grade" left medial collateral ligament sprain. Three weeks after injury the subject had a chief complaint of ongoing limited function and left hip, knee, and posterior thigh pain. Primary personal goals were full return to sport without fear of repeated dislocation. The subject presented to the clinic approximately three weeks after the injury ambulating with bilateral axillary crutches and apparently weight-bearing at approximately 75% on the left lower extremity (LLE), although he had been instructed to be no greater than 25% weight-bearing at that time. He reported 2/10 on the numeric pain rating scale (NPRS) at rest, located in the anterior left hip region, and 5/10 at worst with mild rotational movements in the left hip, knee, and posterior thigh. The subject demonstrated limited left lower extremity range of motion (ROM) and motor performance detailed in Tables 1 & 2. The subject reported medial left knee pain with active end range left knee flexion, and had an empty endfeel secondary to pain with gentle left hip internal rotation, flexion, and extension. The subject presented with positive grade 1 left knee valgus stress test (mild pain, no gapping apparent), and tenderness to palpation in the left psoas, distal biceps femoris, and medial collateral ligament. Resisted left knee flexion reproduced the subject's posterior mid-thigh complaint. The subject's static right lower extremity balance was within normal limits, however the left was not tested in consideration of precautions. He presented with a positive trace left knee effusion as assessed by sweep test and recorded a 51/80 on the Lower Extremity Functional Scale. Dermatomal light touch was intact and deep tendon reflexes were 1+ throughout bilateral lower extremities. The subject presented with impaired left lower extremity motor performance, range of motion deficits, pain, and diminished function and weight-bearing ability consistent with status post traumatic posterior dislocation of the left hip, with secondary soft tissue injury around the hip joint, a grade 1 left MCL sprain, and a grade 1 hamstring strain. The subject was progressed through a phased formal physical therapy program, averaging two visits per week over 14 weeks with multi-modal care including weekly consults with the team physician and the athletic department. Following the 14 weeks, full return to sport was facilitated by the athletic program's athletic training and strength and conditioning staff. Loading of the left hip and lower extremity was carefully controlled throughout the course of care utilizing rating of perceived exertion, percentage of pre-injury 1-repetition-maximum (1RM), and a rolling 1.1-1.2 acute to chronic workload ratio (ACWR) for prescribed resistance exercise, return to run, and plyometric activities. This phase emphasized pain reduction, appropriate healing of affected tissues, strengthening of LLE in protected ranges, and re-introduction of weight-bearing (WB) activity with normalization of gait. The subject was instructed by his physician to be non-weightbearing (NWB) on the LLE until two weeks post-reduction, and then to progress to weightbearing as tolerated (WBAT) at six weeks. The subject demonstrated poor adherence to WB precautions in non-clinical areas and was educated at evaluation and thereafter about appropriate percentage of WB. Posterior hip precautions were placed until six weeks post-reduction. Initial treatment included instrument-assisted soft tissue mobilization (IASTM) to the left hamstrings and medial knee region, and manual techniques to reduce left psoas spasm. Progressive resistance exercise (PRE) was prescribed in NWB positions emphasizing left hip external rotators and extensors while avoiding hip ROM precautions, and eccentric training of left knee flexor musculature. As precautions allowed, the subject was encouraged to begin WB with lateral shifting in standing and protected leg press activity, progressing to partial squatting on stable and unstable surfaces. Gait training was performed to normalize gait and progress from bilateral axillary crutch use to single crutch, and then no assistive device. Aerobic and upper extremity conditioning were achieved with progressive moderate intensity upright cycling and seated UE resistance exercise supervised by strength and conditioning staff. After six weeks the subject demonstrated normalized gait, normalized left hip ROM (hip flexion 0-115 , IR 30 at 90 flexion), reported minimal pain at rest and with prescribed activities, and demonstrated improved left hip motor performance, exhibited by hand-held dynamometer and manual muscle tests. This phase emphasized progressive loading of the left lower extremity and reintroduction of non-contact impact activity. The subject performed progressive unilateral leg press beginning at 50% pre-injury 1-repetition-max (1RM), elevated conventional barbell deadlift of 50% pre-injury 1RM, and kettlebell goblet squats beginning at 20lb progressing up to 100lb by 10 weeks post-injury. He was prescribed progressive elliptical and pool running aerobic activity for two weeks, followed by initiation of a gradual return to run program beginning with two bouts of 2 minutes of running on the treadmill. Core and hip strengthening interventions included various planks, bridging with physioball, half-kneeling cable column chops, and sidestepping and kickbacks with elastic bands at the ankles. Gentle stretching was prescribed for the left hip flexors and knee flexors. Balance training was performed with single leg stance on unstable surfaces and multi-directional rebounder ball toss on stable surfaces. The subject was barred from performing plyometrics, Olympic lifts, and any agility activities. After 10 weeks the subject was able to asymptomatically perform multiple bouts of five minutes of easy pace running on treadmill and artificial turf, 60% preinjury 1RM elevated conventional deadlift and left single leg press, and single leg stance on stable surfaces with external perturbation. This phase emphasized return to plyometric impact activity, agilities, and non-contact sport-specific movement. The subject was prescribed low-intensity single plane agilities without cutting movements, progressing to multiplanar tasks with greater intensity, such as T- and pro-agility style drills with integration of non-contact sport-specific movements. Low-intensity double leg plyometrics were initiated progressing to single leg plyometrics with an emphasis on left hip external rotation control. He initiated a progressive sprinting program during this phase, and performed varied single leg static balance exercises on unstable surfaces with external perturbations. At the end of this phase the subject was able to asymptomatically perform lateral single leg jumps into alternate direction sprint starts, 36-inch double leg box jumps, single leg stance on unstable surfaces with perturbation, 70% of pre-injury 1RM resistance exercise on all non-Olympic lifts (e.g., trap-bar deadlift, elevated conventional deadlift, barbell squat, kettlebell squat), sets of 8 x 40 yard sprints, and all non-contact drills prescribed. The subject completed the return to sport phase with the athletic training and strength and conditioning staff. Formal physical therapy care was ended since he had asymptomatically performed the majority of non-contact sport activity and his athletic program staff provided extensive monitoring and care to continue guiding his return to full participation. He successfully returned to a normal training schedule without restrictions for that point in the off-season. Three months following initial injury the subject was asymptomatically performing the majority of non-contact sport activity and training. He was restricted from contact, >80%1RM lower extremity PRE, and Olympic lifts (e.g., clean variations, snatch, jerk). Following a one to two week visit to home the subject returned and continued care with athletic training and strength and conditioning staff. He reintegrated into typical defensive back off-season training approximately four to five months post injury without restrictions. At seven months post injury, the subject returned to his team physician with report of "pinching" in his anterior left hip with rotational agilities and movements. The physician noted normal strength and range of motion of the left hip, but positive clinical tests for acetabular or labral involvement. A magnetic resonance arthrogram was ordered, which revealed an osteochondral lesion of the superomedial femoral head with underlying intense subchondral marrow signal abnormality and overlying near-full to full thickness cartilage defect of 12x5 mm. There was additional full thickness cartilage delamination with chondral flap posterior and inferior to the osteochondral lesion of 6x6 mm along with a partial thickness, non-detached tear of the anterior labrum, which extended superiorly to the anterosuperior labrum (Figures 3A-B). Mild incipient subclinical avascular necrosis was identified in weightbearing regions of the femoral head. In consideration of imaging results the subject was recommended the options of a trial of intra-articular corticosteroid injection with prescribed rest or surgical intervention including cartilaginous debridement. The subject selected the surgical option and underwent the surgical procedure almost immediately, which consisted of 10 to 2 o'clock left labral repair with cam osteoplasty and acetabular chondroplasty including; femoral head chondral debridement, iliofemoral capsular thermal plication, loose body removal with anterior inferior iliac spine decompression, and injection of plasma rich platelets and Supartz (synthetic joint lubrication). The subject successfully completed the initial post-surgical protocol at a third-party facility, passed the Vail Hip Sports Test, completed a transitional period of physical therapy at the collegiate facility, and was cleared for reintegration into sport approximately four months post operatively. He was able to return to full play in the following football season. Figure 4 details the full course from injury to return to sport the next season.

football, hip dislocation, return to sport, trauma

PMC5598496_01

Male

A 32 year old Hispanic male with no significant past medical history presented to the emergency department with five days history of nausea and vomiting associated with abdominal pain. Patient stated that he has been having 8-10 episodes of non-bloody, non-projectile and non-bilious vomiting which is associated with diffuse, non-radiating, colicky abdominal pain alleviated by taking hot showers. The patient also had two days history of diarrhea which resolved on its own. The patient denied anorexia, dysphagia, heartburn, jaundice, hematemesis, excessive flatulence, bloating, constipation, tenesmus, hernia, fevers, chills, weakness, fatigue, or recent weight loss. The patient had a similar episode 2 months ago and was admitted to the hospital, for which he had a computerized tomography (CT) scan of the abdomen performed. At that time the CT showed a possible diagnosis of inflammatory bowel disease. The patient also has a 15 pack year history of smoking, along with social alcohol use, and daily marijuana use for 19 years. Physical examination upon admission revealed a well-developed, Hispanic male who was in moderate distress from pain. BP 127/70 mmHg, HR 60/min, T 97.4 F, RR 23/min, and Oxygen saturation 97% on room air. Skin was warm, dry, and without rash. Abdomen was soft with periumbilical tenderness, and without hepatosplenomegaly. The remainder of the physical exam was normal. Laboratory data showed revealed Hb 14.2, Hct 42.6, WBC 9, and Platelets 155,000. Urine toxic screen revealed positivity for THC and benzodiazepenes. The patient was admitted with possible diagnoses of cannabis induced hyperemesis and irritable bowel disease. He was started on empirical antibiotics which was discontinued after 2 days, and he was placed on Zofran and pantoprazole for relieve of nausea, however these medications failed to produce any relief. After admission, he was placed on lorazepam 1 mg IV which provided immediate improvement in his nausea. During the patient's hospital stay, he took multiple hot showers as they relieved his vomiting and abdominal pain. The total course of stay for this patient was just over 24 h and he was symptom free prior to discharge. The patient was educated on the cannabis use being the contributory factor of his sickness and he was advised to discontinue its use. He was prescribed Lorazapam 1 mg PO BID for 3 days and then was reduced to once a day for 3 days. He was followed up in outpatient clinic.

cannabis, hot showers, hyperemesis, marijuana, vomiting

PMC7276430_01

Female

A 30 year-old female patient was diagnosed with acute myeloid leukemia (AML) in November 2013. Multiple cures of chemotherapy (idarubicine, cytarabine, fludarabine and amsacrine) led to a remission. In March 2014 (T0) (Fig. 1), because of a high risk of relapse, she received an allogenic hematopoietic stem cell transplantation (HSCT). At T0 + 6 months, she developed ocular, oral, digestive and hepatic graft-versus-host disease (GVHd). Immunosuppressive therapy by tacrolimus, ruxolitinib and oral corticosteroids induced a transient stabilization of GVHd. Between T0 + 6 and T0 + 12 months, she developed a progressive dyspnea, a dry cough and severe asthenia. Pulmonary function tests (PFT) showed a mixed ventilatory pattern with a very severe obstructive syndrome and severe CO diffusion impairment. Extensive blood analyses and non-invasive microbiological samples did not reveal any sign of infection. High-resolution computed tomography (HRCT) showed a bilateral perihilar mosaicism with zones of ground glass attenuation in a "crazy paving" pattern (Fig. 2, panel A). HRCT was completed by Single Photon Emission Computed Tomography with a ventilation/perfusion phase, which showed that the zones of ground glass attenuation where hypoperfused and hypoventilated when compared to adjacent hypodense lung areas. A bronchoscopy with broncho-alveolar lavage (BAL) and transbronchial biopsies (TBB) was performed. Differential cell count of BAL was normal. All microbiological samples remained culture negative. Histo-pathological analysis of lung parenchyma samples was unremarkable. Because of the severity of the respiratory insufficiency, a surgical lung biopsy was not performed. At this stage, our patient presented simultaneously a severe obstructive airway disease, potentially attributable to obliterative bronchiolitis (OB), and a parenchymal disorder, with a "crazy paving" mosaic pattern of ground glass attenuation, for which an infection had been reasonably excluded. To control the probable OB, immunosuppressive treatment was intensified with high-dose oral corticosteroids, and inhaled corticosteroids. Macrolides (as immunomodulators) were added and extracorporeal photopheresis was implemented. This failed to impact on the progression of the airway obstruction and the patient developed a progressive respiratory failure requiring continuous oxygen therapy and subsequently nocturnal non-invasive ventilation. Furthermore, because of her immunosuppression, she underwent recurrent hospitalizations for IV treatment of lower respiratory tract infections. At T0 + 34 months, indication for a bilateral lung transplant (BLT) was confirmed by the local transplant center. At T0 + 45 months, because of worsening of PFT, appearance of a cavitary subpleural lesion on HRCT (Fig. 2, panel A (red circle)), and high levels of serum galactomannan, posaconazole was introduced for suspicion of a locally invasive pulmonary aspergillosis. In spite of several adaptations of anti-fungal therapy, the size of the cavitary lesion increased (20 x 24mm with a 4 mm wall). At HSCT +47 months, her respiratory condition required continuous high pressure non-invasive ventilatory support, and high flow of oxygen. After three weeks in the Intensive Care Unit, BLT was performed. Macroscopically, the explanted lungs were firm and showed a yellow cut surface and a cavity with necrosis (Fig. 2, panel B). Microscopic analysis of the explanted lungs (Fig. 2, panel C) revealed the presence of 1/obliterative bronchiolitis predominating in the upper lobes; 2/diffuse alveolar lipoproteinosis with xanthomatous pneumonia and 3/a subpleural cavity with aspergillus fragments (confirmed by PCR) without signs of vascular or extrapleural invasion, confirming the co-existence of three disorders: OB, PAP and invasive cavitary pulmonary aspergillosis. More than two years after BLT, the patient is in good clinical condition, and has normalized her PFT and her lung parenchyma appears normal on HRCT.

aml, acute myeloid leukemia, bal, bronchoalveolar lavage, blt, bilateral lung transplant, gvhd, graft-versus-host disease, hrct, high resolution computed tomography, hsct, hematopoietic stem cell transplantation, invasive pulmonary aspergillosis, lung transplantation, ob, obliterative bronchiolitis, olb, open-lung biopsy, obliterative bronchiolitis, pap, pulmonary alveolar proteinosis, pft, pulmonary function tests, secondary pulmonary alveolar proteinosis, tbb, transbronchial biopsy

Lung CT-scan: "Crazy Paving" pattern with excavated subpleural lesion (circled).

PMC3682695_01

Female

A 41-year-old Caucasian woman complaining of persistent diarrhea, diffuse neck myalgia, swollen fingers and fatigue was clinically evaluated. Early morning fatigue and continuous neck pain started 6 months earlier and were initially attributed to stress by the patient's regular physician, who recommended psychotherapy. These symptoms did not improve and were worsened after a crisis of gastroenteritis due to seafood, associated with fever and severe abdominal pain, which resolved in 2 days. Despite improvement of the acute gastroenteritis, an intermittent diarrhea, without mucous or blood, persisted for another 2 months while the patient developed swollen fingers and a sudden outbreak of acne. The patient's clinical history revealed that she had pre-eclampsia during her only pregnancy (9 years earlier), mumps and pancreatitis at 9 years old, and a myalgic crisis 4 years earlier, diagnosed at the time as fibromyalgia by her orthopedist. She had never smoked and was not under any medical treatment except for contraception with a levonorgestrel-releasing (20 mcg/day) intrauterine system for the previous 5 years with complete amenorrhea. The myalgic episode was resolved with cyclobenzaprine hydrochloride (15 mg/day) and a healthy sleep routine. Family history revealed that her father died of glioblastoma multiforme (GBM) and her grandfather died of abdominal cancer of unknown origin. The only finding from the physical examination was a discrete tenderness upon palpation of the liver. Hematological values were within normal range. She presented with borderline high levels of LDL, HDL and total cholesterol (138 mg/dL, 48 mg/dL and 207 mg/dL). Triglyceride and VLDL cholesterol levels were 104 mg/dL and 21 mg/dL, respectively. The values for serum apolipoprotein A1 and B were 125 and 106 mg/dL, respectively. The patient tested negative for enteric parasites and fecal occult blood. Urinalysis revealed normal findings. Except for a slightly elevated gamma-GT (88 U/L), all hepatic parameters were within normal limits. Thyroid ultrasonography revealed a colloid cyst in the right lobe, but the TSH, free T3 and T4 levels were normal. Although her fasting glucose was within normal limits, the patient presented with 2-hour post-challenge hyperglycemia (2 hPG > 140 mg/dL), which was suggestive of impaired glucose tolerance. The HbA1C value was 5.4%. The seric amylase level was 97 U/L and the lipase level was 42 U/L. The urea, creatinine, and electrolytes (Ca, inorganic P, Na, K and Mg) values were normal. Plasma ACTH was 9 pg/mL, serum HGH was 0.61 mg/L, cortisol levels were 8.5 and 7.7 mg/dL at 8 am and 4 pm, respectively, DHEA was 400 ng/dL and DHEA-s was 230 mug/dL. Immunological investigation was positive for the following autoantibodies: ANAs (>=1/320:nuclear and metaphasic chromosome, >=1/160:cytoplasmic) and anti-smooth muscle. The panel was negative for p-ANCA, c-ANCA, CEA, Ca 19-9, ANA (nucleolar and nuclear mitotic apparatus), anti-nucleosome, anti-Sm, anti-RNP, anti-thyroglobulin, anti-thyroid peroxidase and native DNA. Serum levels of folic acid (327 ng/mL), vitamin B12 (438 ng/L), 25 hydroxyvitamin D (23 ng/mL) and 1, 25 dihydroxyvitamin D (42 pg/mL) were within normal ranges. The testosterone level was 34 ng/dL. The echocardiogram was normal. Abdominal and pelvic ultrasonographies were normal except for a discrete increase in liver lipid infiltration. The intrauterine device was adequately positioned. At this point, a dietary intervention (a low carbohydrate diet with lactose restriction) was prescribed, and the patient started a physical outdoor exercise program (50 minutes of walking, 5 times a week). Further immunologic testing was performed, but the results were either negative or normal (anti-mitochondrial antibody, Ro/SS-A antigen, La/SS-B antigen, serum immunoelectrophoresis, seric proteins electrophoresis, and serum IgA, IgG and IgM levels). During the following 5 months, the impaired glucose tolerance was controlled (2 hPG = 132 mg/dL), and she lost approximately 13 pounds (lb; starting weight: 156 lb, 5'8''); the diarrheic episodes diminished, but the fatigue persisted. The acne outbreaks were resolved with antibiotic therapy (tetracycline, 1 g/day, for 2 months). Family and colleagues ruled out personal and social problems. The physical exam was normal, and further laboratory tests were obtained. Blood hematological parameters remained unremarkable, but at this time, serum ferritin was assessed. The elevated levels (216 mg/L) indicated that the patient most likely had an iron overload syndrome. She was screened for C282Y, H63D and S65C mutations and was homozygous positive for H63D. Abdominal magnetic resonance image (MRI) Iron Overload Syndrome, amenorrhea and IUS confirmed a hepatic iron overload of 50 mumol/g with a standard deviation of 30 mumol/g. The patient was referred to a hepatologist who prescribed 4 therapeutic bleedings (phlebotomies) of 500 mL, once a month for 4 months. The intrauterine dispositive was removed to restart menstruation and allow for natural iron loss. Initially, the patient experienced extensive extremities edema, decreased immunological resistance and some dizziness after the phlebotomies. Diarrheic episodes ceased, and the fatigue decreased. Regular monthly menses were established after 2 months, and there was an increase in libido, although this was not a previous complaint. After all the phlebotomies, the serum ferritin levels returned to normal (52 mug/L) and the abdominal MRI findings showed a decrease in the hepatic iron concentration (40 mumol/g, standard deviation of 30 mumol/g).

hemochromatosis, hormone releasing iud/contraindications, iron overload

PMC4899985_01

Male

A 64-year-old male presented to his gastroenterologist with a history of portal hypertension and esophageal varices. His past medical history was remarkable for an episode of deep venous thrombosis. He also had a history of ulcerative colitis for which a colectomy and ileostomy had been performed. The patient had no history of hepatitis B or C, nor did he report any alcohol abuse. Based on clinical concern for primary biliary cirrhosis, a percutaneous liver biopsy was performed. The patient tolerated the biopsy well and was discharged without any obvious immediate postbiopsy complications. The results of the biopsy were essentially unremarkable, revealing no evidence of either fibrosis or cirrhosis . Following the biopsy, an MRI of the liver demonstrated a new geographic focus of increased T2 signal in the region of the biopsy (Fig. 1A). This region demonstrated decreased signal on both in- and opposed-phase imaging (Figs. 1B, 1C). However, no difference in signal was seen between these two T1-gradient sequences. T1, fat-saturated, 3D-gradient, arterial-phase imaging demonstrated contrast opacification of the anterior branch of the right portal vein at the same time as the right hepatic artery (Figs. 2A, 2B). During this phase however, there was no main portal-vein enhancement. The main and left portal veins did opacify as expected in the portal phase of imaging (Figs. 2C, 2D). These findings suggested an iatrogenic fistulous communication between the right hepatic artery and the anterior branch of the right portal vein. No intervention was performed as this time, but rather a watchful management approach was taken. One month later, a triple-phase CT demonstrated a nonenhancing filling defect with the right portal vein, with extension into adjacent portions of the anterior and posterior branches (not shown). A subsequent MRI demonstrated complete occlusion of the main portal vein, with cavernous transformation. The prominent early filling of the anterior branch of the right portal vein seen on the previous MRI examination was no longer present, indicating that the arterioportal fistula had resolved (Fig. 3). The hepatic veins were patent and showed no evidence of thrombus, but there were an increased number of small veins around the anterior branch of the right portal vein, indicating the development of collateral venous flow. As in the previous MRI, prominent esophageal varices were seen in the distal esophagus. As a result, elective endoscopic band ligation was performed for treatment. The patient was also referred for a hematologic evaluation and anticoagulation treatment, but the hematological workup was surprisingly negative for hypercoagulable states.

ct, computed tomography, mri, magnetic resonance imaging

PMC5852964_01

Female

The proband was a 63-year-old woman who suffered of a severe depressive episode at 46 years of age, then she slowly developed gait ataxia with falls and dysfunction of fine finger movements. She is the second child of unrelated Italian parents. The father died at 82 years of age with cognitive deterioration starting at 70; the mother is 87 years old and healthy. The patient has three healthy siblings and a son (34 years old) who is reported to suffer of epilepsy since his childhood and showing a wide-based gait in the last two years. When she was 54, the patient's relatives noticed personality changes (aggressiveness, hyperphagia, inappropriate shopping) and increased frequency of falls. Brain magnetic resonance imaging (MRI) showed bilateral and symmetric moderate atrophy of frontal and parietal cortex and clear atrophy of both cerebellum hemispheres and vermis. At that time a tentative diagnosis of olivo-ponto-cerebellar atrophy was made in another hospital. At 55 years of age neuropsychological tests (including Stroop color-word, Wisconsin Card Sorting, Rey auditory verbal learning, Clock drawing, Digit symbol, and Trail Making A and B tests) showed executive attention and visuospatial deficit. The mini-mental state examination (MMSE) score was 29/30. At the age of 59 the patient developed dysarthria. When she was 61 she suffered from generalized tonic-clonic seizures but the interictal electroencephalogram (EEG) was normal. There was progressive cognitive worsening and at the age of 62 the neuropsychological assessment showed deficit in verbal memory, language and attention, and the MMSE scored 15/30. The neurological examination showed moderate gait ataxia, dysdiadochokinesia and dysmetria, dysphagia, dysarthria and abnormal saccadic pursuit, severe axial asynergy during postural changes, choreiform dyskinesias involving upper limbs, face, and tongue. She had no muscle weakness or sensory deficits, deep tendon reflexes were normal and pyramidal signs were absent. At the time of the last examination when the patient was 63, she required assistance for everyday activities. Brain MRI showed advanced cerebellar atrophy, involving both hemispheres and vermis, with brainstem sparing (Fig. 1a). Brain single photon emission computed tomography (SPECT) using the Dopamine Transporter (DAT) ligand I-123 Ioflupane (DAT-SPECT) showed mild reduced uptake in left posterior putamen but was otherwise normal (Fig. 1b). F-18 Fluorodeoxyglucose positron emission tomography (FDG-PET) showed severely decreased glucose metabolism of both cerebellar hemispheres and putamen (Fig. 1c). The genetic analysis for HD, DRPLA and TBP was performed on genomic DNA extracted from peripheral blood sample by standard methods. The polymerase chain reaction (PCR) was performed by using the published primers and PCR products were separated by capillary electrophoresis ABIPrism 3130XL Genetic Analyzer. The size of each allele was established by comparison with control DNAs previously determined by direct sequencing.

incomplete penetrance, sca17, spinocerebellar ataxia, tbp gene

PMC5760869_01

Male

An 89-year-old nonsmoker male with the past medical history of hypertension, dementia, and benign prostatic hyperplasia presented with progressive worsening of shortness of breath for 5 months and mild cough with clear white color sputum. He denied any fevers, chills, weight loss, night sweats, or loss of appetite. On physical examination, he was alert and oriented, with normal vital signs. His SpO2 was 92% while breathing ambient air. Bilateral diminished respiratory excursion and faint bibasilar wheezing were noted on chest examination, and cardiac auscultation found no murmurs or irregularities. The blood cell counts, electrolytes, and renal and liver function tests were unremarkable and QuantiFERON-Tuberculosis Gold was negative. An arterial blood gas analysis showed pH 7.45, PCO233.9 mmHg, and PO268.1 mmHg on room air. Chest radiography showed right-sided pleural effusion [Figure 1], and computed tomography of the chest showed bilateral pleural effusion right greater than left, with atelectasis of RLL [Figure 2]. The patient underwent diagnostic and therapeutic right-sided pigtail catheter placement which drained serous exudative pleural fluid on Light's criteria with lymphocytic predominance. Pleural cultures and cytology were negative. Postpleural fluid drainage and repeated chest imaging showed right-sided unexpandable lung with pneumothorax ex vacuo and possible endobronchial lesion in the right middle lobe (RML) bronchus [Figures 3 and 4]. Subsequently, bronchoscopy was performed which showed narrowed RML bronchi with significant mucosal edema and a round smooth-bordered 3.0 cm endobronchial lesion at RLL bronchi not allowing the bronchoscope to pass beyond the lesion. Endobronchial biopsies, bronchoalveolar lavage, and cytological brushing were performed. RML biopsy showed chronic bronchitis and was negative for malignancy or granulomatous inflammation. RLL biopsy with Verhoeff's elastic staining showed plexus of elastic fibers parallel to basement membrane [Figure 5]. Immunoperoxidase staining on RLL showed the presence of elastic tissue as fibrillar amphophilic material which was centered around blood capillary vessels consistent with the diagnosis of bronchial elastosis [Figure 6]. The first cytology from pleural fluid was negative, and because of the patient's wishes, no further staging and intervention including bronchoscopy removal or surgical resection were performed. After physiological and clinical improvement, the patient was discharged in a stable condition to a long-term care facility.

Computed tomography of the chest postpigtail catheter drainage confirming right-sided unexpandable lung (red arrow) with possible endobronchial lesion in the right middle lobe bronchus (blue arrow).

PMC10202396_01

Male

A 13-year-old boy was referred to our hospital with complaints of high-grade fever, non-bilious, non-bloody projectile vomiting, light headedness, generalized weakness, reduced appetite and passing black-coloured urine. Prior to his admission, the child was febrile (40 C) with blood pressure of 110/40 mmHg (considered to be low as per guidelines of the National Institute of Health), along with thrombocytopaenia (28 000 mm-3 blood; normal: 1.5-4.5 mm-3 blood), low haematological parameters of haemoglobin (12.3 g dl-1; normal: 10-15.5 g dl-1), haematocrit (35.8 %; normal: 35-44 %), mean corpuscular volume (66.1 fl; normal: 80-95 fl) and mean corpuscular haemoglobin (22.7 pg; normal: 32-36 pg). Blood urea (62 mg dl-1; normal: 5-18 mg dl-1) and random blood sugar (204 mg dl-1; normal: 70-140 mg dl-1) levels were significantly raised. Peripheral blood smear examination was positive for P. vivax. Other tests such as Dengue (Non-structural protein 1) NS1, scrub typhus card tests, Widal test and COVID 19 reverse transcriptase (RT)-PCR were negative. Despite thrombocytopaenia, the child had no bleeding manifestations and was administered a first dose of intravenous artesunate and intravenous fluids. With the impending hypovolaemia, and persistent hypotension with an episode of loss of consciousness for 20 min, the child was referred to our hospital. He was afebrile, hypotensive (88/36 mmHg), with high pulse rate (110 bpm) and facial swelling. There was reduction in urine output of around 150 ml per day, but the oxygen saturation (SpO2) was well maintained. Liver was enlarged up to 2 cm below the right costal margin. Other systemic examinations were within normal limits. Upon laboratory investigations, his haemoglobin level was 11 g dl-1, with a low haematocrit (34.2 %), mean corpuscular volume (71 fl) and mean corpuscular haemoglobin (22.9 pg) values with platelet count of 36 000 mm-3 blood. Serum direct bilirubin and liver enzymes were elevated. Giemsa-stained peripheral blood smears revealed normal sized erythrocytes with microgametocytes containing malarial pigments (Fig. 1). Quantitative buffy coat (QBC) examination detected gametocytes of non-falciparum species. Blood sample was subjected to a multiplex nested PCR assay using published primers (Table 1), and an amplified product of 121 bp corresponding with P. vivax was detected by 1.5 % agarose gel electrophoresis using a molecular ladder of 100 bp (Thermo Scientific Gene Ruler 100 bp ladder) (Fig. 2). Buffer used for the agarose gel cast and running buffer in the gel electrophoresis tank was 10x Tris boric acid EDTA (TBE). The child was treated with injectable inotropes, intravenous fluids, oxygenation, the remaining two doses of artesunate and injectable antibiotics (ceftriaxone and vancomycin). Antibiotics were discontinued after malaria was reported. A repeat complete haemogram showed a fall of platelets to 19 000 mm-3 blood after 7 h of treatment, but the child became stable after 22 h with the same regimen and was discharged with advice to continue artemether-lumefantrine combination without any other drugs and/or antibiotics.

pcr assay, hypovolaemia, microgametocytes, morphological variations, vivax malaria

PMC9758553_02

Female

A 65-year-old Malay female with underlying hypertension, type 2 diabetes mellitus, chronic kidney disease stage 3A, history of ischaemic stroke 4 years ago and was semi-dependent for activities of daily living. She presented with complaints of dyspnoea of 1 year duration. Otherwise, she had no chest pain, no palpitation, no constipation, no weight gain. There was no history of pulmonary tuberculosis contact and no family history of malignancy. On physical examination, she had coarse, dry skin with slow mentation and obvious delayed relaxation of deep tendon reflexes. She was hemodynamically stable with blood pressure of 139/86 mmHg, absence of pulsus paradoxus or bradycardia (pulse rate 84 bpm). On auscultation, heart sounds were muffled. Respiratory examination was unremarkable. There was a 3 cm firm and mobile submandibular swelling with no goitre or surgical scar in the neck. Fine needle aspiration cytology of the submandibular swelling was performed and reported to have features of sialadenosis. Gynaecological assessment did not reveal any gynaecology pathology. Blood investigation showed severe hypothyroidism with FT4 3.4 pmol/L (11.5-22.7 pmol/L) and TSH 114.47 mIU/L (0.55-4.78 mIU/L). Her initial electrocardiogram showed low voltage complexes with electrical alternans. Chest radiograph showed massive cardiomegaly (Figure 4). Echocardiogram revealed large global pericardial effusion ranging from 1.2-3.9 cm but no collapse of right ventricular free wall in diastole with left ejection fraction of 65 % (Figure 5). A provisional diagnosis of primary hypothyroidism with massive pericardial effusion was made. She was commenced immediately on a single high dose 400 mcg levothyroxine followed by lower daily dose of 100 mcg (1.6 mcg/kg/dose) together with liothyronine of 10 mcg thrice daily. Her TSH decreased by half to 49.92 mIU/L (0.55-4.78 mIU/L), with FT4 of 8.3 pmol/L (11.5-22.7 pmol/L) after two days of combination therapy of levothyroxine and liothyronine, which subsequently normalized after one week of treatment, with TSH 4.65 mIU/L, FT4 of 10 pmol/L (Figure 1). Oral liothyronine was given for 10 days. Repeat echocardiogram did not show improvement in pericardial effusion and it was decided to proceed with pericardial tapping for diagnostic purpose. One litre of pericardial fluid was drained. Echocardiogram reassessment post tapping showed more than 50% reduction of pericardial effusion, ranging from 5-9 mm, no right ventricular chamber collapse during diastole, with ejection fraction of 69% (Figure 5). Pericardial fluid analysis was reported to be acellular with absence of organisms on gram stain and Ziehl-Neelsen stain for acid fast bacilli (AFB). Fluid biochemistry analysis showed normal total protein of 58 g/L (57-82 g/L) and lactate dehydrogenase of 128 U/L (120-246 U/L). There was no growth on bacterial and tuberculosis culture media of the pericardial fluid. Her electrocardiogram showed normal voltage complexes. Subsequently, the patient was discharged well with levothyroxine 100 mcg OD (1.6 mcg/kg/dose). During clinic review, she appeared well with no complaints of dyspnoea. Her thyroid function improved further and normalized at the second clinic visit with minimal pericardial effusion on echocardiogram reassessment.

hypothyroid, levothyroxine, liothyronine, pericardial effusion

PMC3896808_01

Male

Our patient is a 15-year old Caucasian basketball player with a well-established diagnosis of SJMS. In the age of five years he had a serious pulmonary infection with Mycoplasma Pneumoniae for which he had to hospitalize. After his exit from the hospital and up to the age of ten years he had repeated episodes of pulmonary infections with bronchitis and dyspnea. It was that time were the diagnosis SJMS was made due to bronchiolitis obliterans and resulting emphysema. The radiologic exams were unremarkable. Chest X- ray showed a hyperlucency on the left pulmonary field with the left lung being relatively smaller than the right. Upon lung function tests the child exhibited measurements of lung obstructive disorder with decreased forced expiratory volume in 1 sec (FEV1) and forced vital capacity (FVC) in relation to the normal value considering his age and somatometric parameters. Moreover, the ratio of (FEV1) to FVC (FEV1/FVC) was decreased, indicating airway obstruction. Pulmonary scintigraphy with 99mTc showed decreased perfusion of the affected lung mainly at the apex, whereas the right lung remained unaffected. The patient continued to exhibit recurrent episodes of bronchial infections up to the age of ten. Since then and for the next five years he remained asymptomatic. One year ago the patient was admitted in the emergency department complaining of sudden onset of dyspnea accompanied by pleuritic chest pain on the left side. He has been feeling well over the past days, was afebrile and reported no history of recent trauma. Auscultation revealed decreased breath sounds on the left. A chest X-ray followed revealing spontaneous pneumothorax on the left side. Immediate insertion of an 18 Fr thoracic chest tube in an apical position for the evacuation of air and the patient was transferred to the ward for further hospitalization. During the next few days the patient continued to exhibit significant amount of air in the underwater seal mainly during coughing and the chest X-rays showed that the pneumothorax still existed; although significantly decreased in size. Chest CT angiography followed showing an emphysematous bulla 3 cm in diameter in the left upper lobe with partially expanded lung and small remaining pneumothorax. Additionally, hyperlucency of the left upper lobe with decreased vascularity in concordance with SJMS were also present (Figures 1 and 2). Patient's underwater seal drain was changed and connected to negative suction in order to remove the remaining air and expand the lung. He remained on negative suction for the following seven days with no radiological or clinical improvement; therefore, surgical therapy was decided. Under general anaesthesia using double lumen endotracheal tube, VAT- bullectomy of the left upper lobe was carried out through 3 access ports that were 5.5, 5.5- and 20-mm in diameter. Bovine pericardial sleeve used to buttress and reinforce the staple line. Apical pleurectomy just over 5 cm followed to achieve mechanical pleurodesis. Postoperatively patient's underwater seal continued to remain connected to mild negative suction (10-15 cmH2O) for five days in order to accomplish full pulmonary expansion since he was emphysematous with associated obstructive bronchiolitis and decreased pulmonary elasticity. No postoperative air leak was observed. During his stay we observed minimal apical space when the patient was off suction. Therefore we decided to connect the intercostal drain to a one flutter valve bag (Portex bag) and we discharge him home to optimize his mobilization and treat the minimal apical space. The chest drain was on the 15th postoperative day. Chest X ray after removal showed fully expanded pulmonary parenchyma. One year postoperatively he is in excellent clinical condition and able to cope fully with his basketball activities. No recurrence of spontaneous pneumothorax is observed.

CT scan angiography in our patient with SJMS, showing remaining pneumothorax with presence of apical emphysematous bulla in the left lung (arrow). Note hyperlucency of the upper pulmonary lobe in comparison to the lower.

PMC3896808_01

Male

Our patient is a 15-year old Caucasian basketball player with a well-established diagnosis of SJMS. In the age of five years he had a serious pulmonary infection with Mycoplasma Pneumoniae for which he had to hospitalize. After his exit from the hospital and up to the age of ten years he had repeated episodes of pulmonary infections with bronchitis and dyspnea. It was that time were the diagnosis SJMS was made due to bronchiolitis obliterans and resulting emphysema. The radiologic exams were unremarkable. Chest X- ray showed a hyperlucency on the left pulmonary field with the left lung being relatively smaller than the right. Upon lung function tests the child exhibited measurements of lung obstructive disorder with decreased forced expiratory volume in 1 sec (FEV1) and forced vital capacity (FVC) in relation to the normal value considering his age and somatometric parameters. Moreover, the ratio of (FEV1) to FVC (FEV1/FVC) was decreased, indicating airway obstruction. Pulmonary scintigraphy with 99mTc showed decreased perfusion of the affected lung mainly at the apex, whereas the right lung remained unaffected. The patient continued to exhibit recurrent episodes of bronchial infections up to the age of ten. Since then and for the next five years he remained asymptomatic. One year ago the patient was admitted in the emergency department complaining of sudden onset of dyspnea accompanied by pleuritic chest pain on the left side. He has been feeling well over the past days, was afebrile and reported no history of recent trauma. Auscultation revealed decreased breath sounds on the left. A chest X-ray followed revealing spontaneous pneumothorax on the left side. Immediate insertion of an 18 Fr thoracic chest tube in an apical position for the evacuation of air and the patient was transferred to the ward for further hospitalization. During the next few days the patient continued to exhibit significant amount of air in the underwater seal mainly during coughing and the chest X-rays showed that the pneumothorax still existed; although significantly decreased in size. Chest CT angiography followed showing an emphysematous bulla 3 cm in diameter in the left upper lobe with partially expanded lung and small remaining pneumothorax. Additionally, hyperlucency of the left upper lobe with decreased vascularity in concordance with SJMS were also present (Figures 1 and 2). Patient's underwater seal drain was changed and connected to negative suction in order to remove the remaining air and expand the lung. He remained on negative suction for the following seven days with no radiological or clinical improvement; therefore, surgical therapy was decided. Under general anaesthesia using double lumen endotracheal tube, VAT- bullectomy of the left upper lobe was carried out through 3 access ports that were 5.5, 5.5- and 20-mm in diameter. Bovine pericardial sleeve used to buttress and reinforce the staple line. Apical pleurectomy just over 5 cm followed to achieve mechanical pleurodesis. Postoperatively patient's underwater seal continued to remain connected to mild negative suction (10-15 cmH2O) for five days in order to accomplish full pulmonary expansion since he was emphysematous with associated obstructive bronchiolitis and decreased pulmonary elasticity. No postoperative air leak was observed. During his stay we observed minimal apical space when the patient was off suction. Therefore we decided to connect the intercostal drain to a one flutter valve bag (Portex bag) and we discharge him home to optimize his mobilization and treat the minimal apical space. The chest drain was on the 15th postoperative day. Chest X ray after removal showed fully expanded pulmonary parenchyma. One year postoperatively he is in excellent clinical condition and able to cope fully with his basketball activities. No recurrence of spontaneous pneumothorax is observed.

CT scan angiography of the same patient. Note the decreased vascularity of the left lung with hyperlucent upper lobe and presence of apical bulla. The left lung is smaller in comparison to the right.

PMC4837135_01

Female

A 55-year-old woman presented with prominence of the nasal bones and difficulty in wearing eyeglasses for 3 months. Eighteen months earlier, she had presented to the dermatology clinic with skin lesions on extremities in a different hospital. Two punch biopsies from skin lesions were performed, and results of the histopathologic examination revealed noncaseating granulomatous inflammatory reaction. She had multiple cervical lymph nodes on the left side, with the largest being 16 x 8 mm. An excisional cervical lymph node biopsy was taken in the same hospital, and results of a histopathologic examination revealed caseating granulomatous inflammatory reaction. Results of a tuberculin skin test was also reported to be positive (10 mm) at that time. It was ascertained that the patient had been vaccinated. Unfortunately, no microbiologic analysis of the excised lymph node had been performed. Results of a sputum sample were negative for acid-fast bacilli. Based on the histopathologic finding of caseating granulomas, she was diagnosed as having tuberculosis of the skin and cervical lymph nodes, and received antituberculosis treatment (rifampicin 600 mg, isoniazid 300 mg, pyrazinamide 1500 mg, and ethambutol 1000 mg per day for 2 months, followed by 10 months of therapy with rifampicin 600 mg and isoniazid 300 mg per day). Cervical lymph nodes resolved, but no remission of skin lesions was reported by the patient, despite 1 year of therapy. Results of a physical examination revealed diffuse nontender swelling over the nasal bones, which caused disfigurement of the bony nasal dorsum. There were no skin changes over the mass (Fig. 1). The nasal cavity and septum were normal except for mild crusting on the left inferior turbinate mucosa. There were no palpable lymph nodes in the neck, but there was a scar at the previous lymph node biopsy site. Results of the remainder of the head and neck examination were normal. Ultrasonography of the neck was also normal. There were multiple papular skin lesions on the upper and lower extremities (Fig. 2). Paranasal sinus computed tomography (CT) showed destruction of the nasal bones, with soft-tissue increase (Fig. 3). Because of her history, the patient was initially suspected to have tuberculosis that was affecting the nasal bones; however, skin lesions unresponsive to antituberculosis therapy and histopathologic demonstration of noncaseating granuloma in previous skin biopsy specimens raised the question about the former diagnosis of "skin tuberculosis." We reevaluated the previous data of the patient. We obtained the pathologic slides of the excised cervical lymph node and stained for acid-fast bacilli; the results of staining were negative. Further workup was carried out for the differential diagnosis of sarcoidosis which is the major cause of noncaseating granuloma. A chest radiograph indicated bilateral hilar adenopathy, which was then confirmed by a CT of the chest. There also were parenchymal nodular lesions on a CT of the chest. She had no pulmonary symptoms. Pulmonary function test results also were within normal limits. The patient was admitted with a presumptive diagnosis of sarcoidosis versus tuberculosis, and incisional biopsy was done transnasally through and intercartilaginous incision with the patient under general anesthesia. Histologic examination results showed noncaseating epithelioid cell granulomas. Tissue samples also were provided for microbiologic assessment. Results of staining for fungi and acid-fast bacilli were negative. Results of a polymerase chain reaction test and culture for mycobacterium also were negative. Further workup for sarcoidosis revealed no ophthalmologic, renal, or cardiac involvement. Laboratory test results showed no specific evidence of any other disease. Serum and urine calcium and angiotensin-converting enzyme levels were normal. The patient was diagnosed with sarcoidosis and was started on prednisolone (40 mg/day) and hydroxychloroquine (400 mg/day). The therapy resulted in dramatic improvement of nasal bone, pulmonary, and skin lesions within 2 weeks (Fig. 4).

PMC6911250_01

Male

A 62-year-old patient was referred to a rheumatologist with complaints such as increasing body temperature up to 37.1-37.3 C, gnawing pains in the epigastric region, worsening at night, weight loss of 15 kg for the last 4 months, lack of appetite, fatigue and general weakness. From the anamnesis it is known that during the last 4 months the patient suffered from pain in the epigastric region, and lack of appetite occurred without any apparent cause. Due to these complaints esophagogastroduodenoscopy (EGDS) was performed and revealed signs of chronic gastritis and also epithelial cell damage and regeneration with minimal inflammatory changes described as gastropathy. In the histopathological results minimal polymorphonuclear leukocyte infiltration with mononuclear cell infiltration was found. Helicobacter pylori was excluded. There were no pathological findings in abdominal ultrasound examination. The patient had been treated by a gastroenterologist with domperidone 10 mg twice daily and bismuth subcitrate 240 mg twice daily, but this treatment was inefficient and the symptoms did not improve. The patient started to take nimesulide on his own, which positively influenced the abdominal pain. Abdomen and pelvis computed tomography (CT) was performed and revealed signs of MP, so the patient was referred to a rheumatologist. In the patient's medical history only common colds and childhood infectious diseases were reported. From 2006, arterial hypertension occurred and was treated with ramipril and nebivolol. In 2018, increased glycemic levels were observed and diabetes type 2 was diagnosed. However, in the treatment a diet without any hypoglycemic drugs was sufficient. According to the patient's information, no previous history of tuberculosis, infections such as virus hepatitis (A, B and C) or any allergic reactions was noted. The physical examination revealed only pain in the epigastric area during abdominal palpation, temperature 37.0 C. There were no other evident abnormalities in the physical examination of the cardiovascular and musculoskeletal system, lungs or skin assessment. The cardiac assessment using echocardiography did not reveal any significant disturbances; only due to arterial hypertension left ventricular hypertrophy was found, and the left ventricular ejection rate (LVEF) was 56%. Stool and diuresis were normal. No peripheral edema was observed. A blood test was performed and all results are presented in Table I. In computed tomography (CT) imaging performed in spiral mode with 1 mm steps, an area of fatty tissue induration was found, enveloping the arterial trunk like a cuff and partially surrounding the upper mesenteric artery without any signs of narrowing of lumens, with approximate dimensions of 36 mm x 16 mm. At this level, a single celiac lymph node with a maximum size of 17 mm x 9 mm is observed. The stomach was rather stretched by the fluid, but there were no signs of pathological thickening of the walls. The fat tissue surrounding the loops of the small intestine - visualized in a collapsed state - was not changed. The colon was inflated with gas, the walls of the loops were not thickened, paracolitic fatty tissue was not changed, and nor were the liver and intrahepatic ducts. The gallbladder is not enlarged in size, with homogeneous contents. X-ray positive calculi were not found, the gallbladder walls were not changed. The common bile duct was not dilated. The portal vein was not dilated. The lymph nodes of the porta hepatis were not swollen. The pancreas was not enlarged, the head 26 mm, body 10 mm, tail 8 mm. The gland structure was homogeneous, and the parenchyma at the level of the body and tail was atrophic. The pancreatic duct is not dilated. Parapancreatic fiber is not changed. The area of the major duodenal papilla is without changes. The spleen is not enlarged, uniform structure, normal density. The adrenal glands are typically located, of uniform structure. The kidneys are typically located, of normal size and shape. The parenchyma of the kidneys is not thinned. Cortico-medullary differentiation of the parenchyma is retained, its contrasting without peculiar properties. The hollow system of the kidneys is not dilated. The abdominal aorta and iliac arteries are atherosclerotically altered. Retroperitoneal lymph nodes are not enlarged. The prostate gland is 36 mm x 44 mm in size, with homogeneous structure, of normal density. Surrounding fiber is not changed. Seminal vesicles are without peculiar properties. The bladder is of normal size and shape. X-ray positive calculi in the lumen are not defined. The walls of the bladder are not thickened; surrounding fiber is not changed. Pelvic lymph nodes and inguinal lymph nodes are not enlarged. Conclusion: CT signs of mesenteric panniculitis. Taking into account the data listed, the clinical diagnosis of mesenteric panniculitis was established based on the imaging picture and clinical signs. The disease activity was determined taking into account clinical and laboratory parameters. In the clinical case presented, the prevalence of moderately severe clinical symptoms in the clinical picture with the absence of any significant changes in laboratory tests made it possible to determine the activity of the 1st degree. Due to MP diagnosis therapy with methylprednisolone 8 mg per day and pantoprazole 40 mg/day was administered, and the patient also continued antihypertensive drugs. Rheumatologist, endocrinologist and cardiologist supervision was recommended at the place of the patient's residence. On the background of conducted therapy after 2 months of treatment the temperature returned to the normal range, appetite improved, and weakness decreased. The main symptom, epigastric pain, disappeared.

computed tomography, mesenteric panniculitis, rheumatic diseases

PMC4677577_01

Female

A 57-year-old woman presented to our primary care clinic with tender, subcutaneous nodules on her right ankle and right thigh of 2 months duration. The lesions had begun as 1-2 mm reddish papules that progressed into 2-3 cm nodules. She denied insect bites, local trauma, or the use of new cosmetic products. The previous month she had visited our emergency department complaining of the lesions, and she was at that time treated for presumed cellulitis with a 7-day course of clindamycin, without improvement. Her medical history consisted of well-controlled asthma. Her only medication was inhaled albuterol. She had received a Bacille Calmette-Guerin vaccine during childhood. She had emigrated from China 20 years ago. Her husband had been successfully treated for pulmonary tuberculosis 30 years ago. She herself had never received a diagnosis of latent or active tuberculosis. She had no history of substance abuse. Physical examination revealed three dusky, reddish, ill-defined, edematous subcutaneous nodules (2-3 cm) proximal to her right medial malleolus (Fig. 1). The lesions were slightly tender and cool to touch. There were subcentimeter lesions of similar appearance scattered along the medial right thigh. There was no lymphadenopathy. The remainder of the physical examination was normal. Bacterial and fungal infections, vasculitis, thrombophlebitis, erythema nodosum, and sarcoid were considered in the differential diagnosis. A complete blood count, basic serum chemistry, and erythrocyte sedimentation rate were normal. Serum complement levels and serologies for antineutrophil cytoplasmic antibodies, antineutrophil antibodies, and rheumatoid factor were normal. Antibodies to hepatitis B and C and HIV were negative. A plain film of the chest was normal. The excisional biopsy of one of the lesions revealed granulomas in the subcutaneous fat, surrounded by fibrosis and reactive changes (Fig. 2). At this point, cutaneous tuberculosis was suspected. An interferon gamma release assay was positive for M. tuberculosis, signifying infection. However, mycobacterial staining and culture of tissue for acid-fast bacilli (AFB) were negative. Polymerase chain reaction (PCR) applied to the tissue failed to detect M. tuberculosis DNA. Bacterial and fungal cultures of tissue were also negative. A CT scan of the thorax to evaluate for occult pulmonary tuberculosis was normal. We decided to treat the patient for presumptive cutaneous tuberculosis because of the histopathologic findings of granulomas in the setting of the patient's immigration from an endemic area, history of exposure to active tuberculosis (spouse), and positive interferon gamma release assay. Eight weeks after beginning treatment with pyrazinamide, rifampin, ethambutol, and isoniazid, the lesions had completely resolved. The patient received a total of 9 months of treatment and has had no recurrence during 3 years of follow-up.

cutaneous tuberculosis, erythema induratum of bazin, mycobacterial skin disease, primary care of vulnerable populations, tuberculids

PMC2892707_01

Male

A 34-year-old man without symptoms was referred to our hospital to clarify an abnormal chest radiograph showing a nodular pulmonary lesion. He was currently without symptoms, but had been treated two years prior for tuberculosis after presenting with mild fever, nonproductive cough, and a five-pound weight loss. There were no comorbidities and the patient denied a history of smoking. Physical examination revealed no abnormalities. The chest radiography revealed a well-circumscribed mass in the left lung. CT scans demonstrated a mass with irregular borders, measuring approximately 6 cm in diameter, located in the upper segment of the lower lobe of the left lung. The mass was heterogeneous with hypodense areas and amorphous calcifications. No mediastinal lymphadenopathy was observed (Figure 1). Pulmonary function tests revealed a mild obstructive ventilatory disturbance. Laboratory data, including rheumatoid factor and antinuclear body, were normal. Bronchoscopy was normal and mycobacterial and fungal cultures of bronchoalveolar lavage fluid were negative. Cytological evaluation was negative for malignant cells. CT-guided percutaneous transthoracic fine needle aspiration cytology of the pulmonary lesion was nondiagnostic. There was no evidence of bacterial or fungal organisms in the collected sample. An open lung biopsy revealed a mass in the upper segment of the lower lobe of the left lung and fibrous exudate, which was adhered to the pleural surface. The histopathological findings mainly consisted of deposition of hyaline tissue masses accompanied by sparse lymphocytic infiltrate (Figure 2). There was no histological evidence for infectious agents such as TB and fungal organisms. These features were consistent with a diagnosis of pulmonary hyalinizing granuloma. The patient received no subsequent specific treatment and he remained asymptomatic. There was no increase in the size of the mass as of the last outpatient followup, which was performed two years after diagnosis.

PMC3513844_01

Male

A 19-year-old male collegiate football player presented to the emergency department (ED) with persistent neck pain following an injury at practice. The contact occurred during a blocking drill and reportedly forced his neck into hyperextension. Upon impact, he immediately experienced high cervical neck pain localized to the left side of his neck, although over time this pain became more generalized. The patient was removed from play, and on the sidelines, no weakness or sensory abnormalities were noted on his examination. The pain was exacerbated with palpation at the base of the skull and did not radiate. Cervical range of motion with rotation, flexion, extension, and lateral flexion was limited secondary to pain. The patient had persistent pain later in the evening, not relieved with analgesics and rest, and was ultimately instructed to go the ED for further work- up and evaluation. In the ED, he had continued complaint of neck pain; however, he remained neurologically intact and denied numbness, paresthesias, or weakness on initial evaluation. Of note though, later that evening in the ED, the patient transiently experienced subjective numbness in his left lateral forearm in an ulnar distribution that later spontaneously resolved. He was an otherwise healthy individual with a medical history significant for one "stinger" in the past that completely resolved. Plain films revealed no acute fracture or dislocation [Figure 1]. A computed tomography (CT) scan of his cervical spine demonstrated absent bony fusion of the anterior midline synchondrosis, as well as the midline posterior arch of the C1 bony ring [Figure 2a-c]. The osseous components had well-developed cortical margins, strongly suggesting that the midline discontinuities were not the result of trauma. The patient additionally underwent magnetic resonance imaging (MRI) of the cervical spine that demonstrated prominent edema in the pre-vertebral soft tissues extending from the level of the clivus to the vertebral body of C5 [Figure 3a]. Images at the level of the C1 bony ring demonstrated edema of the paramedian ventral soft tissues at, above, and below the level of the unfused anterior midline synchondrosis [Figure 3b and c]. No ligamentous disruption was identified. The patient's overall clinical picture and imaging findings were consistent with a cervical sprain/strain with an incidental finding of a congenital bipartite atlas. Given his persistent neck pain, tenderness, and findings of pre- vertebral soft tissue swelling, the patient was advised to remain in a rigid cervical collar until seen in follow- up 1 week later. He was treated symptomatically with non- steroidal anti-inflammatory drugs (NSAIDs) and a muscle relaxant. He was temporarily removed from contact drills, but was cleared to ride a stationary bike and to do isometric neck strengthening with the athletic training staff, while remaining in the collar. Follow-up 1 week later revealed diminished tenderness and increased range of motion. Flexion/extension radiographs were obtained and demonstrated no evidence of instability or misalignment. The patient was allowed to resume usual activity and his cardiovascular training regimen with symptomatic restrictions. We opted to wait until his MRI findings resolved, prior to resuming contact activity. Repeat MRI of his cervical spine approximately 1.5 months following the injury demonstrated complete resolution of the pre-vertebral swelling and hyperintensity, and an unchanged appearance of the unfused anterior midline synchondrosis. Even after having a discussion with the patient regarding the uncertain future risk for cervical spine injury and was demonstrated understanding the potential consequences, he desired to continue playing. Given the absence of any signs of instability, the patient was cleared to fully return-to-play. He resumed contact activity, both practice and game-time play, without further issues and continues to remain asymptomatic.

bipartite atlas, cervical spine, neurological sports medicine, return-to-play, spine anomaly

PMC3975196_01

Female

A 58-year-old African-American female presented to a hospital emergency room with a superotemporal marginal corneal ulcer of the left eye two clock hours in length, with mild corneal thinning. Uncorrected visual acuity on the initial exam was 20/30 in the right eye and 20/50 in the left. Both eyes showed diffuse punctate corneal epitheliopathy in the palpebral fissure. Her past medical history included alcohol use since the age of 14, serious alcoholism since the age of 34, and chronic pancreatitis and diarrhea since the age of 52. She reported that she drank 6-12 beers per day. She had a smoking history of >50 pack-years as well as a history of gastrointestinal bleed, liver cirrhosis, cholecystectomy, chronic obstructive pulmonary disease, and anaphylactic reaction to peanuts. She had lived in urban USA since birth. After corneal culture, the patient was started on hourly topical moxifloxacin 0.5% eyedrops in the left eye as well as artificial tears in both eyes. Culture was positive for alpha-hemolytic streptococcus and catalase-positive Gram-positive cocci in groups with preliminary identification as coagulase-negative Staphylococcus. She returned 3 days later, with an unchanged exam except for mild injection of the right eye, and was maintained on the same antibiotic drops but with an increase in artificial tears in the right eye. Three days after that (6 days after the initial visit), she presented to an outpatient office with bilateral marginal corneal ulcers (fig. 1, fig. 2, fig. 3), both with a thinning >50% and parallel to the limbus. The left eye also had a small hypopyon. Uncorrected visual acuity was 20/40 right, 20/80 left. She did not complete workup or treatment and was lost to follow up for over 1 week. She returned to the emergency room 17 days after initial presentation, with a complaint of bilateral severe vision decrease and painful swelling of the left lower lid of 2 days duration. She was hospitalized at that point. On admission, vision was hand motions in both eyes. The right eye had deep marginal thinning for 6 clock hours inferiorly. The left cornea had a marginal area of deep stromal thinning temporally for 5 clock hours, and the inferior lid showed tender erythema and edema. Diffuse severe bilateral corneal edema and hypopyon (1.5 mm in the right eye and 1.0 mm in the left eye) were present. B-scan ultrasound of the fundus of both eyes was unremarkable. After corneal culture, the patient was placed on bilateral topical ocular application of fortified vancomycin eyedrops (25 mg/ml) every hour (for Gram-positive coverage) and moxifloxacin 0.5% eyedrops every hour (for Gram-negative coverage). Cultures from admission grew Pseudomonas aeruginosa and Staphylococcus hominis from the right eye and Staphylococcus warneri and Staphylococcus lugdunensis from the left eye. On the third day of hospitalization, when culture results were available, the eyedrops were changed to fortified vancomycin every 2 h and fortified tobramycin (14 mg/ml) every 2 h. Tobramycin was started because of its potency against Pseudomonas. The presence of three Staphylococcus species in the cultures warranted continuation of the vancomycin eyedrops, but we decreased the frequency to every 2 h around the clock to reduce epithelial toxicity and patient stress. The left lower lid cellulitis did not yield any material for culture, but the patient received IV cefazolin (1 g every 8 h) for 2 weeks with resolution of the cellulitis. Due to the severe corneal ulceration, bilateral amniotic membrane grafts (AmbioDisk; IOP Ophthalmics, Costa Mesa, Calif., USA) with an overlying 16.0-mm Kontur bandage contact lens (Kontur Kontacts, Hercules, Calif., USA) were placed on the fourth day of hospitalization. A urinary tract infection found during hospitalization was culture-positive for vancomycin-resistant Enterococcus and was treated with linezolid. Testing revealed a marked vitamin A deficiency, with a level of 0 mug/dl (reference range 18-77). Vitamin A analysis was performed by LabCorp using high performance liquid chromatography. The patient had mild protein malnutrition with total protein 6.5 g/dl (reference range 6.6-8.7). Her BMI was 21.4 (normal range 18.5-25). Laboratory analysis showed hypokalemia, hyponatremia, hypomagnesemia, and hypocalcemia. Testing ruled out HIV, tuberculosis, syphilis, sarcoidosis, rheumatoid arthritis, hepatitis A, B, C, and Wegener granulomatosis. The ANA titer was elevated (40) with a fine speckled pattern, but not to the level of significance (80). Sjogren syndrome testing for SS-A/Ro, SS-B/La, Smith antibody, and ribonucleoprotein antibodies were all negative by microparticle multiple immunoassay. Erythrocyte sedimentation rate and C-reactive protein were normal. Intramuscular vitamin A was not available, so it was repleted with 100,000 IU orally for 3 days, followed by 50,000 IU orally every day for 2 weeks. After initial treatment of the infections and after ruling out systemic tuberculosis, systemic steroids were given (IV methylprednisone starting at 50 mg daily and tapered over 2 weeks). The patient also received thiamine, folate, ascorbate, calcium, vitamin D, multivitamins, topical cyclosporine 0.05% eyedrops, and intensive eye lubrication. The patient's diarrhea, pancreatic enzyme deficiencies, electrolyte abnormalities, and protein malnutrition were treated, and she received extensive nutritional and alcoholism counseling.

kocuria palustris, peripheral ulcerative keratitis, rothia mucilaginosa, vitamin a deficiency

PMC6010620_01

Male

A 62-year-old African-American male smoker initially presented to the emergency department with acute sharp retrosternal pain that worsened with deep inspiration. He denied shortness of breath, fever, chills, chest trauma, sick contacts or recent travel. He worked as a custodian at a dairy factory and had no pets. His past medical history was notable for latent tuberculosis treated ten years prior. His physical examination revealed ectopic beats, but was otherwise normal. Laboratory studies demonstrated a normocytic anemia and elevated CRP (142 mg/L), normal troponin, complement levels, and negative ANA and ANCA. ECG showed diffuse elevation of ST segments in the precordial leads. Chest radiography was unremarkable. Computed tomography angiogram of the chest showed ground glass pulmonary nodules as well as a small pericardial effusion and pericardial enhancement. The initial concern was for pericarditis. Echocardiogram disclosed a reduced left ventricular ejection fraction of 38%, and a small circumferential pericardial effusion, without evidence of cardiac tamponade or constriction. Cardiac magnetic resonance imaging disclosed a thickened pericardium which enhanced on post contrast imaging suggesting active inflammation. He was presumptively diagnosed with viral myopericarditis and treated with colchicine. Two weeks later, the patient again presented to the emergency department, this time with dyspnea. He was found to be hypoxemic, and chest radiography revealed a new large right-sided pleural effusion (Fig. 1). A thoracentesis was performed with 2700 mL of dark amber fluid removed; evaluation of the pleural fluid revealed an exudative effusion. Gram stain and bacterial cultures were negative. Cytology did not reveal malignant cells. Cell differential demonstrated 2119 cells: 49% neutrophils, 18% lymphocytes, 24% monocytes/macrophages, and 7% mesothelial cells. Glucose was 105 mg/dL, and pH was 7.39. Echocardiogram was notable for newly found constrictive physiology. Left ventricular ejection fraction was 43%. After discharge, his pleural effusion re-accumulated rapidly, requiring multiple large volume thoracenteses over the next few weeks. Repeat pleural fluid cytology remained negative. Given the recurrent unilateral pleural effusion and unrevealing fluid analysis, he underwent medical thorascopic pleural biopsy. Operative findings revealed scattered areas of fleshy nodularity involving the diaphragm and posterior sulcus, most consistent with fat (Fig. 2). Unexpectedly, pleural biopsies were consistent with high-grade pleural epithelioid angiosarcoma. Immunoperoxidase studies showed reactivity to CD31, FLI-1, AE1/3, OSCAR, WT-1, and D2-40 (Fig. 3). Staging PET scan (Fig. 4) revealed malignant FDG-PET avidity of the pericardium, with a loculated pericardial effusion (SUV max 16.1). It also showed FDG activity in the right pleural effusion, right iliac bone, left shoulder soft tissue, and bilateral pulmonary nodules. A few hours after the PET scan, he presented to the Emergency Department with a near-syncopal episode, and was found to be in shock. Electrocardiogram revealed ST-segment abnormalities concerning for acute myocardial infarction. The patient went into pulseless electrical activity arrest. Despite chest compressions, intravenous epinephrine, and emergent pericardiocentesis, the patient did not regain a pulse. Family requested cessation of resuscitation efforts, and the patient passed. Autopsy was declined.

epithelioid angiosarcoma, pericarditis, pleural effusion

PMC4763575_01

Male

A 38-year-old male patient, diagnosed with retroviral infection and disseminated tuberculosis presented with weakness and numbness of the right hand of 2 weeks duration. He also noticed an edematous reddish raised lesion on the inner aspect of right hand, which he attributed to the topical agent he used for relieving the numbness. Pain was present on the right elbow and forearm. The patient had been on antitubercular therapy (ATT) followed by antiretroviral therapy (ART), 5 months prior to presentation at our department. The CD4 count was 67 cells/muL during initiation of HAART. Dermatological examination showed a single well-defined erythematous plaque, 20 x 5 cm with raised borders on the ulnar aspect of right hand and distal forearm, extending to the palm [Figures 1 and 2]. A satellite lesion was present on the upper part of forearm, which also showed erythema and edema. All modalities of sensations were lost in these lesions. Both ulnar nerves were thickened with tenderness on the right side. Slit skin smears from the earlobe, lesional, and normal skin were negative. Histopathological examination showed dermal edema, diffuse granulomas composed of Langhans type giant cells, surrounded by epithelioid cells, lymphocytes, multinucleated giant cells, and fibroblasts with perivascular lymphocytic infiltrate, consistent with Hansen's disease borderline tuberculoid type, with features suggesting type 1 lepra reaction [Figures 3-6]. AFB stain was negative. CD4 count after 5 months showed a rise to 160 cells/muL. The viral RNA load was not measured due to lack of facilities. Thus correlating the clinical, bacteriological, and histopathological features, a diagnosis of Hansen's disease borderline tuberculoid with type 1 lepra reaction presenting as IRIS was made. MB-MDT was started, avoiding rifampicin from the regimen, as patient was also on ATT. HAART was continued and systemic steroids were also given in tapering doses. On follow up there was marked alleviation of his symptoms. However, the patient succumbed within 3 months to a brain tuberculoma.

borderline tuberculoid hansen's disease, hiv infection, immune reconstitution inflammatory syndrome, type 1 lepra reaction

PMC7119359_02

Unknown

The common cold is the most common reason that patients visit physicians. More lost school days occur because of the common cold than all other causes combined. The common cold is the most frequent upper respiratory tract infection (URI). Wald et al studied the usual duration of community-acquired viral URI and the incidence of complications (otitis media/sinusitis) of these URI in infancy and early childhood. Children in daycare were found to be more likely to have protracted respiratory symptoms than children in home care. The mean duration for a single URI ranged from approximately 7 days (for 1-2 year olds in home care) to approximately 9 days (for children younger than 1 year old in daycare). The percentage of simple URIs lasting more than 15 days ranged from 6.5% (for 1-year-old to 3-year-old children in home care) to 13.1% (for 2-year-old to 3-year-old children in daycare). Symptoms of the common cold include sneezing, rhinorrhea, cough, mild sore throat, congestion, low-grade fever, and malaise. Acetaminophen, oral fluids, rest, and saline nose drops with gentle suction are the only treatments generally recognized as safe and partially effective. Symptoms usually abate in 5 to 7 days. When a child begins to recover and develops localized pain such as earache, chest, throat or facial pain, increased irritability or lethargy, decreased oral intake, high fever, a new purulent nasal discharge, difficulty breathing, or night and day cough, complications such as pharyngitis, sinusitis, otitis or lower respiratory tract infection should be suspected. The real challenge is to distinguish between recurrent or persistent colds that need more time and complications that require medical intervention. Cough can persist after viral URI for several reasons. A patient occasionally may develop a dry, tic-like, irritative cough that may be present for days or weeks. Presumably the viral infection has irritated the airways and stimulates the cough receptors. Passive or active smoke inhalation may stimulate the cough receptors further. Removing environmental irritants and the passage of time may be the only modalities effective for this difficult cough. After the URI, the next most common cause of chronic cough is caused by asthma. Cough variant asthma is an occult form of asthma in which the only sign or symptom is chronic cough. It is a problem among all age groups that may go unrecognized. A trial of oral or inhaled bronchodilators with a spacer in young children and a metered-dose inhaler in older children is warranted in patients with or without wheezing and persistent cough after a laboratory evaluation excludes other, more complex, albeit less common, causes. Oral bronchodilators are considered for those children too young to use a spacer or for those for whom the cost of a home nebulizer would be prohibitive. As many as 5% of acute URIs are complicated by an acute infection of the paranasal sinuses. Persistent nasal discharge and chronic cough usually are caused by infections of the ethmoid or maxillary sinuses. These sinuses are present at birth, with frontal and sphenoid sinuses forming later. Inflammation from infectious and allergic processes may lead to obstruction of the sinus ostia and predispose to secondary bacterial infection. Drainage from the sinuses stimulates the cough receptors. The most common organisms for bacterial sinusitis are Streptococcus pneumoniae, Moraxella catarrhalis, and Haemophillus influenzae Bronchitis is a term used by parents and physicians. Unfortunately, this is a nebulous term without a clearly defined set of signs or symptoms. The term does not imply a specific cause, a treatment, or a prognosis. Because a significant degree of overlap exists between colds and asthma, the term bronchitis generally should be avoided and replaced with a more specific diagnosis. Because URIs and asthma have causes other than bacteria, antibiotics usually are not indicated. Most chronic coughs fall into one of the three aforementioned categories: persistent or recurrent URI, reactive airway disease, or sinusitis. Despite the frequency of these diagnoses, other less common causes need to be remembered to avoid inappropriate reassurance or treatment. By considering the age of the child and the clinical circumstances, precise diagnosis can be achieved. In the infant younger than 3 months of age, the triad of staccato cough, tachypnea, and conjunctivitis should raise the question of chlamydia pneumonia. Tuberculosis or fungal infections may be seen in children and present as a chronic, hoarse cough thought to be caused by airway compression secondary to enlarged perihilar or paratrachial nodes. Pertussis starts with 2 weeks of mild rhinorrhea and cough before progressing to the characteristic paroxysms of cough or posttussive vomiting. Loud, brassy cough following a viral URI associated with attention seeking behavior and "la belle indifference" may indicate a psychogenic or habitual cough. Foreign body aspiration should be considered at every age, especially in the toddler. Even an esophageal foreign body can produce a chronic cough by pressing on the posterior pharynx. Overfeeding, a dysfunctional swallowing mechanism, gastroesophageal reflux and bottle propping can cause chronic aspiration, thereby producing chronic cough. Other less common causes of chronic aspiration are congenital abnormalities such as tracheoesophageal fistula, laryngeal cleft, and adductor vocal cord paralysis. Immune deficiency diseases can present with prolonged respiratory symptoms or multiple pneumonias. HIV has become an important cause of immune deficiency in children. Unusual opportunistic infections such as Pneumocystis carinii pneumonia can be seen, but the most common manifestation of HIV disease in children is recurrent bacterial infection such as otitis media or pneumonia that usually responds temporarily to a standard antibiotic regimen. Lymphocytic interstitial pneumonia can complicate HIV infection and may persist with a nonproductive chronic cough, respiratory distress, failure to thrive, and pulmonary infiltrates. Inability to mechanically clear mucus from the respiratory tract may cause trapping of foreign material and lead to chronic cough. Patients with cystic fibrosis present with cough, failure to thrive, and recurrent lower respiratory tract infections often secondary to pseudomonas. These patients produce a thick, tenacious sputum that is difficult to clear from the airway. In the immotile cilia syndrome, an abnormality in the mucocilary apparatus results in frequent respiratory infections. Other less common congenital problems causing chronic cough include any condition in which a large, aberrant, thoracic structure compresses the airway. Examples of this include anomalous great vessels, bronchogenic cysts, or pulmonary sequestration. A simple URI can produce respiratory compromise in these conditions in addition to tracheobronchomalacia in which the central airways are soft and collapse more easily. Few published reports detail the psychogenic cough. It generally is not thought of as rare, however. This cough is characterized as croupy and explosive. It never occurs during sleep and is not affected by antitussives. It usually is regarded as a respiratory tic and can be precipitated by various stimuli such as school phobia, attention seeking, or anxiety. Cough is a reflex response of the respiratory tract to irritants in the form of mechanical, inflammatory, chemical, or thermal stimuli. Dust, smoke, and foreign bodies are common types of mechanical stimuli, whereas extrinsic compression from tumor, lymph nodes, or enlarged anatomic structures is uncommon. Inflammation activates cough receptors because of hyperemia and edema of the mucous membranes. Organic compounds as well as acidic and basic vapors irritate receptors in the smaller airways. Inhalation of hot or cold air may stimulate cough where there is an underlying pathologic condition of the respiratory tract. A reflex is a reproducible, neurally mediated response to a stimulus. In general, the components of a reflex arc include the peripheral sensory receptor, afferent pathway, cough center, and motor response unit. From the respiratory tract, the afferent pathway is mainly via the vagal and superior laryngeal nerves. The cough center is in the medulla. The afferent pathway is mainly via the phrenic and intercostal nerves. The motor unit is the diaphragm and intercostal musculature. The larynx, carina, and bifurcations of large bronchi are especially sensitive to mechanical stimuli, whereas the terminal bronchioles and alveoli are more sensitive to chemical stimuli. Interestingly, cough receptors also are found in the pharynx, external auditory canal, and stomach. If cerumen impinges on the eardrum, a chronic cough can be triggered and will persist until the canal is disimpacted of the cerumen. Air is inspired into the lungs. The air then is entrapped in the lungs by the closure of the epiglottis and the vocal cords. The abdominal muscles contract quickly and forcefully against the diaphragm in conjunction with contraction of the internal intercostal muscles. The pressure within the lungs rises sharply. An explosion of air occurs when the epiglottis and vocal cords open. The common cold is a mild and self-limited syndrome caused by a viral infection of the mucosa of the upper respiratory tract. The symptoms are well known and include sneezing, rhinorrhea, sore throat, and cough. The rhinovirus and the coronavirus cause up to 45% of all colds. Assorted other viruses such as influenza, parainfluenza, respiratory synctial virus, and adenovirus account for another 10% to 15%. Transmission appears to be via respiratory droplets and hand-to-hand contact. Self-inoculation then occurs on the conjunctival or nasal epithelium. The respiratory mucosa becomes hyperemic and edematous. With the onset of inflammation, the cough receptors are stimulated and the reflex is initiated. Asthma is characterized by airway obstruction that is reversible. Reduction in airway diameter is caused by smooth muscle contraction, epithelial inflammation, and mucous secretion into the lumen. Here too, the inflammation triggers cough receptors. Production of cough in sinusitis is via two mechanisms. The postnasal drip into the pharynx associated with sinusitis serves as a mechanical stimulus, whereas the hyperemia of respiratory epithelium serves as an inflammatory stimulus. The history is of importance in determining the cause of persistent cough. Attention first should be directed at the symptom itself, eliciting duration and descriptive qualities of the cough as well as associated symptoms. Indicators of serious illness should be identified next. Identifying the age of the child will help to narrow the differential diagnosis. A more general history then may be obtained, including a prenatal and feeding history in the case of an infant. Growth and development, childhood illnesses, exposures, operations, injuries, hospitalizations, immunizations, medications, allergies, and psychosocial and family history also are necessary. Access to medical care for the child and the health belief system of the family, when evaluated, often will elicit enlightening and useful information. Determining the duration of the cough is critical in sorting out persistent cough from recurrent cough. A frustrated parent may present with their child stating "Johnny has been coughing all winter!" On questioning, many of these chronic coughs will turn out to be a series of separate URIs not caused by a single pathophysiologic process.

PMC7119359_03

Unknown

Once it has been established that the cough is indeed persistent for more than 3 weeks, characteristics of the cough may be noted. A cough productive of purulent sputum usually indicates an infectious cause from a bacterial or viral source. A productive cough usually occurs in children only after the age of 4 or 5 years old. A productive cough at a younger age should raise the examiner's index of suspicion for cystic fibrosis in the toddler age group of tracheoesophageal fistula or gastroesophageal reflux in infants. Viral infections tend to be recurrent. Bacteria that cause chronic cough include Chlamydia, Mycoplasma, Bordatella pertussis, and Mycobacterium tuberculosis. A cough producing thick, tenacious sputum may be associated with cystic fibrosis. A dry, brassy, or stridorous cough may be associated with upper airway disease caused by foreign body aspiration, laryngitis, or laryngotracheobronchitis (croup). Paroxysms of cough are found in pertussis, cystic fibrosis, and foreign body aspiration. A paroxysm of cough followed by a whoop is the classic presentation of whooping cough caused by B. pertussis. The whoop rarely is seen in infants. A productive throat clearing indicates a postnasal drip associated with sinusitis. The staccato cough is associated with chlamydia pneumonia. A psychogenic cough that usually presents as dry and brassy may be bizarre, with a honking or barking quality. A cough associated with a wheeze is likely caused by asthma (Table 1) Timing of the cough also carries certain implications. Cough that occurs with feeding implies aspiration and possibly a congenital abnormality. Reflux and overfeeding would be the more common cause in the infant, whereas tracheoesophageal fistula or laryngeal cleft are uncommon. A child who just enters daycare likely will experience an increased frequency of URIs, whereas seasonal variations may indicate an allergic cause. A temporal relationship to an irritant such as smoke or an allergen such as a pet may be established. Nighttime cough may signal reactive airway disease or sinusitis with recumbent postnasal drip. Cough that disappears with sleep should raise concern of a psychogenic cause. Cough that is worse on awakening may imply cystic fibrosis or bronchiectasis. Cough associated with exercise may be caused by exercise-induced asthma, cystic fibrosis, and bronchiectasis and rarely may suggest heart disease or extrinsic airway compression. An associated symptom such as hemoptysis raises the concern about such diseases as pulmonary tuberculosis, cystic fibrosis, bronchiectasis, or possibly foreign body aspiration. Headache, malodorous breath, and nasal discharge may signify a chronic sinusitis. Prolonged fever associated with weight loss indicates a more serious cause such as HIV infection. Persistent fever Failure to grow or gain weight Clubbing Purulent sputum Hypoxemia Refractory chest radiographic infiltrates Hemoptysis The critical element of the physical examination is the general clinical impression. Does this child appear healthy, ill, or toxic? The signs and symptoms of serious disease should be considered early in the evaluation: With a URI, the child will appear mildly ill and have no significant fever. Rhinorrhea and pharyngeal erythema may be present, but the examination otherwise should be benign. In a child with reactive airway disease, URI symptoms may be present in addition to audibly harsh respirations, a prolonged expiratory phase, and wheeze. Musical rales may be present. A barrel chest suggests a chronic problem. The liver and spleen may be palpable because of hyperinflation of the lungs. Nasal polyps are suggestive of atopy. Sinusitis in children is estimated to be a complicating factor in 5% to 10% of all URIs. Because children average six to eight colds per year, sinusitis is a common condition in primary care. Sinusitis typically presents with a nasal discharge of any quality (thin to thick and clear to purulent). The cough usually is present by day but is usually worse at night. Halitosis (bad breath) may be present. Facial pain and headache are useful indicators only after the age of about 10 to 12. Painless morning eye swelling may be noted by the parent in the school-aged population. Fever, if present, is usually low grade. The infant with tracheoesophageal fistula often will have early respiratory distress, cyanosis, excessive secretions in the oropharynx, and cough with feeding. Splinting may be seen as well. Tracheobronchial compression by anomalous or enlarged vessels causes an infant to have noisy breathing and a cough. The infant may attempt to optimize the airway by assuming an opisthotonos position. Children between the ages of 6 months to 4 years are at particular risk of aspiration of foreign bodies. The initial response is usually gagging, coughing, and wheezing. If the foreign body has been allowed to remain, however, distal obstruction, mucous production, and inflammation may obstruct the airway, causingatelectasis or an infiltrate. Decreased breath sounds over the affected lung with inspiratory rhonchi and expiratory wheezing are found. Inspection for stigmata of allergic disease will reveal a pale, boggy nasal mucosa, clear rhinorrhea, allergic shiners, and the nasal crease. Chronic illness presents with generalized signs such as poor weight gain. Scattered diminished breath sounds, cyanosis, and digital clubbing are late signs of cystic fibrosis. Tobacco abuse may be identified by the smell of tobacco or by nicotine stains, whereas sniffing glue and other substances may produce a clouded sensorium.

PMC8702971_01

Female

Male and female patients from 15 to 65 years old, with complaints of ankle giving away for the last 6 months, and clinical findings of lateral and medial instability were included. Individuals needed to undergo a minimum of 6 months of nonoperative treatment to qualify for surgery. Existence of previous surgery, autoimmune diseases, neuropathy, inflammatory disease, isolated medial instability, progressive collapsing foot deformity, previous ankle infiltration, radiographic findings of ankle arthritis, cavovarus deformity, coagulopathies, a body mass index higher than 35, and site infection were exclusion criteria. Associated injuries, such as osteochondral lesions, syndesmosis instability, tendon ruptures, and fractures also excluded subjects from this research. From March 2018 until January 2020, a total of 29 patients (30 ankles) were operated with MAI diagnosis. The mean participant age was 38.0 (SD 12.1), 48% were male (14/29), and women comprised 52% (15/29). Follow-up average was 14.8 (SD 6.9) (Appendix). Lateral ankle instability was defined as the existence of giving-away symptoms associated with both maneuvers, anterolateral drawer and varus stress. Medial instability in this multidirectional scenario was established by the presence of at least 1 of the clinical or arthroscopic findings below: anteromedial drawer or ankle valgus stress in the preoperative clinical assessment; an open book lesion at the medial malleolus, the ability to insert a 5-mm probe in the medial corner of the ankle, or the ability to insert a 5-mm probe at the medial clear space (between the medial surface of the talar body and the articular surface of the medial malleolus) in the arthroscopic evaluation. Physical examination for multidirectional instability was performed with the patient sitting with both limbs hanging, physician seated in front. Anteromedial drawer was executed by holding the lateral distal leg with one hand while the other embraced the medial calcaneus and talar region (index finger at the posterior tuberosity, thumb at the talar neck), producing an anterior movement combined with external rotation. Stress valgus was performed with one hand stabilizing the lateral distal leg while the other embraced only the calcaneus (thenar area at the calcaneus medial region, hypothenar area at the calcaneus lateral region), producing a valgus/eversion moment to the hindfoot. Any subjective asymmetry among ankles (millimeters for the drawer, degrees for the stress) determined the respective maneuver as positive. For the arthroscopic diagnosis, an "open-book" lesion at the medial malleolus, as described by Vega et al, was considered an indication of multidirectional instability. This finding corresponds to the proximal detachment of the superficial deltoid ligament (tibionavicular band) and explains the rotational component of this instability. Besides, introduction of a 5-mm probe through the medial ankle corner or across the medial tibiotalar space were also considered signs of medial involvement in a multidirectional instability. These assessments were performed by inserting the probe from the anteromedial portal whereas the visualization was carried from the anterolateral portal. Previous nonoperative treatment consisted of at least 6 months of regular physical therapy focusing on global stretching, calf/intrinsics muscle strengthening, and balance training. Surgery was indicated if baseline symptoms persisted and was carried out by 4 fellowship-trained orthopedic foot and ankle surgeons, 2 with more than 20 years and 2 with less than 10 years of experience in the area. After anesthesia and operative site preparation, traditional anterolateral (AL) and anteromedial (AM) arthroscopic portals were performed. A 4.5-mm (70-degree) scope was used to clean the joint and assess possible associated injuries. Necessary adjuvant procedures were executed before the ligament repair (Appendix). AL and AM impacts were resected when needed. Lateral and medial instability were confirmed arthroscopically, and ligament repairs performed starting laterally. A traditional arthroscopic Brostrom was performed, using an anchor and suture passers as previously described. Sutures were passed but not tightened (Figure 1). A medial anchor was inserted at the medial malleolus, in the quadrant described by Vega et al (Figure 2). Sutures were passed respecting the safe zone illustrated by Acevedo et al. The ankle was positioned in neutral (no posterior drawer) and the lateral sutures tightened with arthroscopic knots. Finally, the medial repair was finalized by tightening the deltoid sutures with the ankle still in neutral position (Figure 3). Portals were closed and a dressing applied. Patients were put in a walker boot and remained nonweightbearing for 1 week. By the end of this first week, patients were evaluated, and progressive weightbearing began. The boot was worn until the fourth week, when it was replaced by a rigid ankle brace. This orthosis was used until the sixth week and then progressively removed (used for sports until the fifth month). Physical therapy was started at the second postoperative week (no inversion, eversion, or rotation until the sixth week) and patients were allowed to return to practice (or baseline activities) in a light manner after 3 months. Full return to competitive activity was allowed by the fifth postoperative month (Figure 4). Patients were assessed primarily for function through the American Orthopaedic Foot & Ankle Society (AOFAS) Hindfoot Score. Secondary outcomes included pain using the visual analog scale (VAS) and complications. Assessments occurred preoperatively (by 1 week before intervention) and at the 5-month postoperative follow-up. Complications were recorded as dehiscence, neural damage, infection, and rerupture. Dehiscence was defined as inability to heal the skin by the fourth postoperative week. Peripheral nerve damage was defined as hypoesthesia or paresthesia not resolved by the end of the sixth month after the surgery. Infection was defined as clinical signs of infection or pus drainage of the wound requiring the use of antibiotics. Rerupture was classified as an ankle sprain during the follow-up. After collecting the information, we characterized the variable normality of the qualitative variables through the Kolmogorov-Smirnov test. For relationship between qualitative variables analysis, the Two Proportion Equality Test and the Spearman Correlation were used. Comparison among times of the study was performed with the Wilcoxon test.

ankle injuries, collateral ligaments, joint instability, lateral ligament

PMC4153186_01

Male

A sixty-six year-old, non hypertensive, non diabetic, heavy alcoholic male who was a known smoker for 20 years, presented with a rapid enlargement in the anterior lower part of the neck along with gradual swelling of upper chest (sternal area) which developed within 3 weeks (Figure 1). At presentation, he reported easy fatigability and generalized weakness. He also had anorexia but minimum difficulty in deglutition of solid food for the last week along with hoarseness of voice. He mentioned weight loss during the last one month. The patient did not have any symptom of hypothyroidism, hyperthyroidism or upper respiratory symptoms due to external compression. He had no previous history of long term medicine intake, pulmonary tuberculosis, contact with a TB patient or any surgical interventions. Bowel and bladder habits were normal. He was alert, conscious and co-operative. On physical examination, he had a firm goiter associated with enlarged firm and fixed cervical lymph nodes. He had both sided enlarged supraclavicular lymph nodes (2.5cmx2.5cm) which were firm and non tender. Left lobe of thyroid was enlarged, lobulated and firm. There was a hard, non tender mass over manubrium of sternum with a size of 8cmx5cm, fixed to skin and underlying bone. Breath sounds were normal over both sides. His blood reports: Hb 12 g/dl, total leukocyte count 12,500, fasting blood sugar 101, urea 33 mg%, creatinine 0.80 mg%, serum sodium 136 mEq/L, potassium 4.42 mEq/L, LDH 447 U, total bilirubin 0.17, SGPT 25 U, SGOT 13 U, ALP 68 U, total protein 6.9 gm/dl, albumin 3.0 gm/dl, and globulin 3.9 gm/dl. Tests of thyroid function were within the normal range. No feature of upper airway obstruction was noted. Thyroid and cervical ultrasound examination revealed enlargement of the left lobe of thyroid with a heterogeneous and hypoechogenic pattern and a focal lesion. Fine needle aspiration cytology (FNAC) was performed from the thyroid (Figure 2), pre-sternal mass (Figure 3) and the abnormal lymph nodes (Figure 4) and metastatic squamous cell carcinoma was found. Cytological samples did not reveal characteristics of thyroid-derived malignant neoplasms. Immunostaining was negative for thyroglobulin, calcitonin, TTF1, K 5-6, and CK20. Computed tomography (CT) scan of the neck (Figure 5) and chest revealed a left thyroid lobe mass and destruction of the sternum resulting in a prominent swelling in front of the chest. There was no evidence of a lung cancer. Upper gastrointestinal endoscopy demonstrated one ulcerative growth at thirty cm distance from the incisor teeth involving full circumference of mucosa suggestive of a malignant neoplasm. Biopsy from the ulcer showed squamous cell carcinoma (Figure 6). Vocal cord examination revealed diminished movement of left vocal cord. He had increasing weight loss, dysphagia, poor appetite, and difficulty maintaining his caloric needs. As surgical debulking was not possible, external beam radiation therapy of the neck and upper mediastinum was planned along with combination chemotherapy. Unfortunately, the general condition of the patient deteriorated quickly, and the patient died before definitive therapy can be instituted.

esophageal carcinoma, squamous cell carcinoma, sternal deposit, thyroid metastasis

PMC6556260_01

Female

A 47-year-old previously healthy female presented with generalised body swelling, disproportionate ascites, loss of appetite, and loss of weight for four months' duration. She denied any fever, night sweats, yellowish discolouration of the eyes, hematemesis, melena, chronic cough, and haemoptysis. She reported no history of orthopnoea and paroxysmal nocturnal dyspnoea, and her urine output remained normal. Her past medical history was not significant for any liver, renal, or cardiac disease. She denied any past or contact history of TB. She reported no use of alcohol or herbal medications and no intravenous drug abuse. She was in a monogamous relationship and she denied any family history of liver or renal disease. She was afebrile on admission and her vitals included a pulse rate within normal limits. On exam, she was emaciated with a body mass index of 18, and she had significant ascites with mild ankle oedema. She was anicteric and did not have any lymphadenopathy, hepatosplenomegaly, or the peripheral stigmata of chronic liver disease. Respiratory system and cardiovascular examinations were within normal limits. On eye exam, there was no evidence of choroid tubercles. The initial laboratory findings are summarised in Table 1. The anaemia workup, including serum iron studies, vitamin B12, and folate testing, was normal. A blood picture revealed normochromic normocytic anaemia and thrombocytosis, suggestive of anaemia of chronic disease. Thyroid function tests were normal. She did not have any proteinuria, and her international normalised ratio (INR) was normal. Repeated blood cultures, urine culture, and sputum culture were sterile, and a human immunodeficiency virus (HIV) fourth-generation test was negative. CA 125 was mildly elevated to 175 U/ml (<46 U/ml). The initial chest x-ray (CXR) was normal, and her transthoracic two-dimensional echocardiography showed normal systolic and diastolic functions and no evidence of constrictive pericarditis. A transvaginal ultrasound (US) did not reveal any ovarian pathology. Meanwhile, an abdomen US revealed a mildly hyperechoic liver with moderate ascites. Contrast Enhanced Computed Tomography (CECT) of the abdomen and pelvis revealed a normal-sized liver with evidence of heterogenicity of the liver parenchyma with minimal nodularity of the liver surface and moderate ascites with no portal vein thrombosis or lymphadenopathy. The spleen, gallbladder, biliary tract, and intestines were normal, as were the ovaries. The findings were in favour of possible decompensated chronic liver disease (CLD). However, the CLD workup did not reveal any potential aetiology (Table 2). Upper gastrointestinal endoscopy (UGIE) was normal and did not show any evidence of portal gastropathy or varices. The initial diagnosis of possible cryptogenic CLD was made, and the patient was started on spironolactone and furosemide. Even though the diagnostic paracentesis was planned on admission, it was delayed due to the patient's refusal, but we were to do initiate after a few days. The analysis of the ascitic fluid revealed an exudative picture. There was no evidence of spontaneous bacterial peritonitis, and the ascitic fluid cytology was negative for malignant cells. With elevated inflammatory markers and an exudative type of ascites, we decided to proceed with further investigations to rule out possible peritoneal TB. The ascitic fluid acid-fast bacilli (AFB) test was negative. The ascitic fluid bacterial, TB culture, and TB Gene Xpert were negative. The tuberculin sensitivity test (Mantoux) was positive at 17 mm without ulceration. Her repeated sputum for AFB, TB culture, and GeneXpert were negative. Because the clinical picture did not fit the imaging findings, we decided to proceed with diagnostic laparoscopy and peritoneal biopsy. The laparoscopy was in favour of miliary TB (Figure 1) and the peritoneal biopsy revealed granulomatous inflammation with caseous necrosis favouring TB. She was started on anti-TB treatment (ATT), and on initial follow-up, she showed improvement in her clinical, biochemical, and radiological parameters. Her fever settled with ATT, and her ESR was 15 mm/1st hour and CRP was 12 mg/l at 3 weeks after the initiation of ATT.

PMC7227742_01

Male

A 32-year-old male who had been working in a cement-manufacturing facility for 6 years (and had stopped a year ago due to illness) presented with complaints of dry cough for the past 1 year with progressively worsening shortness of breath over a period of 6 months. The shortness of breath was exertional and had progressed rapidly over the past 1 month. He also complained of low-grade fever every day for the past 1 month. There was no history of weight loss, loss of appetite, or of contact with tuberculosis. On examination, he was found to be tachypneic with a respiratory rate of 30 breaths per minute and a pulse rate of 120 per minute with pulse oximetry revealing an oxygen saturation of 84%. His blood pressure was 112/76 mm Hg. Chest auscultation revealed fine bi-basal crepitations. On presentation, he was anemic with hemoglobin of 11.9 mg/dL with normal leukocyte and platelet counts. His arterial blood gas report [Table 1] showed Type 1 respiratory failure. His chest X-ray was suggestive of bilateral diffuse infiltrates in the middle and lower zone. High-resolution computed tomography (HRCT) chest image revealed calcified mediastinal nodes with centrilobular nodules in upper lobes along with areas of interlobular septal thickening with fibrosis, a right-sided pleural effusion, and ground glass opacities seen in bilateral upper and lower lobes. [Figure 1a and 1b] He was suspected to have a lower respiratory tract infection on a background of silica-induced lung disease. However, blood and sputum cultures were negative. He was empirically given multiple antibiotics along with noninvasive positive pressure ventilation support. A fiberoptic bronchoscopy was done on high flow oxygen. The gross appearance of the bronchoalveolar lavage (BAL) fluid was normal and cultures sent for BAL fungal, bacterial, tubercular, and Pneumocystis jirovecii workup were negative. Endobronchial biopsy showed only exogenous pigment in the mucosal cells due to pneumoconiosis. The patient then underwent a computed tomography (CT) guided-biopsy during which he developed worsening of shortness of breath, right-sided chest pain, and absent breath sounds on the same side. Chest X-ray showed a right-sided hydropneumothorax. A right-sided intercostal drain was inserted and this drained fluid which was opaque with a reddish hue [Figure 2]. Biochemical examination revealed an elevated triglyceride level of 898 mg/dL -suggestive of a chylothorax. A lymphangioscintigraphy was planned to identify the cause of the chylothorax but was deferred till stabilization of the patient's condition. The patient's condition initially improved after intercostal drainage with improvement in shortness of breath. However, he subsequently developed high-grade fever from the 5th day of CT-guided biopsy with worsening respiratory failure and new infiltrates on the chest X-ray. The patient also had new onset shock refractory to fluids and maximal inotropes. He was resuscitated as per the institutional protocol and antibiotics were added. Despite best efforts, the patient succumbed to septic shock due to the hospital-acquired pneumonia within 72 h. The transthoracic lung biopsy [Figure 3] showed revealed anthracofibrosis with alveolar proteinosis.

accelerated silicosis, chylothorax, silicoproteinosis

PMC4900102_01

Female

A 42-year-old asymptomatic Turkish woman, para 2, presented with areas of focal fibroglandular asymmetry in the right breast on screening mammography. There was no personal or family history of breast carcinoma. She delivered her last child 4 years before presentation and had breastfed continuously for 2 years. Sonographic evaluation revealed oval, well-defined, benign-appearing isoechoic-hypoechoic masses suggestive of fibroadenomas, at 6, 9, and 10 o'clock (Fig. 1). The lesion in the 6 o'clock subareolar location was palpable to the breast surgeon. Ultrasound-guided core biopsies of all three lesions were performed. The pathology results were benign, with the pathology from the palpable lesion at 6 o'clock remarkable for findings of benign breast tissue with marked inflammation, multinucleated giant-cell reaction, and abscess formation. As the patient was asymptomatic, and the imaging appearance was not concordant with an acute abscess, the pathologic findings were thought to represent a chronic process. Clinical followup was the agreed-upon course of management. Five weeks later, the patient returned with erythema, swelling, and drainage of purulent fluid through several skin ulcers and fistulas in her right breast. These findings began a few days following the core biopsies (Fig. 2). Antibiotic treatment for postbiopsy mastitis was initiated. Ultrasound revealed a 5cm complex fluid collection with sinus tracts centered between the 6 o'clock and the 9 o'clock positions (Fig. 3). Fluid aspirated from the collection was negative for malignant cells or bacterial growth. As the mastitis worsened, methicillin-resistant Staphylococcus aureus (MRSA) was considered. The patient was switched to the appropriate broad-spectrum antibiotics. Repeat aspiration did not reveal any organisms. Evaluations for tuberculosis and sarcoidosis were negative. As the swelling, erythema, and fistula formation persisted, the decision was made to undergo surgical debridement. Surgical pathology revealed marked non-necrotizing granulomatous inflammation, predominantly periductal in location, with an exuberant acute and chronic organizing inflammatory response. The patient's clinical condition improved markedly following the debridement.

PMC4823493_01

Female

The female neonate was born after gestational age of 38 weeks and 2 days with an elective caesarian section due to an antenatal diagnosis of congenital omphalocele in the second trimester, with an Apgar score 8 at the 1st minute and 9 at the 5th. This firstborn neonate weighted 2.800 gr at birth and presented a giant omphalocele containing the whole liver and part of the large and small intestine (Figure 1). The rest of the physical examination was normal with no cardiovascular anomalies. The newborn was admitted to the neonatal intensive care unit and was supported with mechanical ventilation using sedation and muscle relaxation for the first 4 days of life. In the second postnatal day the patient underwent the first operation with excision of the hernia sac, complete reduction of the viscera into the peritoneal cavity, and abdominal wall closure without any traction, after identification and separation of the skin from the fascia and debridement of the margins. The early primary closure technique seemed successful and the neonate was in a stable condition postoperatively. An infection was noted on the 7th postoperative day due to colonization of a peripherally inserted central venous catheter with staphylococcus epidermidis. The neonate was dismissed from the pediatric surgery clinic after nursing for a month with no feeding or other problems.

PMC3700488_01

Male

The patient described here is a 64-year-old Japanese male with a past history of low anterior resection for rectal cancer at age 55, and a polypectomy for a colonic polyp at age 58. Family history was unremarkable. The patient has smoked 10 cigarettes per day and consumed 4 go (0.72 L) of shochu (a Japanese distilled spirit, 25% alcohol by volume) per day for 40 years. The patient has presented symptoms of muddy diarrhea since approximately January 2011, and visited a local doctor upon losing 4 kg of weight. A blood test revealed anemia and hypoproteinemia (hemoglobin: 6.7 g/dL, albumin (Alb): 3.2 g/dL), while a gastrointestinal (GI) endoscopy found multiple polyps in the stomach, duodenum, and large intestine. The patient therefore began attending the Digestive Disease Center at our hospital from March 2011. Multiple polyps found by lower GI endoscopy, combined with the presence of associated symptoms (alopecia, onychatrophia, pigmentation, and dysgeusia), resulted in the diagnosis of CCS (Figure 1). A histopathological examination revealed the gastric lesions to be hyperplastic polyps, and the small and large intestine lesions to be inflammatory polyp. The base of the polyp and adjacent mucosa showed extensive edema and increased eosinophils in the lamina propria mucosa and dilated glands. These are typical histological features of CCS polyps. Hypoproteinemia caused due to liver cirrhosis and nephrotic syndrome was excluded because liver dysfunction, ascites, and proteinuria were not observed. Steroid treatment was not conducted due to the following factors: the patient was a heavy drinker, there was a possibility that the hypoproteinemia had not been corrected, and the patient had previously tested positive for tuberculosis with the QuantiFERON test, which put him at risk for recurrence. During observation, the patient was therefore administered H2 blocker orally. Regular follow-up examinations revealed multiple gastric cancers and multiple colon adenomas, at which point the patient was admitted to our hospital for additional treatment in January 2012. A blood test revealed hypoproteinemia and undernutrition (total protein (T.P.): 5.08 g/dL, Alb: 3.08 g/dL, cholinesterase (CHE): 102 U/L), as well as abnormalities in trace elements (Fe: 18 g/dL, Zn: 60 g/dL, Ca: 8.12 mg/dL, P: 2.32 mg/dL). Immunoglobulin values, IgG (887 mg/dL) and IgE (1150 IU/mL) were high, while IgA (189 mg/dL) and IgM (82 mg/dL) were within normal limits. Carcinoembryonic antigen (CEA), a tumor marker, increased slightly from 5.0 to 7.6 ng/mL. An upper GI series found a dense growth in the stomach of small protrusions 10 mm or less, including 10-25 mm type 0-I lesions primarily in the gastric antrum, and type 0-IIc+III lesions in the gastric angle in the lesser curvature (Figure 2). Upper GI endoscopy found no abnormalities in the esophageal mucosa; however, large and small diffuse inflammatory polyps were found from the antrum cardiacum to the descending limb of the duodenum. Several 12-20 mm large protruding lesions indicative of type 0-I lesions were also found in the gastric antrum in the greater curvature, the posterior wall, and the pylorus in the posterior wall, which led us to suspect well-differentiated adenocarcinomas (Figure 3). Endoscopy of the small intestine revealed large and small inflammatory, partially villous polyps accompanied by oblong gland ducts with low duct density for 100 cm, from Bauhin's valve to the oral end. No polyps were found in the jejunum. Endoscopy of the large intestine revealed approximately 50 large and small inflammatory polyps with rugged surfaces predominantly in the right side of the colon (Figure 4). Polypectomy was performed on 4 lesions that were diagnosed as adenomas in a biopsy taken at the time of the large intestine endoscopy. Of these 4 lesions, 2 were at the location of gland duct growth indicating neoplastic change on part of the mucosal epithelium, which in turn indicates hyperplastic change; these were diagnosed as low-grade tubular adenomas (Figure 5). A total gastrectomy was performed on the gastric lesions, because there was a possibility of cancer lurking in other polyps, and if the polyps were not removed, they may have become cancerous. Intraoperative findings included scattered melanoid pigmentation on the mesentery and the small intestinal wall. Large and small polyps were present in the surgical margin of the duodenum. Blinding the surgical margin would have resulted in the possibility of an anastomotic leak, thus making regular observation of duodenal polyps difficult. Therefore, we used the double tract method for reconstruction (Figure 6). The postoperative pathological report found atypical gland duct growth, inflammatory cell infiltration primarily into lymphocytes, and 4 gastric cancer lesions. All of these lesions were well-differentiated adenocarcinomas. The main lesion was well-differentiated tubular adenocarcinoma, intermediate type, 10x20 mm in size, invading submucosal layer (sm2), positive lymphatic invasion (ly1) and negative vascular invasion (v0). The tumor showed expanding growth and a distinct border with the surrounding tissue (Infiltration Alpha). No metastasis to the lymph nodes was observed (n0/52). Tumor cells were positive through full thickness for p53 and Ki67 and partially positive for MUC5AC and MUC2 (Figures 7 and 8). In addition, pathological examination detected Helicobacter pylori infection. The patient was discharged from the hospital 18 days after surgery with no postoperative complications.

cronkhite-canada syndrome, colon adenoma, gastric cancer

PMC6304509_01

Female

A 19-year-old Omani female not known to have any significant medical history was referred to our hospital with a history of upper abdominal discomfort more localized to the epigastric region and associated with jaundice and dark urine. There was no history of fever or night sweat nor history of travel. On physical examination, the patient was jaundice; otherwise, the systemic examination was unremarkable. Complete blood count was within normal limits with a normal white blood count (6.3 10*g/L). Liver function test revealed a picture of obstructive jaundice with a total bilirubin of 52 umil/L, Alkaline phosphatase 302 [iU] /L, and Alanine transaminase 457 [iU]/L. QuantiFERON-Tb gold test was positive. CT scan of the abdomen and pelvis showed a lobulated and heterogeneous liver hilar mass with a central necrosis, measuring 2.4 x 3.9 cm. The mass was obstructing the proximal common hepatic duct resulting in dilatation of the intrahepatic biliary tree (Figure 1). The mass was associated with multiple enlarged peripancreatic, porta hepatis and hepatoduodenal lymph nodes, measuring up to 1.2 cm. None of the lymph nodes were showing central necrosis. Features were suggestive of a cholangiocarcinoma of the common hepatic duct. Further work-up with a liver MRI redemonstrated the porta hepatis mass. The mass was T2 hyperintense and T1 hypointense and showed moderate enhancement on postcontrast sequence with severe diffuse restriction (Figures 2 and 3). On MRCP, the mass was causing severe narrowing of the proximal 1.8 cm of the common hepatic duct, reaching the confluence and causing moderate dilation of the intrahepatic biliary tree. In addition, the MRI revealed multiple foci of restriction scattered throughout the liver and some of them showed subtle enhancement on postcontrast sequence suggestive of liver microabscess (Figure 3).Constellation of MRI findings was suggestive of localized TB of the porta hepatis; however, neoplastic lesion such as rhabdomyosarcoma and lymphoma could not be excluded and further evaluation with a tissue biopsy was advised. Chest radiograph was normal. Tumor markers were within normal limits including Cancer Ag 19-9 (CA 19-9): 8U/mL (range, 0-37U/mL), Carcinoembryonic antigen (CEA): 1.2 ug/L (range, 0-3ug/L), Alpha fetoprotein: 1.1 ug/L (range 0-15), and Chromogranin A: 47ug/L (range 26-92ug/L) The patient underwent laparoscopic biopsy and was found to have enlarged porta hepatis lymph nodes. Biopsy was taken from the porta hepatis mass and histopathological examination showed a granulomatous inflammatory process. Although, no definite proof was obtained by culture or polymerase chain reaction (PCR), probable TB diagnosis was made based on the histological and imaging findings, and the patient was treated for 6 months with Rifampicin 150 mg and Isoniazid 75 mg. The patient showed significant response to treatment with dramatic improvement of liver function test. A follow-up liver function test 3 months after starting anti-TB medication showed normalization of Alkaline phosphatase 91 [iU] /L along with improvement of total bilirubin of 24 umil/L and Alanine transaminase 211 [iU]/L. After completion of anti-TB medication, liver function test was back to normal with a total bilirubin of 17 umil/L, Alkaline phosphatase 58 [iU] /L, and Alanine transaminase 16 [iU]/L. A follow-up CT abdomen was performed 10 months later and showed complete resolution of porta hepatis mass and intrahepatic biliary dilatation along with significant regression of previously noted enlarged upper abdomen lymph nodes.

PMC4198776_01

Male

A 15-year-old high school football player initially presented to his primary care physician complaining of episodic headaches, total body stiffness, and severe nausea and vomiting for several days following participation in a football game. Viral meningitis was suspected, so the patient was started on oral prednisone. Of note, the patient had experienced mild back pain during the week preceding the game and was using ibuprofen for pain management. Symptoms gradually resolved over the next two weeks and the patient returned to baseline clinical status before resuming athletic activities. Following participation in a subsequent football game, the patient was admitted to the hospital with recurrence and exacerbation of his previous symptoms. At this time, his headache was localized to the left side, body stiffness was most pronounced in the posterior thighs and lower back, and nausea and vomiting were persistent. The patient denied a recent history of fevers and had no evidence of neck stiffness. Neurological exam was unremarkable other than a mildly unsteady gait and did not reveal any focal deficits. Clinical workup resulted in the diagnosis of intracranial and spinal subdural hematoma. CT and MRI of the head revealed a 2-3 mm thick intracranial subdural hematoma over the left cerebral hemisphere with extension into the interhemispheric fissure (Figure 1). A thin subdural hematoma was also noted over the left cerebellar hemisphere of the posterior fossa (Figure 2). MRI of the lumbar spine demonstrated a 3 mm wide dorsal subdural hematoma extending from L1 to L4 levels without compression of the conus medullaris or cauda equina nerve roots (Figure 3). Laboratory evaluation revealed no evidence of coagulopathy. The patient was managed conservatively and followed up on an outpatient basis following a two-day hospitalization. Over the next week, the patient's headache and back pain resolved. However, lower limb pain progressed to pain radiating down the posterior thighs and lateral leg and was most pronounced in the right leg. Physical exam at this time was remarkable only for mild weakness of right knee extension and positive right-sided straight leg raise sign. Extensive imaging workup consisting of MRI of cervical and thoracic spine and MR angiography of the brain did not reveal any underlying vascular lesions. With conservative clinical management, the patient slowly returned to baseline clinical status without residual neurologic deficits. Repeat imaging of the brain and spine 2 months later showed complete resolution of both prior subdural hematomas.

PMC5109579_01

Male

A 68-year-old man was admitted to our hospital for the following symptoms: a non-productive cough, malaise, gait difficulty, visual impairment, multiple skin rashes, and a nodule on his middle anterior chest. Until then, he had not visited any medical facilities for many years due to his economic status. According to the patient's recollection, the papules and nodule appeared 3 years previously. His visual impairment started 1 year previously and gradually worsened. His cough started 3 months before this admission, and it was initially wet and then became non-productive. In addition, he experienced general malaise, and he had difficulty walking since 10 days before the hospital visit. A physical examination on admission showed a blood pressure of 117/63 mmHg, pulse rate of 65 beats per min, and body temperature of 35.8C. Both conjunctivae were moderately anemic without icterus. Viscous discharge was present in both eyes. Erythema was found on his right cheek, anterior and posterior chest, and both lower legs. On his right cheek, painless erythema with scabs was observed. Purulent discharge was observed while gently pressing the rash. A solitary red nodule (5 cm in diameter) was present on his anterior chest (Fig. 1a). Multiple small, red papules (maximum size: 2 mm) were present on his trunk (Fig. 1b). His extremities were edematous, and an erosive rash was present on his legs. Several lymph nodes (maximum size: 15 mm) were palpated around his superficial lateral cervical area. Aside from these lymph nodes, a thumb-sized, painless, soft subcutaneous mass was present on his right lateral neck. On chest auscultation, the breath sounds were weak in his right lower lung. Laboratory results on admission are shown in Table 1. An increased white blood cell count, C-reactive protein level, and erythrocyte-sedimentation ratio were detected. Normocytic anemia and decreased total protein and albumin levels were noted. M. avium complex (MAC) antibody was slightly increased. Other than MAC antibody, antibodies for hepatitis B and C viruses, human immunodeficiency virus (HIV), and human T cell leukemia virus type 1 were negative. The number of CD4-positive T lymphocytes was 440 cells/muL. Results of an enzyme-linked immunospot assay for IFN-gamma response to Mycobacterium tuberculosis antigens (T-SPOT(R).TB, Oxford Diagnostic Laboratory, Marlborough, USA) on admission showed zero spots for ESAT-6 and CFP-10 antigens (the positive control panel detected 21 spots). When determining the IFN-gamma response to M. tuberculosis antigens by an enzyme-linked immunosorbent assay (QuantiFERON(R) TB-3G, Cellestis, Chadstone, Australia), the test results were considered to be invalid because the IFN-gamma response to phytohemagglutinin (PHA) was not detected in the positive control tube (0.00 IU/mL). On chest computed tomography, the right inferior lobar bronchus was completely occluded by a tumor-like lesion (1 cmx1 cm in size), resulting in complete atelectasis of his right lower lung (Fig. 2a). Bronchoscopy showed that the tumor-like lesion completely occluded the right lower bronchus (Fig. 2b). An ultrasound analysis indicated that his left cervical mass was a subcutaneous abscess. Brain magnetic resonance imaging (MRI) showed swelling in the retrobulbar part of both optic nerves (Fig. 4c). Bacterial cultures of the patient's sputum on admission did not indicate any significant common bacteria. However, on Ziehl-Neelsen staining, 2+ for acid-fast bacilli (AFB) were observed in his sputum. A polymerase chain reaction (PCR) analysis showed that the bacilli were M. avium. Lavage fluid from the right lower bronchus also showed 3+ for AFB. In addition to the respiratory specimens, AFB was also detected in the eye discharge (1+), purulent discharge from the right cheek (2+), and a biopsy specimen from a mass-like lesion of the right lower bronchus and the chest nodule (3+) by Ziehl-Neelsen staining (Fig. 1b). All of these AFB were confirmed to be M. avium by PCR. A biopsy of the tumor-like region in the right lower bronchus indicated the formation of a histiocytic granuloma with numerous AFB (Fig. 3a). Additionally, numerous AFB (Fig. 3b) and a xanthogranuloma with histiocytic infiltration positively stained with CD68 (Fig. 3c) were detected in the chest nodule. According to these results, the patient was finally diagnosed with disseminated M. avium infection. According to previous reports on the relationship between serum autoantibodies to IFN-gamma and disseminated NTM diseases, we performed an enzyme-linked immunosorbent assay (ELISA) for the autoantibody to IFN-gamma (human interferon-gamma antibody ELISA kit, Cusabio, Wuhan, China) using the patient's serum specimen. The optical density (450 nm) value of the patient's serum was 0.409, with 0.037 in a negative control well. In this assay system, a value 2.1-fold higher than the negative control well (i.e., 0.077 in this case) is considered to be positive for the presence of an autoantibody to IFN-gamma. Subsequently, we tested the concentrations of anti-IFN-gamma autoantibodies and the neutralizing capacity to recombinant human IFN-gamma in the patient's serum using methods previously reported. The serum concentrations of the autoantibody to IFN-gamma were 728.13 ELISA Units (EU) 1 month after treatment, 2015 (1 month after treatment) and 109.29 EU 6 months after treatment 28, 2015 (6 months after treatment). These titers were significantly higher than the normal range (5-50 EU). The signal transducer and activator of transcription-1 in immortalized human T cells was not phosphorylated after stimulation with IFN-gamma by the presence of the patient's serum. According to these results, we determined that the patient's serum had retained neutralizing anti IFN-gamma autoantibodies. Anti-mycobacterial chemotherapy was started 30 days after admission. A combination of 800 mg of CAM daily, 600 mg of RFP daily, and 750 mg of EB daily was initiated. The rash on the right cheek temporarily worsened around 10 weeks after chemotherapy. After 4 months of chemotherapy, the patient's general condition and the appearance of his skin lesions markedly improved (Fig. 4a and b). Follow-up orbital MRI showed obvious improvement in swelling of both optic nerves (Fig. 4c and d).

A chest computed tomography scan and bronchoscopic findings. a: Atelectasis of the right lower lobe.

PMC5109579_01

Male

A 68-year-old man was admitted to our hospital for the following symptoms: a non-productive cough, malaise, gait difficulty, visual impairment, multiple skin rashes, and a nodule on his middle anterior chest. Until then, he had not visited any medical facilities for many years due to his economic status. According to the patient's recollection, the papules and nodule appeared 3 years previously. His visual impairment started 1 year previously and gradually worsened. His cough started 3 months before this admission, and it was initially wet and then became non-productive. In addition, he experienced general malaise, and he had difficulty walking since 10 days before the hospital visit. A physical examination on admission showed a blood pressure of 117/63 mmHg, pulse rate of 65 beats per min, and body temperature of 35.8C. Both conjunctivae were moderately anemic without icterus. Viscous discharge was present in both eyes. Erythema was found on his right cheek, anterior and posterior chest, and both lower legs. On his right cheek, painless erythema with scabs was observed. Purulent discharge was observed while gently pressing the rash. A solitary red nodule (5 cm in diameter) was present on his anterior chest (Fig. 1a). Multiple small, red papules (maximum size: 2 mm) were present on his trunk (Fig. 1b). His extremities were edematous, and an erosive rash was present on his legs. Several lymph nodes (maximum size: 15 mm) were palpated around his superficial lateral cervical area. Aside from these lymph nodes, a thumb-sized, painless, soft subcutaneous mass was present on his right lateral neck. On chest auscultation, the breath sounds were weak in his right lower lung. Laboratory results on admission are shown in Table 1. An increased white blood cell count, C-reactive protein level, and erythrocyte-sedimentation ratio were detected. Normocytic anemia and decreased total protein and albumin levels were noted. M. avium complex (MAC) antibody was slightly increased. Other than MAC antibody, antibodies for hepatitis B and C viruses, human immunodeficiency virus (HIV), and human T cell leukemia virus type 1 were negative. The number of CD4-positive T lymphocytes was 440 cells/muL. Results of an enzyme-linked immunospot assay for IFN-gamma response to Mycobacterium tuberculosis antigens (T-SPOT(R).TB, Oxford Diagnostic Laboratory, Marlborough, USA) on admission showed zero spots for ESAT-6 and CFP-10 antigens (the positive control panel detected 21 spots). When determining the IFN-gamma response to M. tuberculosis antigens by an enzyme-linked immunosorbent assay (QuantiFERON(R) TB-3G, Cellestis, Chadstone, Australia), the test results were considered to be invalid because the IFN-gamma response to phytohemagglutinin (PHA) was not detected in the positive control tube (0.00 IU/mL). On chest computed tomography, the right inferior lobar bronchus was completely occluded by a tumor-like lesion (1 cmx1 cm in size), resulting in complete atelectasis of his right lower lung (Fig. 2a). Bronchoscopy showed that the tumor-like lesion completely occluded the right lower bronchus (Fig. 2b). An ultrasound analysis indicated that his left cervical mass was a subcutaneous abscess. Brain magnetic resonance imaging (MRI) showed swelling in the retrobulbar part of both optic nerves (Fig. 4c). Bacterial cultures of the patient's sputum on admission did not indicate any significant common bacteria. However, on Ziehl-Neelsen staining, 2+ for acid-fast bacilli (AFB) were observed in his sputum. A polymerase chain reaction (PCR) analysis showed that the bacilli were M. avium. Lavage fluid from the right lower bronchus also showed 3+ for AFB. In addition to the respiratory specimens, AFB was also detected in the eye discharge (1+), purulent discharge from the right cheek (2+), and a biopsy specimen from a mass-like lesion of the right lower bronchus and the chest nodule (3+) by Ziehl-Neelsen staining (Fig. 1b). All of these AFB were confirmed to be M. avium by PCR. A biopsy of the tumor-like region in the right lower bronchus indicated the formation of a histiocytic granuloma with numerous AFB (Fig. 3a). Additionally, numerous AFB (Fig. 3b) and a xanthogranuloma with histiocytic infiltration positively stained with CD68 (Fig. 3c) were detected in the chest nodule. According to these results, the patient was finally diagnosed with disseminated M. avium infection. According to previous reports on the relationship between serum autoantibodies to IFN-gamma and disseminated NTM diseases, we performed an enzyme-linked immunosorbent assay (ELISA) for the autoantibody to IFN-gamma (human interferon-gamma antibody ELISA kit, Cusabio, Wuhan, China) using the patient's serum specimen. The optical density (450 nm) value of the patient's serum was 0.409, with 0.037 in a negative control well. In this assay system, a value 2.1-fold higher than the negative control well (i.e., 0.077 in this case) is considered to be positive for the presence of an autoantibody to IFN-gamma. Subsequently, we tested the concentrations of anti-IFN-gamma autoantibodies and the neutralizing capacity to recombinant human IFN-gamma in the patient's serum using methods previously reported. The serum concentrations of the autoantibody to IFN-gamma were 728.13 ELISA Units (EU) 1 month after treatment, 2015 (1 month after treatment) and 109.29 EU 6 months after treatment 28, 2015 (6 months after treatment). These titers were significantly higher than the normal range (5-50 EU). The signal transducer and activator of transcription-1 in immortalized human T cells was not phosphorylated after stimulation with IFN-gamma by the presence of the patient's serum. According to these results, we determined that the patient's serum had retained neutralizing anti IFN-gamma autoantibodies. Anti-mycobacterial chemotherapy was started 30 days after admission. A combination of 800 mg of CAM daily, 600 mg of RFP daily, and 750 mg of EB daily was initiated. The rash on the right cheek temporarily worsened around 10 weeks after chemotherapy. After 4 months of chemotherapy, the patient's general condition and the appearance of his skin lesions markedly improved (Fig. 4a and b). Follow-up orbital MRI showed obvious improvement in swelling of both optic nerves (Fig. 4c and d).

A chest computed tomography scan and bronchoscopic findings. b: A tumor-like legion occluded the right lower bronchus.

PMC6579837_01

Female

A 15 kg, 4-year-old female Arabian Tahr from the Omani Mammals Breeding Center had its left hind leg at the distal tibia amputated 5 months before the prosthesis operation. The initial injury was a left distal tibia extra-articular multi-fragmented open fracture with severe contamination and soft tissue loss. It was treated by a circular external fixator. Within 5 days ischemic necrosis and infection developed and amputation of the distal tibia was performed. Post-amputation the animal showed severe problems in ambulation. Different custom-made exoprostheses were tested without positive results. The negative outcomes were caused primarily by attachment failure, stump irritation, and infection. Considering the animal's welfare, an attempt to restore normal movement by the implantation of ITAP was undertaken. Preoperative assessment of limb length and diameter of the medullary canal was based on radiographic projections with Kirschner wire that was 5 mm in diameter, 100 and 200 mm in length, as well as photographs of the animal. CT scanning and 3D image reconstruction of the affected leg were unavailable. The custom-designed prosthesis was manufactured by the IWET Company in Kleosin, Poland by engineers Marek Lubak and Michal Sujeta. The prostheses elements are pictured in Figure 1. The prostheses are comprised of a titanium alloy (Ti6Al4V) stem for intramedullary placement with dorsal and medial locking plates for additional secure fixation, a perforated umbrella-shaped flange for skin in-growth and a distal extra cutaneous pin for exoprosthesis attachment. The exoprosthesis consisted of an adjustable locking hinge made from stainless steel attached to a carbon fiber leg with the hoof. All elements of the designed prosthesis were subjected to structural analysis by finite element methods (FEM). Due to the patient's very active nature, triple weight (45 kg) was assumed for calculations. The titanium prosthesis was made by combining techniques of computer numerical control milling and 3D printing. Elements of the prosthesis were adjustable with the possibility of regulating the length (+/- 40 mm) and a flexion angle for the best fit for the animal. The 15 kg Tahr was sedated with 1 mg medetomidine at a dose of 0.06 mg/kg (Domitor 1 mg/ml Orion Pharma) and 1.5 mg butorphanol at a dose of 0.1 mg/kg (Butomidor 10 mg/ml Orion Pharma), followed with 750 mg ceftriaxone at a dose of 50 mg/kg (Rocephin 1 g Roche) and 7.5 mg meloxicam at a dose of 0.5 mg/kg (Meloxicam 5 mg/ml Troy Laboratories) by intravenous injection. After sedation, the leg was prepared for aseptic surgery in the standard manner. Anesthesia was induced by 30 mg propofol at a dose of 2 mg/kg (Propofol 1% 10 mg/ml Fresenius), then an endotracheal tube that was 5 mm ID, 7.3 mm OD x 20 cm (Mila International) was inserted, cuff inflated, and anesthesia was maintained with 2-5% isoflurane in 100% oxygen. The patient underwent an electrocardiogram, capnography, pulse oximetry, and indirect blood pressure for monitoring anesthesia. Ringer lactate as a supportive fluid therapy was maintained at a dose of 10 ml/kg/h during the surgical procedure. The patient was placed in the right lateral position with the affected limb facing in the uppermost direction. A circumferential transverse incision of skin was made 1 cm proximal from the stump and extended 4 cm proximally at the dorsal aspect of the tibia. Dissection of the soft tissue from the shaft of the tibia allowed for a 20 mm osteotomy of the distal tibia using an oscillating saw. The medullary canal of the tibia was broached using a curette and a 6 mm drill. The ITAP implant was inserted and pushed into position with a slap-hammer and secured by one 3.5 mm and two 2.7 mm locking screws both at the dorsal and medial plate. Intraoperative radiographs were taken to assess the implant position and its alignment before the final tightening of locking screws (Figure 2). The remaining muscles and tendons were attached to a perforated umbrella-shaped flange with 2-0 polyglactin 910 (VICRYL Plus, Ethicon). The skin was closed with 2-0 polyamide (Ethilon, Ethicon) simple interrupted sutures. Recovery from the anesthesia was uneventful. Postoperative medications included antibiotic therapy with 135 mg combination of amoxicillin, clavulanic acid at a dose of 9 mg/kg (Synulox RTU Zoetis), and pain control with 7.5 mg meloxicam at a dose of 0.5 mg/kg (Meloxicam 5 mg/ml Troy Laboratories) every 24 h for 10 days. The wound dressing was changed every 2 days. The skin seal around the distal flange was achieved after 30 days. A radiographic examination at 8 weeks revealed thickening and bone remodeling around the distal end of the bone (Figure 3). An exoprosthesis was attached 2 weeks after surgery. After the initial adjustment, including length, and hinge flexion, the animal immediately started bearing its own weight. Initially, lameness was not ideal at a level of 2/5 on the AAEP scale. Within a 3-week period, however, this improved to a 1/5 on the AAEP scale. Three months post-implantation a complication occurred. Larvae of the Old-World screwworm fly (Chrysomya bezziana), which feeds on living tissue, were found in the junction between the skin and the implant. It was observed that the subsequent infection with sanguine-purulent discharge affected the skin and subcutaneous tissue around the prosthesis (Figure 4). Treatment for the screwworm fly consisted of aggressive tissue debridement, antibiotic therapy, pain management, and wound care. Under general anesthesia, with the same protocol as described previously, surgical debridement, and maggot removal was performed. Following the removal of the screwworm larvae and maggots, systemic antibiotic treatment with 33 mg of ceftiofur at a dose of 2.2 mg/kg every 24 h (EXCENEL RTU, Zoetis) and 300 mg of amikacin at dose of 20 mg/kg IV every 24 h (Amikin inj 100 mg/ml Bristol-Myers) was administered for 7 days, with a 135 mg combination of amoxicillin and clavulanic acid at a dose of 9 mg/kg (Synulox RTU Zoetis), and pain control with 7.5 mg meloxicam at a dose of 0.5 mg/kg (Meloxicam 5 mg/ml Troy Laboratories) every 24 h for the next 10 days. This combination of medicine administered post-treatment of the infection proved effective. To promote healing and reduce the risk of implant-bone infection for the first 4 days, interactive moist dressings with the addition of 200 mg amikacine (Tenderwet active 24, Hartmann) combined with silver mesh (Atrauman Ag, Hartmann) were applied and changed daily. After 4 days, the remaining skin defect was treated with hydrocolloid dressing (Hydrocoll, Hartmann) combined with silver mesh (Atrauman Ag, Hartmann) and wound healing cream, containing Sh-Polypeptide-1- acidic Fibroblast Growth Factor (Regen Gel, VET STEM CELL Poland), applied daily. The skin defect completely healed in 18 days. Radiography examination revealed bone remodeling around the distal end of the tibia without any signs of osteolysis. During the treatment, the animal was kept indoors for close observation. Post-treatment the Tahr was released from a safe enclosure into its herd. The distal part of the tibia was constantly protected with soft dressing (Softban) and secured by an adhesive bandage (Tensoplast) all the time and changed every 7-10 days. The patient tolerated the situation very well; the dressing was changed without sedation and no more skin-implant complications have been observed. With time, it was found that an S-shape design of the "hoof" in the prosthesis is not optimal, as it hooks on long grass or even might cause leg entrapment with wire mesh fences. The gap on the distal end of the prosthesis was closed by silver duct tape (Scotch). After 6 months post-surgery, the animal was successfully returned to the herd, where it was accepted and now walks and runs using the prosthetic. Although a shortening of stride was noticeable throughout the rehabilitation process, the restoration of lameness from 2/5 to 1/5 (on the AAEP scale) within 3 weeks was a positive indicator of functional restoration success.

arabian tahr, arabitragus jayakari, itap, intraosseous transcutaneous amputation prosthesis, amputation, prosthesis, rehabilitation, wildlife

PMC7462578_01

Female

An 88-year-old woman diagnosed with COVID-19 at a hospital in Sao Paulo - the epicenter of the COVID-19 outbreak in Brazil - was put under mechanical ventilation for 20 days due to acute respiratory distress syndrome (ARDS) caused by the SARS-CoV-2. The patient had no history of smoking. Laboratory examination revealed a high percentage of white blood cell neutrophil count 12,870 (normal range: 1700-7000 mm3) and a decreased percentage lymphocyte count 860 (normal range: 900-2900 mm3). There were elevated blood levels for C-reactive protein 28.05 mg/L (normal range: 0-5 mg/L), D-dimer 4.65 mg/L (normal range: < 0.5 mg/L), and Lactic Dehydrogenase (LDH) 595 U/L (normal range: 240-480 U/L). At a fraction of inspired O2 (FiO2) of 60%, with a PEEP of 8 mmHg under a 20 mmHg pressure support, the blood gas analysis showed pH 7.49 (normal 7.35-7.45) a PO2 of 89 mmHg (normal 80-100 mmHg), pCO2 of 28 mmHg (normal 35-45 mmHg) and a SatO 2 of 97% (normal 94-100%). Suddenly, she developed oxygen desaturation (SpO 2) of 87% and a worse respiratory pattern. During physical examination, respiratory sounds were diminished at right hemithorax. The chest x-ray revealed right pneumothorax (Fig. 1-A). A pigtail catheter was introduced with successful reexpansion of the right lung (Fig. 1-B). A huge air escape was observed after the pleural drainage, which was put under a water seal with a filter protected. Forty-eight hours after the first pneumothorax, the patient developed another respiratory distress, with an ipsilateral new pneumothorax (Fig. 1-C) requiring another chest drain with conventional 28F chest tube thoracostomy under suction, leading to improved lung reexpansion (Fig. 1-D). The pigtail was withdrawn two days after the chest tube insertion, and the chest tube was kept in place until mechanical ventilation weaning, which occurred 14 days after the second procedure.

covid-19, chest drainage, pneumothorax

PMC6434163_01

Female

A previously healthy 18-year-old female presented to the Emergency Room after one day of fever, nonproductive cough, difficulty breathing, and pleuritic chest pain. Two months prior to presentation she started vaping using a "Baby Smok Beast Mod" device with 6% nicotine fluid 5 times per day for 30 minutes. She denied traditional cigarette smoking, drug use, exposure to pulmonary irritants, recent respiratory illness or history of deployment to the Middle East. Initial vitals were remarkable for oxygen saturation of 88% on room air, temperature of 102.4 F, heart rate of 122 beats/min, respiratory rate of 22 breaths/min, and blood pressure of 104/68 mm Hg. On physical exam, she was found to be in mild distress with tachycardia, tachypnea and facial flushing. There was neither accessory muscle use nor chest wall tenderness, and her lungs were clear to auscultation bilaterally. There was no lower extremity edema or calf tenderness. Laboratory tests revealed significant leukocytosis of 19.6 x 109/L with 91.2% granulocytes and 0.5% eosinophils. Initial chest x-ray demonstrated right lower lung airspace consolidation consistent with a pneumonia. Intravenous azithromycin was initiated and she was admitted to the hospital for further monitoring. Overnight, she developed moderate distress with worsening tachycardia, dyspnea, and hypoxemia. Increasing levels of oxygen by nasal cannula were required to maintain her oxygen saturation above 92%, meanwhile her respiratory rate increased to 30 breaths/min. Repeat examination revealed bibasilar inspiratory crackles. D-dimer was elevated to 0.79 mcg/ml. Repeat chest radiograph demonstrated increasing airspace opacities. A computed tomography pulmonary angiogram (CTPA) was completed due to concern for pulmonary embolism (PE). The CTPA excluded PE, but found diffuse ground-glass patchy airspace disease and coalescing nodules (Fig. 1). Due to worsening respiratory failure overnight, the patient was transferred to the Intensive Care Unit (ICU) for closer monitoring and respiratory support. Bronchoscopy with bronchial alveolar lavage (BAL) was performed, revealing 26% eosinophils in the lavage fluid. Sputum and BAL cultures were negative for viral, fungal, and bacterial pathogens. No other infectious etiologies to include TB, legionella, strongyloides, coccidioides, or histoplasma were found. Given her acute onset of symptoms, negative alternative workup, and significant BAL eosinophilia the diagnosis of AEP was made. She was started on methylprednisolone 125mg intravenous every 6 hours. After two days she showed significant improvement and was switched to prednisone 60mg oral once daily. She fully recovered 6 days after starting steroids, and was discharged home on oral prednisone with subsequent tapering. On discharge, her vital signs and physical exam were within normal limits. A repeat chest x-ray performed on the day of discharge showed significant improvement of the airspace opacities bilaterally (Fig. 2).

acute eosinophilic pneumonia, electronic cigarette use, vaping

PMC7683612_01

Female

A 32-year-old woman presented to another hospital with a sudden onset of right-sided hearing loss and severe true rotational vertigo, which occurred immediately after nose-blowing. She was treated with corticosteroids and bedrest for 1 week, and her vestibular symptom initially resolved. However, on the 7th day, her severe rotational vertigo recurred, and her hearing loss persisted, and she was referred to our hospital. An otoscopic examination showed bilateral intact tympanic membranes. Pure tone audiometry showed a severe right-sided mixed hearing loss (Figure 1). Left-beating horizontal and rotatory nystagmus was mainly observed in the supine position with Frenzel glasses. A high-resolution temporal bone CT scan on the 10th day showed pneumolabyrinth in the right vestibule (Figure 2). She was again treated with bedrest and corticosteroids. After the conservative treatment, however, her vertigo and severe hearing loss did not resolve. Therefore, we decided to perform perilymphatic fistula (PLF) repair surgery on the 17th day. The operation was done under general anesthesia; a transcanal approach with tympanomeatal flap elevation enabled the observation of a dehiscence in the center of the stapes footplate with a bony defect 0.5 mm in diameter, which was covered by a membranous tissue, and a tear was found in this membrane (Figure 3). A small amount of perilymph leakage was observed from this tear, and middle ear lavage with 0.3 ml of saline for a CTP detection test was collected during the operation. The fistula in the footplate was sealed with connective tissue, and the round window was reinforced with connective tissue and cartilage to stabilize the labyrinth further. The vestibular symptoms and nystagmus disappeared immediately after the operation, and at her 1-month follow-up assessment, her hearing improved (Figure 4). Postoperatively, a CTP detection test revealed a concentration of 0.84 ng/ml, which is positive, with the cutoff criteria being CTP 0.8 positive, 0.8 > CTP > 0.4 intermediate, and 0.4 > CTP negative (ng/ml). A more detailed history revealed that, for 15 years, she felt vertigo as if her brain was shaken upward when she would blow her nose. True rotational vertigo would continue for 3 to 4 s. After she stopped blowing her nose, she would again feel normal. She did not hear any internal sounds such as echoing, resonant voice, pulse/heartbeat, or hearing her eyes move or blink. She did not have any history of traumatic events to her head or ears. Based upon her history, intraoperative findings, and postoperative resolution of her vestibular symptoms, the dehiscence of the stapes footplate caused pressure-induced vertigo symptoms. At 1 year after the surgery, she had no recurrence of the vestibular symptoms, and her cochlear function remained unchanged.

ctp, plf, cochlin-tomoprotein, perilymph fistula, pneumolabyrinth, stapes, superior canal dehiscence, third window syndrome

PMC10077138_01

Male

A 65-year-old Caucasian male was referred to a provincial ophthalmology service with a 2-week history of bilateral eye redness, photophobia, and ocular discomfort. He also described intermittent spontaneous epistaxis, fatigue, lethargy, and unintentional weight-loss. He had a background of ischaemic heart disease, hyperlipidaemia, hypertension and right hip osteoarthritis awaiting replacement. His medication history included: aspirin, metoprolol, and atorvastatin. He was a retired truck driver and ex-smoker. He had no previous ophthalmic history of note with no prior ocular surgery. His best corrected visual acuities on presentation were 6/5 (right) and 6/9 (left) with normal intraocular pressures. Nodular scleritis extended to the right nasal limbus (shown in Fig. 1). The cornea was clear without defect. The anterior and posterior segments were quiescent in both eyes, with normal fundus and optic nerve appearance. Systemic blood work and a punch biopsy of his right scleral mass were taken. He subsequently represented acutely to the emergency department 10 days later with frank haematuria, dizziness, and new confusion. He displayed word-finding difficulties and atypical dysarthria leading to admission for further systemic work-up and neuroimaging. His blood work demonstrated anti-neutrophil cytoplasmic IgG autoantibody (ANCA) positivity with an anti-proteinase 3 antibody (PR3) level of 112 U/mL. His complement studies showed C3 elevation (1.95 g/L) and normal C4 (0.46 g/L). Anti-myeloperoxidase antibody levels were <3 U/mL. Glomerular basement membrane antibodies were not detected. Infectious screen including sarcoidosis, tuberculosis, and syphilis was negative. Rheumatology factor and anti-cyclic citrullinated peptide were both negative. Coagulation studies returned normal. His creatinine was 96 mumol/L with an estimated glomerular filtration rate of 71 mL/min/1.73 m2. Urine cytology demonstrated red blood cells, polymorphonuclear leucocytes without evidence of malignant cells. Liver function tests demonstrated normal transaminase levels, however, elevated alkaline phosphatase (199 U/L) and Gamma-glutamyl transferase (164 U/L). Hepatitis B and C serology along with human immunodeficiency virus serology were negative. Multi-system computed tomography imaging demonstrated lung, liver, prostate, bladder, nasal, and ethmoidal/maxillary sinus involvement (shown in Fig. 2). Biopsies of both his right nasal sclera and nasal cavity mass demonstrated inflamed granulation tissue with reactive atypical squamous epithelium without frank dysplasia or malignancy. Multinucleate giant cells were visible in both biopsied samples. The histopathology slide of the right scleral biopsy is shown in Figure 3. An acute infarct of the left inferior parietal cortex was present on magnetic resonance angiography without evidence of cerebral vasculitis. Stenosis of both proximal internal carotid arteries with >80% critical stenosis on the left side was revealed on duplex carotid ultrasound. A diagnosis of granulomatous with polyangiitis was made and a multidisciplinary approach employed including ophthalmology, otolaryngology (ENT), rheumatology, urology, and vascular surgery subspecialties. He was commenced on intravenous methylprednisolone 1 g for three consecutive days. He received two, 1 g rituximab infusions 14 days apart and cotrimoxazole 960 mg 3 times-weekly. He remained on aspirin, metoprolol, and atorvastatin. Dual antiplatelet therapy was avoided due to his ongoing haematuria and epistaxis. He successfully underwent left endarterectomy. During the initial stages of his intravenous methylprednisolone treatment, he developed right peripheral ulcerative keratitis (PUK). This occurred 12 days from presentation, 2 days after systemic steroid commencement. There was significant corneal thinning with loss of the nasal juxtalimbal corneal stroma. Due to the high risk of morbidity, corneal scraping was not conducted. His topical eye drops included g.chloramphenicol 0.5% four-times daily, g.hyaluronate sodium 0.1% every 2-hours, and g.acetylcysteine 10% four-times daily in addition to oral doxycycline and ascorbic acid. Rapidly progressive corneal thinning was noted with extensive stromal tissue loss exposing Decement's membrane. Due to the high risk of perforation, surgical temporizing measures were necessary. Corneal cyanoacrylate gluing with nasal juxtalimbal conjunctival resection with bandage lens placement was carried out (see online suppl. materials for intraoperative surgical video). There was no descemetocele formation, corneal perforation, or secondary microbial keratitis. His visual acuities following the procedure were 6/9+1 (left) and 6/12-1 (right). His C-reactive protein reduced from 387 mg/L to 8.7 mg/L supporting GPA remission 3 months following presentation. He is currently on tapering oral prednisone with weekly methotrexate 20 mg maintenance therapy without evidence of recurrence. A 5-month progress anterior segment photo is shown in Figure 4. The patient remains under the care of ophthalmology, rheumatology, and urology outpatient departments at time of publishing.

granulomatosis with polyangiitis, peripheral ulcerative keratitis, scleritis, wegener’s granulomatosis

PMC6548921_01

Male

A 68-year-old man with a 50-pack-year history of smoking had been followed since 1992 at our hospital. The patient's first cancer occurred in the ascending colon and was surgically resected in 1992. His second and third cancers occurred in the sigmoid colon and rectum, respectively, and were resected in 2012. The pathological diagnosis of both cancers was pStage I. His fourth cancer was squamous cell carcinoma in the lower lobe of the left lung (pT2bN0M0, pStage IIA); this tumor was resected in 2012. His fifth and sixth cancers occurred in the sigmoid colon and the rectum, respectively, and were endoscopically resected in 2013. The pathological diagnosis of both cancers was carcinoma in situ. His seventh cancer occurred in the prostate and was treated via retropubic radical prostatectomy in 2014 (pT3aN1M0, pStage IV). The patient's mother had had uterine cancer, and his brother had been diagnosed with stomach cancer at a young age (Fig. 1). Given this history, familial cancer syndrome was suspected. We provided counseling to him and his family according to the ethical guidelines of the Division of Clinical Genetic Oncology of our hospital; we then examined him for microsatellite instability (MSI). The loss of MSH2 and MSH6 was detected via immunohistochemistry (IHC) in the colon cancer resected in 2013, and two of five microsatellite markers (BAT25 and BAT26) showed replication error (Fig. 2A-E). Therefore, the patient's colon cancer was considered to be a high-frequency MSI (MSI-H) tumor. In addition, rearrangement in the MSH2 germline gene, which has previously been described in Lynch syndrome, was identified using a multiplex ligation-dependent probe amplification assay (Fig. 2F). In April 2015, a consolidation shadow with a thick-walled cavity in the upper lobe of the left lung was identified on computed tomography. A transbronchial lung biopsy (TBLB) revealed organizing pneumonia. The shadow gradually expanded, and new lesions emerged in the right upper and lower lobes. Another TBLB performed in April 2016, revealed adenocarcinoma without epidermal growth factor receptor mutation or anaplastic lymphoma kinase rearrangements in the left upper lobe. We used IHC to confirm that the tumor was a primary lung cancer and not a metastatic tumor from known colorectal cancers (Fig. 3A-H). Furthermore, the results of additional IHC staining indicated that programmed death ligand-1 (PD-L1) expression was observed in about 3% of the tumor cells of lung biopsy tissue (Fig. 3I), and PD-L1 was not expressed in colorectal tumor cells (Fig. 3J). Examinations of MSI in lung biopsy tissue were performed via IHC and MSI analyses. IHC revealed the loss of MSH2 and MSH6 in the lung cancer (Fig. 4). However, MSI-H was not detected in the MSI analysis. In summary, the patient was diagnosed with primary lung cancer of the left upper lobe, which was pathologically proven to be adenocarcinoma, as well as MSI with radiologically multiple pulmonary metastases of the right upper and lower lobes (cT3N0M1a, cStage IV). He began receiving cisplatin and pemetrexed therapy in June 2016 and was subsequently treated with maintenance pemetrexed. The lung tumors exhibited a partial response, but the bilateral lung tumors progressed after five months (Fig. 5A). The patient began receiving nivolumab (3 mg/kg intravenously every 2 weeks) in November 2016. The lung tumors dramatically decreased in size within 2 months. However, the patient discontinued nivolumab due to drug-induced interstitial lung disease and started treatment with corticosteroids in March 2017. Surprisingly, tumor shrinkage continues to be obtained without anti-cancer treatment as of September 2018, when we drafted this report (Fig. 5B).

lynch syndrome, msi-h, nivolumab

PMC4753744_01

Female

A 29-year-old woman, a known case of chronic kidney disease (CKD) presented with history of fever from last 4 months. Her basic renal disease was unknown as she had presented with bilateral small kidneys. Fever was high grade, intermittent and was associated with poor appetite. She had no dysuria, cough or abdominal complaints. The examination was unremarkable except for left-sided axillary lymphadenopathy. There was no hepatosplenomegaly and breast examination was normal. Neurological examination was unremarkable. Her creatinine on admission was 6.9 mg/dl with an estimated glomerular filtration rate (eGFR) of 7 ml/min/1.73 m2. She was evaluated for fever. Serological tests for malaria, dengue, and enteric fever were negative; urine cultures were sterile. Her hemoglobin, total leukocyte count and platelet counts were 8.5 g/dl, 5880/microl, and 1.5 lakhs/microl, respectively. The kidney function tests revealed serum urea of 223 mg/dl and serum creatinine of 6.90 mg/dl. The serum sodium and potassium levels were 136 mmol/l and 4.8 mmol/l, respectively. The liver function tests and thyroid function tests were normal. Blood cultures were sterile. Ultrasound abdomen showed hepatosplenomegaly with irregular, shrunken kidneys. There was no hydroureteronephrosis. Computed tomography of chest and abdomen showed splenomegaly, retroperitoneal and axillary lymphadenopathy with no mediastinal lymphadenopathy. There was no consolidation, collapse or cavitating lesion. Fine needle aspiration from the axillary lymph node was inconclusive. Endoscopic ultrasound-guided fine needle aspiration cytology of the retroperitoneal nodes showed reactive lymphoid cells with few histiocytes. Her tuberculosis gold quantiferon test was positive. In view of persistent fever, lymphadenopathy, hepatosplenomegaly and positive quantiferon gold test, she was empirically initiated on antitubercular therapy with four drugs (isoniazid [INH], rifampicin, pyrazinamide and ethambutol) with appropriate dose adjustments for her kidney function. She was also commenced on pyridoxine 40 mg once daily. Hemodialysis (HD) was initiated through left radiocephalic fistula. One-week after initiation of antitubercular therapy, she developed slurring of speech with unstable gait. On examination, she had pulse 100 beats/min, blood pressure was 150/90 mmHg with no postural drop. The oxygen saturations were 100% on room air, blood glucose levels, serum sodium, and calcium levels were normal. Central nervous system examination showed dysarthria with impaired finger-nose test on left side with past pointing. Her gait was ataxic with swaying on left side. She was unable to perform rapid alternating movements on left side. Motor examination done showed decreased tone with normal power and reflexes on left side. There were no neurological findings on the right side. Sensory examination was normal with negative Romberg's sign. Magnetic resonance imaging (MRI) brain showed diffusion restriction in bilateral dentate nuclei with T2 fluid-attenuated inversion recovery hyperintensity with no evidence of hemorrhage [Figure 1]. There were no features suggestive of tuberculoma or abscess. As there was no other obvious explanation of the sudden development of cerebellar ataxia, a diagnosis of INH induced toxic encephalopathy was considered and INH was withdrawn. Two days after withdrawal of INH, patient's condition started to improve and had complete neurological recovery within a week. She was commenced on HD via a left radio-cephalic arteriovenous fistula. She was discharged on modified antitubercular therapy that included rifampicin at dose of 450 mg/day, pyrazinamide at dose of 500 mg twice daily and levofloxacin at dose of 250 mg/day. On follow-up after 3 weeks, she has remained afebrile with no neurodeficit.

ataxia, cerebellum, chronic kidney disease, dentate nuclei, isoniazid toxicity

PMC6812314_01

Female

We present a case of a 47-year-old woman with a past medical history of actinic keratosis, seborrheic dermatosis, anxiety, deep vein thrombosis, and depression, who presented with a 4-day history of progressively worsening shortness of breath, nasal congestion, fevers, chills, cough, lower extremity swelling, and generalized body aches. There was no history of sick contacts, TB exposure, or recent travel. She was on the following medications: alprazolam, amlodipine, buspirone, clonazepam, dicyclomine, losartan, ondansetron, warfarin, escitalopram oxalate, ibuprofen, methadone, and topical tretinoin. While in the emergency room, she was unable to maintain adequate oxygenation and required endotracheal intubation. Bilateral crackles and rhonchi were heard on chest examination. Patient was treated empirically with multiple antibiotics. After no significant improvement, she was placed on steroids as well as azathioprine and managed with supportive care. CBC with differential showed a WBC count of 9.97, hemoglobin 9.9, hematocrit 35.8, and platelet count of 266. Blood culture showed no growth. Influenza A and B Antigen and cryptococcal antigen were negative. Bronchoalveolar lavage culture showed no growth and gram stain was negative. Serology for rheumatoid factor was normal and histoplasma antigen was not detected. Electrolytes, blood urea nitrogen, and creatinine were normal. Echocardiogram revealed elevated right ventricular systolic pressure (81-90 mmHg) with subsequent right heart catheterization confirming pulmonary hypertension. Chest CT with contrast revealed bilateral diffuse predominant ground glass attenuation with scattered alveolar opacities of the lungs. Due to clinical deterioration, a repeat chest CT without contrast done 9 days after showed multifocal consolidation in bilateral lungs which had worsened when compared to previous CT. Small trace pleural effusions were present but no pneumothorax. CT Angiogram pulmonary embolism protocol with contrast was done 5 days after the second chest CT and it showed no filling defect within the pulmonary arterial system to indicate any significant pulmonary embolus but revealed small partial occlusive filling defect in the right internal jugular vein. The heart and pericardium were unremarkable. Extensive multifocal airspace opacities were seen in the bilateral lungs which worsened compared to the prior exam. These were greater in the bilateral upper lobes. Due to lack of clinical improvement, a video assisted thoracoscopic surgery (VATS) with biopsy of the right middle and lower lung lobes was performed which revealed a diffuse alveolar septal thickening, due to combination of fibroblastic proliferation and alveolar lining cell hyperplasia. Scattered eosinophilic hyaline membranes were also present and these findings were supportive of diffuse alveolar damage. Several fibrinous thrombi were also noted in the small arteries. No viral inclusions were identified and biopsy cultures showed no growth. Patient had significant improvement with continued supportive treatment and was discharged 20 days after admission to a long-term care center, advised to stop e-cigarette smoking, and to follow up with the pulmonologist and the primary care physician in the clinic on outpatient basis. Patient adhered to lifestyle modification and clinic visits and a repeat chest CT scan done about 3 months following discharge showed significant improvement in the previously seen infiltrates with complete resolution in the upper lung zones.

PMC8555453_01

Male

A 50-year-old male farmer complained of fatigue and chest tightness with no obvious cause since March 20, 2019. After resting, his condition improved slightly, but then gradually worsened. The patient visited a local hospital for diagnosis on April 2, 2019. Peripheral blood film (PBF) showed white blood cells (WBC) of 5.6x109/L, red blood cells (RBC) of 1.43x1012/L, hemoglobin (Hb) of 53.2 g/L, and platelets (PLT) of 8x109/L. The attending physician recommended a transfer to a tertiary hospital for diagnosis and treatment. The patient was transferred to our hospital on April 4, 2019. Physical examinations showed enlarged bilateral submandibular lymph nodes without hepatosplenomegaly. PBF indicated WBC of 4.20x109/L with 43% neutrophils, 26% lymphocytes, 26% monocytes, and 5% blasts. PBF also revealed RBC of 1.12x1012/L with anisocytosis, Hb of 41 g/L, and PLT of 6x109/L. Bone marrow (BM) aspirates revealed a significant increase in bone marrow cellularity; 18% were myeloblasts with regular or irregular nuclei, fine chromatin, visible nucleoli, and reduced blue plasma. Nuclear-cytoplasmic dyssynchrony, nuclear malformations, binuclear, and Pelger malformed granulocytes accounted for 13% of the granulocytes, and 3% abnormal eosinophils were observed. Nucleated red blood cells were significantly reduced and accounted for 1.5%. Petal-nucleated red blood cells and anisocytosis were also observed; 18% of the aspirates were monocytes. Two granular megakaryocytes were observed on the whole slide, and the number of platelets was significantly reduced. Results from the bone marrow biopsy showed hypercellularity of the bone marrow tissue, with an increase in immature cells. Immunophenotyping of bone marrow cells showed 5.65% blasts, expressing CD34, CD117, CD13, HLA-DR, lack of CD7, CD10, CD38, CD33, CD11C, CD11b, CD64, CD15, CD19, CD123, CD56, CD36, CDCR4, CD14, CD300e, CD4, and CD2 (Supplementary Figure S1). This study was approved by the Ethics Committee of the Traditional Chinese Medical Hospital of Langfang City, China. Bone marrow nucleated cells (1-3x106/mL) were cultured in Gibco bone marrow cell culture media (USA) for 48 h and then analyzed by G-banding based on an international system for Human Cytogenomic Nomenclature (ISCN 2016). Karyotype analysis demonstrated 46,XY,inv(16)(p13.1q22)[10] (Figure 1). Fluorescence in situ hybridization (FISH) was performed using the Vysis dual-color separation CBFbeta probe (Abbott, USA), green fluorescent labeled 3'CBFbeta (16q22) probe, and the red fluorescent-labeled 5'CBFbeta probe. The rearrangement of the CBFbeta gene fusion was detected on chr16 (Figure 2). RT-PCR was used to detect the following gene fusions based on a previous study. All of these genes were negative: BCR-ABL, SIL-TAL1, E2A-HLF, TEL-AML1, MLL-AF4, E2A-PBX1, AML1-ETO, MLL-AF9, PML-RARalpha, PLZF-RARalpha, STAT5b-RARalpha, MLL-AF6, MLL-AF10, MLL-ELL, MLL-ENL, NPM-MLF1, TEL-PDGFRB, FIP1L1-PDGFRA, AML1-MDS1/EVI1, DEK-CAN, TEL-ABL, ETV6-PDGFRA, NUP98-HoxA13, NUP98-HoxC11, NUP98-HoxD13, NUP98-HoxA9, NUP98- HoxA11, NUP98- PMX1, TEL-JAK2, MLL-AF17, MLL- AF1q, MLL- AF1p, MLL-AFX, MLL-SEPT6, (NPM, FIP1L1, PRKAR1A, NUMA1)-RARalpha, NPM-ALK, SET-CAN, TLS-ERG, and AML1-MTG16. WT1 was 11.7%. A rare fusion transcript of CBFbeta/MYH11 was detected, and electrophoresis of the PCR amplified product showed a positive band between 200-300bp (Figure 3A). Additional analysis of the PCR amplified product by capillary sequencing was performed. The sequence was as follows: TTTCAGAATTTTGAAGGCTCCCATGATTCTGAATGGAGTCTGTGTTATCTGGAAAGGCTGGATTGATCTCCAAAGACTGGATGGTATGGGCTGTCTGGAGTTTGATGAGGAGCGAGCCCAGCTTCACGAGTATGAGACGGAACTGGAAGACGAGCGAAAGCAACGTGCCCTGGCAGCTGCAGCAAAGAAGAAGCTGGAAGGGGACCTCTTCTAAA. G denoted the end of the CBFbeta exon4 and C denoted the beginning of the MYH11 exon34 according to NM_002474.3 and CCDS_10565.1. This confirmed that CBFbeta exon4 and MYH11 exon34 were fused to form the fusion transcript. Comparing the CCDS sequence of the NCBI database, the CBFbeta/MYH11 fusion transcript belonged to a rare type I fusion transcript (Figure 3B). The patient was then diagnosed with inv(16)(p13.1q22); CBFbeta/MYH11 (type I) AML. Next-generation sequencing (NGS) analysis was used to detect additional prognostic mutational genes, including FLT3, NPM1, KIT, CEBPA, DNMT3A, IDH1, IDH2, TET2, EZH2, AML1, ASXL1, PHF6, TP53, SF3B1, SRSF2, U2AF1, ZRSR2, NRAS, CBL, SETBP1, ETV6, and JAK2. No mutations in these genes were observed. The patient underwent chemotherapy with decitabine (DAC), daunorubicin (DNR), and cytarabine (Ara-C) (DAC: 50 mg qodx3; DNR: 40 mg d1-2, 60 mg d3; Ara-C: 200 mg d1-4, 150 mg d5, 200 mg d6-7). In addition, supportive treatment including heart, liver, and stomach protection, antiemetics, RBC, and platelet transfusions, was administered. On the 24th day after chemotherapy, BM cellularity was reduced, hence, supportive treatment was continued. On the 41st day, the cellular composition of the BM aspirates consisted of 10% myeloblasts, 11% monoblasts and pre-monocytes, and 2% abnormal eosinophils. The patient was administered a second cycle of chemotherapy with DAC, homoharringtonine (HHT), Ara-C, and etoposide (VP-16) (DAC: 50 mg qodx3; HHT: 2mg d1-5, 3mg d6-7; Ara-C: 150mg d1-7; VP16 0.1g, d1-7). In addition, supportive treatment was also administered. Seventy-five days after the initial chemotherapy, BM morphology returned to normal, and chromosomes were 46,XY(20). FISH showed CBFbeta gene separation and rearrangement. Chemotherapy was continued, and 272 days after the initial chemotherapy, CBFbeta gene separation and rearrangement was negative as determined by FISH, and the CBFbeta/MYH11 fusion transcript showed positive. After 487 days of the initial chemotherapy, bone marrow morphology showed complete response (CR), with 46,XY(20) chromosomes. FISH was negative for CBFbeta gene separation and rearrangement. However, the CBFbeta/MYH11 fusion transcript was still observed. At present, the patient is still undergoing regular chemotherapy and follow-up.

PMC5952557_01

Female

A 35-year-old Hispanic female was admitted for worsening upper abdominal pain, nausea, and vomiting. She had a past medical history of heartburn which was being treated with PPI. She was initially seen in the emergency department for worsening epigastric abdominal pain and was discharged home on daily omeprazole. She returned to her primary care clinic 2 months later complaining of similar symptoms while being on omeprazole. Since omeprazole was not effective, she was switched to esomeprazole. Two months later, she visited her home country of El Salvador and was evaluated for abdominal pain. Due to her persistent symptoms, cholecystectomy was performed, without much relief of her symptoms. Patient reported that she was unable to take the initially prescribed esomeprazole secondary to financial issues and was not on any acid-suppressing medications in the previous 2 months. Upper endoscopy was then performed and it showed multiple gastric ulcers. She was then started on pantoprazole. After returning to the United States, she continued to have pain and started taking nonsteroidal anti-inflammatory drugs (NSAIDs) for relief. Subsequently, she visited her primary care office with worsening of her pain associated with nausea and vomiting. During this clinic visit, she was switched to dexlansoprazole and was asked to come to the emergency department if she continued to have symptoms. She returned to the emergency department the next day for further evaluation of her worsening symptoms. On initial evaluation in the emergency department, she was afebrile and had stable hemodynamics. She endorsed severe abdominal pain and a 30-pound weight loss over the last year, but denied any hematemesis, melena, or hematochezia. Laboratory evaluation revealed white blood cell count of 26.5 x 103/mm3, hemoglobin 13.8 g/dl, and platelet count of 116 x 103/mm3. On review of laboratory data, patient's last platelet count checked 6 months priorly was normal (264 x 103/mm3) and had been obtained before the patient was started on a PPI for the first time. No other laboratory tests had been obtained until this recent emergency department visit. Therefore, the effect of PPI on the platelet count for the next 6 months after initiation of therapy was not available to us. Chemistry panel, liver function, urinalysis, and blood/urine cultures were negative. CT imaging of the abdomen and pelvis showed diffuse steatosis but was otherwise normal. Gastroenterology was consulted and due to refractory abdominal pain, weight loss, and NSAID use, an upper endoscope was recommended. Additionally, intravenous esomeprazole twice daily was started. Her platelet count continued to drop, falling to 72 x 103/mm3 the next day and to 12 x 103/mm3 the day after. Hematology was consulted for the rapid drop in platelet count and the etiology was thought to be secondary to drug-induced thrombocytopenia, infection, or idiopathic thrombocytopenic purpura. Of note, the patient did not have any history of bleeding or clotting disorders. Additionally, there was no evidence of hemolysis on the peripheral blood smear and the patient was not coagulopathic. On review of medications, since there were no other drugs (except for one prophylactic dose of heparin) that could be attributed to thrombocytopenia, it was recommended to hold the PPI. The PPI was then stopped, and platelet count recovered to 99 x 103/mm3 within two days. Upper endoscope performed at that time revealed nonspecific gastritis. Biopsies were found to be negative for Helicobacter pylori infection. Due to the spontaneously improved platelet count, antibodies to heparin-platelet factor 4 complex were not checked to rule out heparin-induced thrombocytopenia. Since our patient's platelet count normalized after stopping PPI, this current episode of thrombocytopenia was deemed likely secondary to PPI use. Our patient was subsequently discharged home, but continued to have persistent epigastric pain. She tried a H2 (histamine 2) receptor antagonist with minimal symptom relief. She was next seen in the Gastroenterology Clinic. At this time, the platelet count was 135 x 103/mm3. During this visit, the question of whether patient's thrombocytopenia was truly related to PPI use was revisited, given that heparin-induced thrombocytopenia was not ruled out. Since a PPI was warranted due to her persistent symptoms, the decision was made to restart dexlansoprazole with close follow-up. She ultimately got readmitted to the hospital 7 days later for persistent epigastric pain (while on PPI). This time the platelet count was found to have decreased further to 43 x 103/mm3. The platelet count continued to drop, similar to her prior admission while on PPI, with the lowest count being 10 x 103/mm3. PPI was held because of prior concern for PPI-induced thrombocytopenia. On this admission, our patient did not receive any heparin products and peripheral blood smear was not consistent with hemolysis. She did not receive any medications known to cause thrombocytopenia. Platelet count improved to 50 x 103/mm3 while off PPI and she was discharged home. Patient's symptoms improved on H2 antagonist, sucralfate, and pain control with morphine. On this admission, PPIs were listed as a drug allergy and documented in the patient's medical record. She was seen in the Gastroenterology Clinic after hospital discharge and it was noted that her symptoms were partially controlled on H2 antagonist, sucralfate, and scopolamine (which she received from her home country for control of nausea). Platelet count ultimately improved to 415 x 103/mm3. A complete pictorial description of our patient's platelet count is shown in Figure 1.

PMC5715873_01

Female

A 29 year old nulliparous woman with a history of ovulation disorder was diagnosed as having primary infertility at her first visit. She failed to conceive despite receiving multiple courses of clomiphene citrate. Thus, the ovulation stimulation agent was switched from clomiphene to daily human menopausal gonadotropin (hMG) (basal luteinizing hormone, follicle-stimulating hormone, etc. were not calculated and the protocol of ovarian stimulation was unknown). An ultrasound examination revealed that her ovaries had enlarged to 6 cm in size (the follicular size and number were unknown and serum E2 was not calculated) after the initiation of hMG therapy. Human chorionic gonadotropin (hCG) (2500 U) then was used to trigger ovulation. On day 4 of hCG treatment, she presented with mild abdominal distention. An ultrasound examination revealed that the ovaries had enlarged to 11.6 cm in size. She was followed up on an outpatient basis due to the presence of mild ascites. On day 14 of hCG therapy, an ultrasound examination revealed no change in the bilaterally enlarged ovaries and an increase in the mild ascites. A pregnancy test was negative at the time. On day 22 of hCG therapy, the patient was admitted to her former hospital with severe abdominal distention and severe leg edema. An ultrasound examination revealed enlarged ovaries (left, 15.2 cm; right, 12.6 cm) and severe ascites. A chest X-ray showed severe pleural effusion. The patient was diagnosed with OHSS based on the clinical picture and the ultrasonographic evidence. A pregnancy test was positive and hypouresis of 155 mL/d was observed. She was therefore transported to Gifu University Hospital, Gifu, Japan. The woman's height was 166 cm and her body weight was 62.8 kg, which was 15.8 kg heavier than her usual weight. Her blood pressure was 105/77 mm Hg and her pulse rate was 90-100 beats/min. Her oxygen saturation level was 98% on room air and she was not febrile. She had a tender and markedly distended abdomen with prominent shifting dullness. An ultrasound examination revealed enlarged ovaries and severe ascites (Figure 1). She also had edema in the bilateral lower extremities. The initial laboratory results indicated mild hemoconcentration: hemoglobin, 12.6 g/dL; hematocrit, 36.1% (from a baseline hematocrit of 30%); serum creatinine, 0.64 mg/dL; albumin, 2.8 g/dL; and D-dimer, 2.0 mug/mL (Table 1). A chest X-ray film showed severe right pleural effusion (Figure 2). At the time of her admission (when her symptoms were mild), a 14 Fr Foley catheter was inserted intravesically and a central venous line was inserted to allow rapid initial hydration and to facilitate the strict monitoring of the patient's fluid intake, central venous pressure, and urinary output. Fluids (100-150 mL/h, extracellular fluid) and albumin (5%) were administered i.v. However, the patient's urinary volume did not increase and her central venous pressure did not recover. Furthermore, she began to experience dyspnea and her IAP, which was measured indirectly based on the intravesical pressure, was found to be significantly elevated (25 mm Hg). Ultrasound-guided paracentesis was performed and 2000 mL of ascitic fluid was drained. Following a 14 mm Hg decrease in intravesical pressure, the patient's urinary volume increased from 20-30 mL/h to ~150 mL/h. Finally, after the draining of 6000 mL of ascitic fluid, the patient's intravesical pressure dropped to 6 mm Hg and her urinary volume was maintained at 100-150 mL/h (Figure 3). Heparin was administered the following day because her laboratory data revealed that her D-dimer level had risen to 3.9 mug/mL; however, a computed tomography scan revealed no thromboembolic event and her hematocrit level remained at 32.8%. Subsequently, the patient's urinary volume progressively decreased to 10 mL/h. On day 7 of hospitalization, the patient's intravesical pressure was again found to be significantly elevated, at 24 mm Hg. A further 1500 mL of ascitic fluid was drained and the patient's urinary volume improved to 120 mL/h, following a 13 mm Hg decrease in intravesical pressure (Figure 3). Her condition improved and a fetal heartbeat was confirmed on day 35 of hCG therapy. The patient was discharged on day 25 of hospitalization. The patient's ovaries were normally sized at the 18th gestational week. Her condition remained favorable as the pregnancy progressed. The onset of labor occurred at 39 weeks and 3 days of pregnancy and she gave birth via natural vaginal delivery to a girl who weighed 3080 g.

abdominal compartment syndrome, disease management, intravesical pressure, intra‐abdominal pressure, ovarian hyperstimulation syndrome

PMC4323387_01

Female

A 24-year-old Japanese woman with one year history of active rheumatoid arthritis (RA) who complained in March 2007 with pain and swelling of bilateral wrists, elevation of the inflammatory markers such as C-reactive protein (CRP), erythrocyte sedimentation rate (ESR) and matrix metalloproteinase-3 (MMP3). The blood examination showed anti-agalactosyl IgG antibody CARF positive, which is known as the early diagnosis marker for RA (Das et al.). X-ray imaging showed particular bone erosions in the carpal bones of the hands and partially ankylosis of the carpal bones (Figure 1). RA diagnosis was met with the 1987 Rheumatoid Arthritis Classification. The combination of MTX (6-8 mg/week) and PSL (3 mg/day) was selected as an initial therapy for RA in September 2007. After that, however, disease activity was increased up to DAS28-CRP 5.1 (over right fingers, bilateral knees, right index middle ring PIP, and right ankle) and x-ray showed rapid destructive joints and high disease activity progression to Steinbrocker stage classification 3 within half a year after RA diagnosis. Then, she was referred to Takatsuki Red Cross Hospital for administration of anti-TNF-alpha inhibitor. Screening test was examined by included laboratory data with ECG, chest x-ray for excluding tuberculosis (Tbe), hepatitis C viruses (HCV) and hepatitis B viruses (HBV). Immunological examinations were tested for rheumatoid factor (RF) 22 U/ml, MMP-3 654 ng/ml, CRP 7.65 mg/dl, and ESR 35 mm/h. In August 2008, ADA (40 mg every other week) was administrated with MTX (8 mg/week). Seven days after receiving first administration of ADA, she showed rapid progression of sore throat, high fever and general lymph nodes swelling. Laboratory tests showed an elevated white blood cell count (WBC) 31800 (20.6% neutrophils and 63.7% lymphocytes without atypical lymphocytes), high level of CRP (3.3 mg/dl) and elevated liver-function tests with alanine aminotransferase level (53 U/L), aspartate aminotransferase (65 U/L), and gamma-glutamyltransferase (138 U/L). Evaluation of diagnosis with computed tomography (CT) and ultrasonography showed cervical and mediastinal lymph node swelling, multiple nodules measuring up to 13 mm in diameter in the lungs and mild hepatosplenomegary (Figure 2). An inguinal lymph node biopsy staining with hematoxylin and eosin staining (H&E staining) showed proliferation of the lymphatic cells without tumor cell phenotype (Figure 3A) and immunohistological studies with this examined inguinal lymph node revealed the lympho-proliferative CD20 positive cells (Figure 3B). H&E staining in high power filed showed the full range of mature lymphatic cells with polymorphous pattern and phagocytic macrophages included condensed small nuclear cells suggested apoptotic cell (Figure 3C). Besides, many lymphatic cells in the inguinal lymph node were positive with cleaved caspase 3 staining (Figure 3D). Moreover, EBV RNA in situ hybridization with the biopsy specimen revealed positive signals in the nucleus of large cells, and EBV DNA was detected by southern blot analysis (data not shown). Flow-cytometric analysis of infiltrating lymphocytes in lymph node showed an abundant population of CD38 positive B cell. In addition to routine blood test and urine cultures, the histories of infection were collected (e.g., HCV, HBV, tuberculosis, cytomegalovirus, parvovirus, varicella-zoster virus, HIV, EBV). The examinations for all these infections agents were negative except for high titers of anti-EBV antigen IgG (Table 1). Taken together these examinations, we diagnosed EB virus related B-cell LPD after the treatment with TNF-alpha inhibitor plus MTX, and that was in accordance with the 2008 WHO classification. Combination therapy with ADA plus MTX was terminated and pulse treatment with methylprednisolone was started. Steroid treatment for 7 days resulted in dramatic regression of LPD. Moreover, 10 days treatment with methylprednisolone reached to the complete remission of arthritis with below detection limits in ESR (3 ~ 11 mm/h), CRP (<0.3 mg/dl), and low level of MMP-3 (17.3 ~ 59.7 ng/ml) (Figure 4A and B). After the improvement of clinical symptoms and laboratory data, the administration of PSL was tapered off. She achieved drug-free with the reduction of EBV VCA-IgG titers (160 U/ml) 12 months after the emergent admission, and delivered healthy baby 2 years after discharge. She has completely attained drug-free Boolean remission for 5 years.

complete remission, lymphoproliferative disorder, rheumatoid arthritis, tumor necrosis factor alpha inhibitor

PMC8479966_01

Male

A 53-year-old male from Kerala, South India presented with loose stools, which were watery in nature and without blood, three-four episodes per day for 3 weeks. He complained of vague abdominal pain on and off, decreased appetite and weight loss of 3-4 kg over 1 month. He gave no history of associated fever, vomiting, urticarial rashes, or any respiratory symptoms. In addition to having alcohol use disorder, he was a known case of type II diabetes mellitus, hypertension and hyperlipidaemia and was on regular oral medications for the previous 2 years. He also experienced recurrent episodes of stroke, which resulted in a left-sided hemiparesis 2 years previously. He was also diagnosed as having pulmonary tuberculosis (sputum-positive), for which he had been on anti-tubercular therapy (ATT) for the previous 6 months. He denied intravenous (IV) drug abuse or any high-risk sexual behaviour. He was not on steroids or immunosuppressive drugs and gave no history of travel outside the state. He reported consumption of only cooked food and there was no food intolerance. All his family members were reported to be healthy. He was a cattle farmer and worked barefoot on his cattle farm; he also had a shallow pond near to his home where he used to grow freshwater fish for consumption. To his knowledge there was no practice of open field human defecation in the farm area. He was treated symptomatically at primary health care facilities and since there was no relief, he was referred to this tertiary care centre. On clinical examination, he was not febrile and vitals were within normal limits. He had bilateral pitting pedal oedema and macular erythematous rashes over the anterior aspect of both the legs for 2 weeks, which were non-migratory in nature. Systemic examination was normal. Routine blood investigations showed decreased haemoglobin (Hb) 9.6 %, elevated total count (TC) 13 600 cells cumm-1 with differential count (DC), polymorphs 90 %, lymphocyte 6 %, eosinophil 2 % and monocytes 2 %, an erythrocyte sedimentation rate (ESR) of 78 mm h-1, and serum electrolytes showed hypokalaemia (potassium - 2.6 meq l-1). His random blood sugar on admission was elevated (274 mg dl-1). He tested negative for viral markers of human immunodeficiency virus (HIV), hepatitis C virus (HCV) and hepatitis B virus (HBV). Ultrasonography (USG) of the abdomen showed fatty hepatomegaly with focal lesions in the liver, for which computed tomography (CT) of the abdomen and pelvis with contrast was performed. This showed several hypodense lesions involving segment 5 of the liver with mild hepatomegaly. CT of the lungs showed cavitation in the upper lobes of both lungs. Upper gastrointestinal endoscopy was performed, which was normal. Stool was sent for microscopy and bacteriological culture. Macroscopically, the stool was watery, yellowish coloured, with no mucus or blood. Wet preparation revealed numerous motile larvae in the rhabditiform stage, which measured 100-400 microm in lengthx15-20 microm in width and had a short buccal cavity. There were a few oval shaped eggs, ~50-60x30-35 microm in size, with larvae, suggestive of S. stercoralis. There were no pus cells or red blood cells. (Fig. 1) Stool microscopy following the formal ether concentration technique did not show any additional findings. Stool microscopy was repeated with freshly collected stool samples on three separate occasions, which also demonstrated motile rhabditiform larvae of S. stercoralis (Fig. 2). In addition, agar culture method was performed to visualize the positive trail sign. Nearly 2 g of freshly passed stool was placed on an agar plate. The plate was sealed with tape and then incubated at room temperature for 2 days. The plate was later examined and showed a 'positive trail sign', that is, there were tracks present as the bacteria were carried over the agar by the migrating larvae. The agar culture method was to be repeated after therapy, if microscopy of stool did not reveal larvae, as it is a more sensitive test for assessing the elimination of the parasite. The bacteriological culture of stool yielded Aeromonas sobria, which was sensitive to ciprofloxacin, chloramphenicol, tetracycline and cotrimoxazole. Stool occult blood (Hemospot kit, standard guaiac method, Tulip Diagnostics, Goa, India) and Clostridium difficile toxin (VIDAS difficile toxin A and B, bioMerieux SA) were negative. Hyperinfection syndrome with disseminated strongyloidiasis, alcoholic liver disease, type 2 diabetes mellitus, hypertension, dyslipidaemia and pulmonary tuberculosis. Therapy included blood sugar and electrolyte correction and the patient was empirically started on ciprofloxacin intravenously (IV) along with parenteral fluids and other supportive measures. Following the stool microscopy report, a stat oral dose of a combination of albendazole 400 mg and ivermectin 6 mg, followed by once daily for 2 days, was given. The patient was continued on ciprofloxacin IV for 4 days. He showed symptomatic improvement by the second day of treatment, his stool became semisolid in consistency and the number of motile larvae in fresh stool showed an appreciable reduction. He was discharged after 4 days on mixtard insulin and oral ciprofloxacin 500 mg twice daily for 3 days. The patient was readmitted on the third day of discharge with complaints of fever and recurrence of diarrhoea. His blood sugar value at the time of readmission was again elevated (210 mg dl-1). His total leucocyte count (TLC) was 12 000 cumm-1, with polymorphs 60 %. His blood was sent for culture and empirical therapy was initiated with injected piperacillin/tazobactam and mixtard insulin. Unfortunately, on day 2 of readmission he expired. Escherichia coli was isolated from his blood culture 3 days after his readmission, sensitive to cephalosporins, carbapenems, piperacillin/tazobactam and aminoglycosides, but resistant to ciprofloxacin, which he was discharged on for the Aeromonas infection.

aeromonas sobria, strongyloides stercoralis, disseminated strongyloidiasis, hyperinfection syndrome

PMC5709055_01

Male

A 46-year-old male was admitted to hospital for treatment of recurrent pericarditis. The patient was hospitalized for treatment of acute pericarditis in 2006 complaining of chest and right shoulder pain. Other complaints at that time included a mild cold and fever lasting for several days prior to admission. The blood test showed leukocytosis - WBC 11.08 x 109/l (with a shift to the left) and elevated CRP 86.5 mg/l. The electrocardiogram (ECG) showed a sinus rhythm, ST segment elevation in leads I, II, III, and aVF. ECG findings remained without any changes during the hospitalization period. Mild left ventricular hypertrophy and impaired left ventricular diastolic function were seen on the transthoracic echocardiogram (TTE). The patient's condition improved with the administration of non-steroidal anti-inflammatory drugs (NSAIDs) and he was discharged after a nine-day stay in hospital with complete resolution of symptoms. Three months after discharge, the patient was brought to the emergency department complaining of chest pain and shortness of breath present at limited physical activity and at rest. Other complaints included palpitations and fever as high as 38.5 C. The ECG showed sinus tachycardia with inverted T-wave in all ECG leads. The TTE showed pericardial effusion distributed around the heart (0.8-1 cm). Leukocytosis with a shift to the left and elevated CRP were present (WBC 12.8 x 109/l, CRP - 203 mg/l). Based on this clinical picture, recurrent pericarditis was diagnosed and the patient was hospitalized. The patient developed renal insufficiency during the period of admission (serum creatinine was 168 micromol/L). The renal function recovered after stimulating diuresis. The patient received treatment with NSAIDs (diclofenac) and 6 million units of penicillin per day intravenously. The chest computed tomography (CT) scan performed before discharge from hospital revealed a thickened pericardium of 4 mm and fibrotic changes is both lungs. A conclusion that a disease relapse occurred, most likely, due to patient terminated treatment of acute pericarditis earlier against medical recommendation was made. Because of a slow onset, prolonged disease course, fibrotic heart and lung changes on the CT, tuberculous pericarditis was suspected but as tuberculosis was not confirmed, this diagnosis was ruled out. Seven days from admission to the hospital the patient's condition improved and he was discharged. Patient had no complaints after hospitalization. In 2016, ten years after the treatment of recurrent pericarditis, the patient was brought by ambulance to Vilnius University Hospital Santaros klinikos with chest discomfort relieved with nitroglycerin. Other relative symptoms included shortness of breath, weakness, and fever as high as 38 C with chills. The patient had a history of smoking and was suffering from hypertension. On admission, the patient had fever of 38.1 C, blood pressure was 130/80 mmHg, pulse - 100 beats per minute, no murmur was noted on examination, and no oedema of the limbs was present. The blood test showed leukocytosis with a shift to the left (WBC 13.66 x 109/l), elevated CRP - 42.4 mg/L, and D-dimer - 800 mkg/L levels. In the emergency department, cardiac-enzyme levels were found to be normal. Based on laboratory findings, the patient's medical history, and the data of previous hospital admissions, recurrent pericarditis was suspected and the patient was hospitalized for further treatment and clinical investigation. The patient's high fever persisted, so blood and urine culture tests were done but both were negative for bacteria. The ECG showed sinus tachycardia and an inverted T wave in leads V1-V6 (Figure). A moderate-sized pericardial effusion (1.7 cm) was seen on the TTE. The patient received Sol. Amoxiclavi 1.2 g twice daily, NSAIDs (prolonged-release diclofenac tablets 75 mg per day), oral perindopril, beta-blockers, and Aspirin. The patient's condition improved with the prescribed treatment, and the fever and inflammation markers started decreasing: leukocytosis 13.66 13 10.45 x 109/l, CRP 42.4 33.5 9.8 mg/L. A repeat TTE showed moderate-sized and hemodynamically insignificant pericardial effusion (less than 1 cm echo-free space apically and around the left atrium). ECG showed a sinus rhythm without other significant changes. The patient was discharged six days from admission to hospital with complete resolution of the symptoms. He was recommended to continue taking aspirin and beta-blockers, and to continue the treatment of hypertension. The patient was also urged to give up smoking and to control his body weight, and benefits of regular physical activity were also emphasized. The patient had no complaints of chest pain since the latest hospital admission; hypertension was controlled adequately.

acute pericarditis, fever, leukocytosis, recurrent pericarditis, transthoracic echocardioscopy

PMC9196303_01

Male

A 17-year-old boy with acute myeloid leukaemia (AML) received an allo-HSCT from a human leukocyte antigen-matched sibling donor in May 2020. The conditioning regimen consisted of cytarabine, busulfan, cyclophosphamide, and porcine antilymphocyte globulin (p-ALG), with graft-versus-host disease (GVHD) prophylaxis of cyclosporine A (CsA), mycophenolate mofetil (MMF), and short-course methotrexate (MTX). Oral voriconazole was administered as prophylaxis for possible fungal infection, maintaining the trough level between 2 and 5 mg/L after transplantation. Neutrophil and platelet engraftment was achieved on day 17 (day + 17) and day + 19 after allo-HSCT, respectively, and the patient was safely discharged on day + 20. The initial post-transplantation course was uncomplicated, and stable donor chimerism was achieved from day + 43. On day + 52, the patient was hospitalised for nausea, vomiting, abdominal pain, and severe watery diarrhoea (35 ml/kg/24 h) without fever or liver dysfunction. Paediatric colonoscopy with multiple biopsies confirmed the diagnosis of overall grade IV acute GVHD in the gastrointestinal tract. Methylprednisolone (2 mg/kg/day), tacrolimus (1 mg/day), and basiliximab (20 mg/dose/week) were promptly administered intravenously to prevent worsening of GVHD, in addition to parenteral nutrition and anti-diarrhoeal agents. Clinical conditions gradually improved, and a second endoscopy showed a smooth colonic mucosa without any residual signs of GVHD. On day + 114, the patient was discharged from the hospital. On day + 123, the patient was readmitted for fever and anorexia without headache or diarrhoea. Computed tomography (CT) scan of the chest (Figure 1) revealed a new right upper lobe defined nodule (17 x 15 mm) surrounded by a ring of consolidation. Blood tests (Table 1) revealed a C-reactive protein level (CRP) of 208.9 mg/L [normal range (NR), <= 5 mg/L], with 7.19 x 109/L white blood cells (NR, 3.5-9.5 x 109/L) and 97 x 109/L platelets (NR, 125-350 x 109/L). Microbiological tests, including cultures and polymerase chain reaction (PCR) for pathogens, failed to identify any agents. Bone marrow evaluation revealed normal myeloid maturation without any signs of disease recurrence or acute GVHD and full-donor chimerism. He was treated empirically with intravenous voriconazole, acyclovir, imipenem, and linezolid. Three days later, the CRP level had decreased to 149 mg/L, but the patient's condition did not improve, and the patient developed a cough. The patient's blood sample was then sent to the Beijing Genomics Institute (BGI)-Wuhan for pathogen detection via next-generation sequencing (NGS). Two days later, NGS of the blood confirmed the presence of C. bertholletiae genetic material. Intravenous liposomal amphotericin B (LAmB, 1.14 mg/kg/day) and oral posaconazole delayed-release tablets (300 mg/dose, twice daily for 24 h loading dose, followed by 300 mg/dose/day maintenance) were promptly started on day + 132, along with a switch of antibiotic therapy from imipenem and linezolid to benzylpenicillin. Six days later, the patient's temperature was normal, and the cough decreased noticeably, but he experienced persistent headache and violent mood swings. A follow-up brain magnetic resonance imaging (MRI; Figure 2) identified signal abnormalities suggestive of left-side basal ganglia abscesses (28 x 18 mm) and signs of perifocal oedema. No bacteria, viruses, Mycobacterium tuberculosis, or mycoplasma was detected via NGS in the cerebrospinal fluid (CSF), but C. bertholletiae was detected. CSF studies revealed negative minimal residual disease (MRD) with flow cytometry analysis. A diagnosis of overall disseminated mucormycosis caused by C. bertholletiae involving the lung and intracranial basal ganglia was made. A multidisciplinary team made the decision for surgical treatment for intracranial mucormycosis after assessing patient characteristics, the biology of C. bertholletiae, underlying disease, risks, and side effects. On day + 141, the patient was referred to the neurosurgery team for an intracranial debridement, along with the same antifungal therapy. NGS of the resected specimen was also positive for C. bertholletiae and confirmed the diagnosis of disseminated mucormycosis. After surgery, the patient's clinical condition markedly improved, especially the fractious mood, and normal neurological function was restored without any other abnormalities. He recovered well post-operation without recurrent C. bertholletiae infection or neurologic sequelae. One month later, he was discharged with continued antifungal combination therapy outside the hospital. On day + 258, the intravenous LAmB and oral posaconazole delayed-release tablets were switched to maintenance monotherapy of posaconazole (300 mg/dose/day) for about 10 months. During the combination therapy, only mild adverse effects, including abdominal symptoms and anorexia, were observed, none of which necessitated the cessation of antifungal drugs. The patient showed good adherence and tolerance to posaconazole without any adverse events in the maintenance monotherapy. Throughout the treatment, he maintained a good clinical condition with no reoccurrence of symptoms. At the 13-month follow-up visits, his neurologic examinations remained stable, and the surgical site appeared to be healing well with clean wound margins. The preoperative and postoperative lesion volume changes were evaluated using brain MRIs (Figure 2) and demonstrated a gradual reduction. Regular CT scans of his chest (Figure 1) revealed that the original right upper lobe nodule disappeared completely. Repeated NGS tests of the blood and CSF showed normal results. Currently, all laboratory test results (Table 1), except for slight serum creatinine increases, were determined to be within normal limits, and the patient was in good health.

hsct, benefits, cunninghamellamycosis, intracranial basal ganglia, surgical treatment

Computed tomography (CT) scan of the chest. (B) On day + 123, the patient developed a fever and anorexia, and chest CT revealed a new right upper lobe defined nodule (17 x 15 mm) surrounded by a ring of consolidation.

PMC9196303_01

Male

A 17-year-old boy with acute myeloid leukaemia (AML) received an allo-HSCT from a human leukocyte antigen-matched sibling donor in May 2020. The conditioning regimen consisted of cytarabine, busulfan, cyclophosphamide, and porcine antilymphocyte globulin (p-ALG), with graft-versus-host disease (GVHD) prophylaxis of cyclosporine A (CsA), mycophenolate mofetil (MMF), and short-course methotrexate (MTX). Oral voriconazole was administered as prophylaxis for possible fungal infection, maintaining the trough level between 2 and 5 mg/L after transplantation. Neutrophil and platelet engraftment was achieved on day 17 (day + 17) and day + 19 after allo-HSCT, respectively, and the patient was safely discharged on day + 20. The initial post-transplantation course was uncomplicated, and stable donor chimerism was achieved from day + 43. On day + 52, the patient was hospitalised for nausea, vomiting, abdominal pain, and severe watery diarrhoea (35 ml/kg/24 h) without fever or liver dysfunction. Paediatric colonoscopy with multiple biopsies confirmed the diagnosis of overall grade IV acute GVHD in the gastrointestinal tract. Methylprednisolone (2 mg/kg/day), tacrolimus (1 mg/day), and basiliximab (20 mg/dose/week) were promptly administered intravenously to prevent worsening of GVHD, in addition to parenteral nutrition and anti-diarrhoeal agents. Clinical conditions gradually improved, and a second endoscopy showed a smooth colonic mucosa without any residual signs of GVHD. On day + 114, the patient was discharged from the hospital. On day + 123, the patient was readmitted for fever and anorexia without headache or diarrhoea. Computed tomography (CT) scan of the chest (Figure 1) revealed a new right upper lobe defined nodule (17 x 15 mm) surrounded by a ring of consolidation. Blood tests (Table 1) revealed a C-reactive protein level (CRP) of 208.9 mg/L [normal range (NR), <= 5 mg/L], with 7.19 x 109/L white blood cells (NR, 3.5-9.5 x 109/L) and 97 x 109/L platelets (NR, 125-350 x 109/L). Microbiological tests, including cultures and polymerase chain reaction (PCR) for pathogens, failed to identify any agents. Bone marrow evaluation revealed normal myeloid maturation without any signs of disease recurrence or acute GVHD and full-donor chimerism. He was treated empirically with intravenous voriconazole, acyclovir, imipenem, and linezolid. Three days later, the CRP level had decreased to 149 mg/L, but the patient's condition did not improve, and the patient developed a cough. The patient's blood sample was then sent to the Beijing Genomics Institute (BGI)-Wuhan for pathogen detection via next-generation sequencing (NGS). Two days later, NGS of the blood confirmed the presence of C. bertholletiae genetic material. Intravenous liposomal amphotericin B (LAmB, 1.14 mg/kg/day) and oral posaconazole delayed-release tablets (300 mg/dose, twice daily for 24 h loading dose, followed by 300 mg/dose/day maintenance) were promptly started on day + 132, along with a switch of antibiotic therapy from imipenem and linezolid to benzylpenicillin. Six days later, the patient's temperature was normal, and the cough decreased noticeably, but he experienced persistent headache and violent mood swings. A follow-up brain magnetic resonance imaging (MRI; Figure 2) identified signal abnormalities suggestive of left-side basal ganglia abscesses (28 x 18 mm) and signs of perifocal oedema. No bacteria, viruses, Mycobacterium tuberculosis, or mycoplasma was detected via NGS in the cerebrospinal fluid (CSF), but C. bertholletiae was detected. CSF studies revealed negative minimal residual disease (MRD) with flow cytometry analysis. A diagnosis of overall disseminated mucormycosis caused by C. bertholletiae involving the lung and intracranial basal ganglia was made. A multidisciplinary team made the decision for surgical treatment for intracranial mucormycosis after assessing patient characteristics, the biology of C. bertholletiae, underlying disease, risks, and side effects. On day + 141, the patient was referred to the neurosurgery team for an intracranial debridement, along with the same antifungal therapy. NGS of the resected specimen was also positive for C. bertholletiae and confirmed the diagnosis of disseminated mucormycosis. After surgery, the patient's clinical condition markedly improved, especially the fractious mood, and normal neurological function was restored without any other abnormalities. He recovered well post-operation without recurrent C. bertholletiae infection or neurologic sequelae. One month later, he was discharged with continued antifungal combination therapy outside the hospital. On day + 258, the intravenous LAmB and oral posaconazole delayed-release tablets were switched to maintenance monotherapy of posaconazole (300 mg/dose/day) for about 10 months. During the combination therapy, only mild adverse effects, including abdominal symptoms and anorexia, were observed, none of which necessitated the cessation of antifungal drugs. The patient showed good adherence and tolerance to posaconazole without any adverse events in the maintenance monotherapy. Throughout the treatment, he maintained a good clinical condition with no reoccurrence of symptoms. At the 13-month follow-up visits, his neurologic examinations remained stable, and the surgical site appeared to be healing well with clean wound margins. The preoperative and postoperative lesion volume changes were evaluated using brain MRIs (Figure 2) and demonstrated a gradual reduction. Regular CT scans of his chest (Figure 1) revealed that the original right upper lobe nodule disappeared completely. Repeated NGS tests of the blood and CSF showed normal results. Currently, all laboratory test results (Table 1), except for slight serum creatinine increases, were determined to be within normal limits, and the patient was in good health.

hsct, benefits, cunninghamellamycosis, intracranial basal ganglia, surgical treatment

Computed tomography (CT) scan of the chest. (F) On day + 540, the chest CT revealed that the original right upper lobe nodule disappeared completely.

PMC9062947_01

Male

A 58-year-old male with medical history of autoimmune deficiency syndrome, hypertension, diabetes mellitus, polysubstance abuse disorder, psychogenic movement disorder, and antiphospholipid antibody syndrome presented to emergency department (ED) with altered mental status. Initial computed tomography (CT) head without contrast was negative for hemorrhage. The ED proceeded with performing a LP to obtain cerebrospinal fluid (CSF) for the diagnostic purpose of ruling out meningitis and HIV encephalitis. The LP yielded 20cc of bloody CSF. Of note, patient was on Coumadin for antiphospholipid syndrome and had an international normalized ratio of 2.0 and prothrombin time of 19.8. The ED failed to reverse his warfarin before performing the LP and the patient developed headache soon after, which sustained for the next few days. A second CT of the head without contrast was completed 48 h after the LP, for sustained headache and development of somnolence, which demonstrated diffuse SAH with intraventricular extension [Figure 1]. The patient was transferred to the intensive care unit for close neurological monitoring. The patient subsequently developed low back pain, lower extremity weakness with radiculopathy, and urinary retention. Magnetic resonance imaging of the lumbar spine demonstrated ventral extra-axial hematoma measuring 1.3 cm with compression of the cauda equina most severely at L2-L3 level [Figure 2]. Neurosurgery was consulted and the patient was taken to surgery for emergent decompression of the hematoma. Intraoperatively, the dura was tense with a durotomy noted and both intradural and extradural hematomas were evacuated. The patient's mental status remained altered postoperatively with additional deficits of the upper extremity weakness on postbleed day 13. Transcranial Doppler (TCD) demonstrated elevated intracranial velocities (right middle cerebral arteries [MCA] velocity 251 cm/s, right posterior cerebral artery velocity 104.1 cm/s, and left MCA velocity 162.1 cm/s). Lindegaard ratio was 8.7 and 4.6 on the right and left, respectively. CT angiogram revealed moderate-to-severe narrowing of bilateral MCA and anterior cerebral arteries vessels as well as moderate narrowing of the basilar artery. Patient was started on hyperdynamic therapy and underwent a cerebral angiogram for delivery of intra-arterial spasmolytic therapy, which resolved the radiographic vasospasms [Figure 3]. Throughout his hospital course, the patient underwent one additional intra-arterial spasmolytic treatment for clinical vasospasm on postbleed day 15. At that time, patient had recurrent weakness of the upper extremities as well as TCD findings suggestive for vasospasm. The patient was discharged from the hospital 45 days after admission after completing a 3-week course in the neurocritical care unit for close observation for any subsequent vasospasm and followed by rigorous inpatient physical therapy. At discharge, the patient's upper extremity weakness had resolved, but he remained paretic in the lower extremities. He was able to feed and groom himself independently and transfer himself from bedside to wheelchair (modified Rankin score [mRS] 4). At 2-year follow-up, the patient had improvement in his lower extremity strength with some deficits noted (mRS 2).

cerebral vasospasm, lumbar puncture, spinal hematoma

PMC7569431_01

Male

Our patient is a 24-year-old black male, who presented to us for the evaluation of persistent abdominal pain, diarrhea, and weight loss. He describes a six-month history of episodic, diffuse, and crampy abdominal pain. Each episode would last about five to ten minutes and was mild to moderate in intensity. The pain would resolve spontaneously, and there were no associated symptoms, aggravating, or alleviating factors. Three months prior to his presentation, he started experiencing loose, watery diarrhea which would occur every two to three days. He described having three to four loose bowel movements per day, with no presence of mucus or blood. He also complained of anorexia and a 10 lb weight loss over the previous three months. A comprehensive review of systems was otherwise negative. He denied any fever, chills, or any relation of his diarrhea to food intake, and there was no history of nocturnal diarrhea. There was no recent antibiotic use and no history of recent travel or sick contacts. He denies any joint pain, skin rash, or mouth ulcers. There was no history of shortness of breath, cough, wheezing, chest pain, or urinary symptoms. His past medical history was significant for Lyme disease in childhood and attention-deficit hyperactive disorder. There was no history of surgery in the past. He denied any history of smoking, alcohol use, or recreational drug use. There was no family history of inflammatory bowel disease (IBD), colon cancer, or any other GI malignancies. On physical examination, the patient appeared malnourished, evident by temporal wasting. His vital signs were generally unremarkable. He weighed 134 lb (60.8 kg) which puts him at a BMI of 17.80 kg/m2. Examination of the gastrointestinal system was unremarkable, with a soft, nontender abdomen, with no visceromegaly. There was no scleral icterus or conjunctival pallor. The remainder of the physical exam was normal. Results of routine hematology and biochemistry investigations including liver enzymes were all within normal limits. Celiac serology was negative, and stool workup including fecal leukocytes, stool culture, ova and parasites, giardia, and cryptosporidium were all negative. His carcinoembryonic antigen (CEA) was within normal limits. Colonoscopy showed a circumferentially encasing, partially obstructing, stenotic mass, with overlying granular and inflammatory mucosa in the hepatic flexure (Figures 1(a)-1(c)). The colonoscope could not be negotiated through the mass to evaluate the cecum. The colonic biopsy revealed soft consistency of the mass, and there was excess of bleeding from the biopsy site (Figure 1(c)). The colonic mucosa of the remaining part of the colon appeared normal, and random colon biopsy was obtained. The histopathology of the hepatic flexure mass was significant for focal active chronic colitis with ulceration, polypoid granulation tissue formation, reactive epithelial changes, and noncaseating granulomata formation that was consistent with granulomatous inflammation (Figure 2(a)). Special stains for tuberculosis, fungi, and other microorganisms were all negative. The crypt architecture was preserved (Figure 2(c)), and the histopathological findings were devoid of the basal cell plasmacytosis to conclude to inflammatory bowel disease. Esophagogastroduodenoscopy was performed and was unremarkable; biopsies of gastric and duodenal tissues and subsequent testing for Helicobacter pylori infection, celiac disease, and Whipple disease were all negative. An abdominal CT scan of the abdomen performed with contrast was remarkable for circumferential thickening of the cecum and ascending colon without any evidence of obstruction. There were perihepatic and pelvic ascites in the cul-de-sac and nodular thickening of the peritoneum in the right lateral abdominal wall and minimally at the omentum. The patient subsequently underwent a laparoscopic peritoneal biopsy. The biopsy specimen showed noncaseating granulomas and confluent granulomatous inflammation. Special stains for tuberculosis and fungi were negative. A CT scan of the chest was performed and revealed a slightly irregular 1 cm pulmonary nodule in the superior segment of the right lower lobe. The area of nodular sarcoid cannot be excluded. There was also minimal fissural nodularity which could represent underlying sarcoid. A diagnosis of colonic sarcoidosis was made, and the patient was treated medically with oral prednisone, starting at 40 mg daily for one week with a gradual taper to a target maintenance dose of 5 mg daily over the course of eight weeks. Upon starting prednisone, the patient improved clinically with the resolution of his abdominal pain and diarrhea, along with a 20 lb weight gain, and remained in sustained symptomatic remission after three months of treatment. A colonoscopy performed five months after treatment revealed interval improvement of colonic stenosis resolution of the inflammatory mass, and the scope could be traversed through the stricture (Figure 3(a)). Some mucosal inflammation and granularity could be noted; however, there was significant improvement as compared to the index colonoscopy (Figure 3(b)). The biopsy specimens from the previously involved areas showed chronic mucosal injury with no evidence of dysplasia, malignancy, or noncaseating granulomas (Figure 4).

PMC10069403_01

Male

A 26-year-old male professional soccer player with no previous history of injuries sustained a traumatic right knee injury. The player had a history of having played 300 professional matches as a midfielder / forward. He was a predominately right footed player and had an average playing mass of 78kg and height of 176cms. Mid-way through the first half of a competitive match he received shoulder contact from an opposing player during a deceleration action. This contributed to a change in the following two to three steps of his normal deceleration pattern forcing his right knee into the classic dynamic valgus position of abduction, flexion, and internal rotation. The knee was in the 'position of no return' leading to an instant rupture of the ACL. After being removed from the field of play the initial examination showed reduced range of knee flexion 80 and an unwillingness to actively or passive extend the knee into hyperextension. The ACL was absent on Lachman testing and the player was experiencing high levels of pain 7-8/10 on a numerical rating scale. Within 48 hours a magnetic resonance imaging scan (MRI) was performed which confirmed a full thickness rupture of the ACL and partial thickness tears of the posterior horn to the medial and lateral menisci. The PCL and collateral ligaments were intact and there was no chondral damage. Within seven days the player was assessed by an orthopaedic surgeon and the decision was made to have a surgical intervention. The plan was clearly outlined to the player: it would take a minimum of nine months to return to competitive sport and there was a 30-40% chance the medial meniscus repair might fail and require a further surgical intervention at some stage. The surgical opinion was that initially repairing the medial meniscus would reduce the tension on the harvested ACL graft in the early phases of the rehabilitation process. The player underwent a successful 90-minute operation during which the surgeon harvested a four-strand autologous hamstring semitendinosus and gracilis graft from the contralateral limb (left leg). This was inserted into the right knee as the new ACL. The player underwent meniscal repair of the posterior horn sections of both the medial and lateral menisci. The player initially completed eight months of ACL rehabilitation. In accordance with Buckthorpe and Della Villa s work this consisted of three distinct stages of ACL rehabilitation. Stage 1 was the early stage (Figure 1, gym Phases 2 and 3) where focus was placed on the player reducing pain and swelling and recovering normal gait and activities of daily living. Following this, the player went into the mid-stage (Figure 1, gym Phases 4 and 5) to regain muscular strength, power, and movement quality before entering the final sports specific stage to redevelop the underling explosive qualities and necessary soccer qualities to perform with the team. At the eight-month stage (Figure 1, grass Phase 2) despite the player completing HSR and COD drills on the grass the player felt a sharp pain in the medial aspect of the right knee during some routine hopping exercises. An MRI revealed he had re-torn the surgically repaired posterior horn of the medial meniscus. This distinct possibility had been outlined from day 1 so despite initial disappointment and frustration it was not a shock to the player or his support team. The player underwent the necessary medial meniscectomy of the posterior horn, and the following outlines the 10-week rehabilitation the athlete engaged in after the meniscectomy, in order to return to competitive soccer. The aim of the first 3 phases (Figure 1) were to set the expectations and prepare the player for the loading and progressive gym Phase 4. Holistic care begins in all injuries during Phase 1 (diagnosis and planning). In this case the player underwent the necessary scans, consultations, and a surgical intervention to the posterior horn of the medial meniscus of his right knee. A routine surgical operation excised the small section of the posterior horn that was loose and simultaneously allowed for an arthroscopic examination of the previously reconstructed ACL and the lateral meniscus that were both reported to be healing well. Absolute clarity in communication between all members of the MDT during Phase 1 was paramount. The player and his support team inside and outside of the club along with the coaches were given clear understandable information about what had happened and the process ahead. Addressing and agreeing on the expectations of all the key people helps to start the process in a realistic and unison manner. The acute and contralateral limb loading Phase (Figure 1 - Phase 2) lasted for the first seven days post-surgery. Wound management was prioritized along with daily use of the game ready (Model GRPro 2.1, Betchworth House 57-65 Station Road Redhill. RH1 1DL. UK.) to reduce post-surgical swelling and pain. Effleurage massage and range of motion exercises were used to restore mobility especially into knee flexion and extension and to reduce the formation of a capsular contraction. Controlled non-weight bearing exercises and the Compex muscle stimulator (electrical muscular stimulation was performed with model No SP 8.0, MI-scan, wireless, 120 mA, 400 us, 150 Hz. Guildford, Surrey, GU2 8XG, UK.) were used to address muscular atrophy and regain normal muscular recruitment patterns. Also in this Phase, contralateral limb exercise training and cardiovascular conditioning (seated battle ropes, boxing, upper body circuits, core and arm bike) sessions were completed to complement the nutritional advice given (provided by team nutritionist) and to maintain team involvement for the player wherever possible. This player exited gym Phase 2 at seven days post-surgery. For this, he exhibited full knee extension, flexion of >125 , the grading of a trace of joint effusion measured by the stroke test (Scale - Zero = No wave produced on downstroke. Trace = Small wave on medial side with downstroke. 1+ = Larger bulge on medial side with downstroke. 2+ = Effusion spontaneously returns to medial side after upstroke [no downstroke necessary]. 3+ = So much fluid that it is not possible to move the effusion out of the medial aspect of the knee) and a pain level never above 2/10 on a numerical rating scale. He had strictly adhered to the prescribed protocol, was competent in his non-weight bearing exercises and had subsiding pain and swelling levels. Patience within and respect during these first two phases allowed the player to appropriately start the gym Phase 3. With a low pain score (<2/10 numerical rating scale) and trace joint effusion the player progressed into the gym Phase 3 to start early loading and regain normal movement patterns (Figure 1). Competency in the fundamental weight bearing exercises and gait variations was the primary goal of this phase. Firstly, he completed the key exercises like squats, lunge patterns, Roman deadlifts (RDL), heel raises, and gait exercises with reduced body weight in the pool and was then transitioned to the gym. Movement quality was deemed to be a key factor and assessed visually to ensure there was no loss of balance, contralateral hip drop, ipsilateral knee valgus or any excessive trunk movement. During gym Phase 3 the player was required to complete 3 sets x 8 repetitions with normal movement strategies and no post-session reaction to be able to start gym Phase 4. By day 10 the player had achieved these criteria and could start the rehabilitation pathways outlined in gym Phase 4 (Figure 2). Experience suggests premature entry into gym Phase 4 will lead to recurrent episodes of swelling, pain and compensatory movement strategies that reduce the players well-being and overall confidence. This phase started at the 10-day mark post-surgery and continued into week four when the player started to complete the necessary gym exit profiling tests in gym Phase 5. The aim of gym Phase 4 was to expose the injured lower extremity to different physical demands through the variety of rehabilitation pathways outlined in Figure 2. The pathways are clearly outlined in a progressive manner as the demands increase in a step-by-step fashion ensuring the player and the injury can safely perform the profiling tests in gym Phase 5. During gym Phase 4 not all the rehabilitation pathways were worked on each day as a DUP theme was applied throughout the week (Figure 3). For this player a normal working week consisted of rehabilitation days on Monday and Tuesday with Wednesday set as regeneration day. Similarly, Thursday and Friday were rehabilitation days and often Saturday was free to work on any specific aspects as required. Sunday was traditionally set as a day off which was aligned with normal team training schedules. The aim of the undulated process was to expose the player to the most complex and neuromuscular challenging demands at the start of the session and the safer exercises towards the end of the session when arguably he was more fatigued. Similarly, the player completed more neuromuscular challenging pathways (indoor ball skills pathways, plyometric pathway, maximum strength pathway, IKD pathways and anaerobic and upper body type conditioning) on Monday and Thursdays when the player was most fresh compared to lower intensity and higher volume type sessions on Tuesday and Fridays (running preparation pathway, injury specifics pathways, capacity pathway, aerobic conditioning and core exercises) when the player had worked the previous day (Figure 3). During gym Phase 4 there were eight key rehabilitation pathways to follow. The manner in which six of these progressed is highlighted in Figure 4. In the capacity pathway the player completed multiple exercises in his regular sessions but was critically assessed in five key SL exercises (squat, calf raise gastrocnemius bias and soleus bias and hamstring bridge in 90 and 30 ). These are progressed from 3 sets of 8 repetitions to 2 sets to fatigue which was completed in the gym exit profiling in gym Phase 5. Gradually increasing the repetitions and sets developed a local muscular endurance and robustness in the joint to withstand the loads in preparation for the grass phases ahead. Strength was addressed in the maximum strength and IKD pathways. With all strength progressions the repetitions were reduced as the load was increased. Again, the player had a variety of exercises for the posterior and anterior chain but was critically assessed in the SL leg press, RFESS, trapbar deadlift, and the barbell floor thrust. Accompanying this the IKD pathway was initiated on the treatment table with manual resistance as the therapist resisted knee flexion and extension through range. This was then progressed to the IKD machine where initially quicker speeds (low joint forces) were employed. These contraction speeds were gradually decreased from 180 /s to 60 /s as the player ended by completing the traditional 3-speed profiling (60,180 300 /s) at the end of gym Phase 4 ready for the gym exit profiling in gym Phase 5. The players power and RFD qualities were also introduced early in gym Phase 4. They were initially started through the introduction of the plyometric pathway which involved the player completing a drop series of squats and lunges in the pool on Mondays and Thursdays (Figure 3). This was progressed to the land with simple landings from a step and box (altitude landings). As the plyometric pathway progressed the introduction of the hop battery which consisted of the SL horizontal hop, triple hop, medial and lateral hop for distance tests as described by Ebert et al, and force plate jump profiling which consisted of DL and SL countermovement jump, along with DL and SL drop jumps leading into week four which included some of the types of simple hopping techniques the player was doing. The use of the force plates enabled the analysis of the relative force, RFD and interlimb asymmetries for example, to be compared to preinjury standards. Despite ongoing improvement and monitoring these qualities cannot be completely restored without the necessary grass speed exposures later in the process. Movement patterns through the running preparation pathway were also completed specifically on Tuesday and Fridays (Figure 3.) as the number of ground contacts increased from 100 in the first session to 600 by the end of gym Phase 4. Every time the foot hit the ground it was counted and calculated as a sum for the total session. This progressed from simple wall drills and sled walks to A skip (a skipping pattern in a linear direction emphasizing the hip drive phase of running) variations. By week 4 the player had increased the number of ground contacts so he was able to start gym Phase 5 where he would be expected to complete 800-1000 ground contacts in a session. This along with two running introduction sessions (60-75% progressing to 95% body weight) on the anti-gravity treadmill (Alter-G, Fremont, CA, USA.) further highlighted his readiness for the grass phases. Gym Phase 4 encompassed the rehabilitation pathways and progressions and in this case lasted from 10 days into week 4. These step-by-step increases in each of the pathways emphasized the design of graded exposure and also the variability created through the different pathways. The player improved in his local muscular endurance (capacity pathway) and strength (maximum strength and IKD pathways). He also started to develop his power and RFD qualities (plyometric pathway). By adding the movement qualities that were practiced in his running preparation pathway and indoor balls skills pathway he was starting to develop a level of confidence in the gym. This self-confidence came from being pain free not only in these but in the wide variety of exercises and movements that gym Phase 4 included. Having successfully completed the gym Phase 4 rehabilitation pathways described (Figure 2) he was ready to enter the gym Phase 5 (gym exit profiling). The most common question a player asks at the start of the rehabilitation process is "when I can start running on the grass?" Gym Phase 5 has been specifically designed using objective tests to answer this question. The player had complete familiarity with the profiling modalities as they were gradually introduced throughout gym Phase 4. These standardized and repeatable profiling tests such as the hop test battery and force plate jumps were conducted regularly by all squad members as monitoring tests which added weight to their significance and relevance to performance. The common language they created was understood and well interpreted between the MDT, the player`s peers, and the coaches through ongoing education. The structure of gym Phase 5 was conducted in complete alignment with the DUP of gym Phase 4. Gym Phase 5 was fundamentally an extension of gym Phase 4 with the exercises in the pathways being objectively profiled on the fourth and fifth day of week 4. On the fourth day the player completed the indoor ball skills profiling, plyometric profiling, the maximum strength and the IKD strength profiling. Despite a seemingly large volume of work, the indoor ball skills profiling (15 mins), the plyometric profiling (15 mins), the maximum strength profiling (30 mins) and the IKD profiling (15 mins) all took in total 75 minutes. Again, familiarity during gym Phase 4 to all these exercises reduced the players time to completion in one session. The indoor balls skills pathway had seen the player progress through familiarization exercises with the ball which included exercises like the keep-up variations to lateral shuffles and volleys. The plyometric profiling (force plate jumps included the DL and SL countermovement and drop jumps with the hop battery including SL horizontal, triple, medial and lateral hop techniques) would not be equal to preinjury levels at this stage but it was important the player could perform all tests without pain or compensatory movement patterns. Compensations were judged in real time in the frontal plane by observing a vertical line through the trunk, one line through the exercising limb and one line horizontally through the pelvis. Despite being subjective, suboptimal mechanics seen through this method are easy to assess and can be used as simple steps to coach the player to better movement quality. In summary the movement quality, overall confidence, and ability to complete the plyometric variations at this stage was a prerequisite to exit gym Phase 5. The maximum strength profiling (Figure 4B) saw the player achieve 230kg on a 3-repetition maximum SL leg press and 35kg each arm during a RFESS. Later that fourth morning the player completed the IKD profiling. At this stage the key criteria to achieve were >90% LSI and pre-injury scores in the peak torque at 60 /s (strength) and the total workload for 15 repetitions at 300 /s (endurance) for the quadriceps and hamstring muscles (Figure 4C). For the strength and endurance IKD tests, the quadriceps were 96% and 94% respectively when utilizing the pre-injury ipsilateral maximum scores for comparison. On the final workout day of the week the player started by completing the running preparation profiling. Through a variety of drills such as A skips (a skipping pattern in a linear direction emphasizing the hip drive phase of running), B skips (a skipping pattern in a linear direction emphasizing the hip extension phase of running) and heel flicks for example, the player demonstrated the ability to complete 1000 ground contacts per limb in a movement session, a prerequisite for starting grass Phase 1. He also completed his final anti-gravity treadmill running session. The treadmill session followed on from the previous session that ended while running at 75% body weight. Two-minute running intervals at 12.6 km/hour (3.3ms-1 / 40% of maximum speed) with a stepwise increase from 80 to 95% body weight was successfully achieved. This was in exact alignment with the planned running intervals of the upcoming first session of grass Phase 1 in the following week. Later in the final day of the week the player completed low-level control and balance exercises as injury specific exercises. Movement quality while maintaining limb, pelvic and trunk alignment was the focus as SL rotational and balance type exercises were conducted. To conclude gym Phase 5 the player completed the capacity profiling. This involved the player completing as many repetitions as possible on five key exercises. Throughout gym Phase 4 he had worked on numerous variations of these exercises like in all pathways but these five were specifically chosen to be profiled. From Figure 4A, the player exceeded >90% LSI and pre-injury ipsilateral maximum scores. Scores of 67 repetitions for the SL gastrocnemius heel raise, and 80 repetitions for the hamstring bridge in 90 and the SL squat exercise were achieved (Figure 4A). These tests along with hamstring bridges in 30 and SL soleus heel raise were used to measure the capacity of the lower limb musculature. Comparisons between limbs and exceeding >90% of his pre-injury ipsilateral maximum scores provided the player with the feeling of confidence to safely enter the grass Phase 1. To exit gym Phase 5, it was important to utilize a holistic approach. Four key factors were interpreted together to make a safe and calculated decision that the player was ready to start grass Phase 1. Firstly, he had achieved >90% of his pre-injury ipsilateral maximum scores in his capacity, maximum strength and IKD profiling (Figure 5A). These key pathways were the cornerstone of his rehabilitation at this stage. Secondly it is widely acknowledged that the power (hop test battery - Figure 4D, and countermovement jump profiling - Figure 4E) and RFD (SL drop Jump, IKD quadriceps peak torque at 0.18ms and isometric hamstring RFD at 100ms) qualities will lag at this stage, but the player had started to go through the progressions and was comfortable with all exercises of the plyometric pathway (Figure 2). Thirdly, although not purely objective, the player had completed other pathways like the running preparation and indoor ball skills (Figure 2) which further highlighted his competency in a variety of movement patterns and also to tolerate load. Finally, and arguably the most critical factor was the psychological confidence the collective of all the pathways had provided the player. At this stage expecting the player to feel ready to resume playing is unfeasible. However, verbalizing his confidence and readiness (>90% confidence) to start on the grass was imperative for him to commence grass Phase 1 at the start of week 5. This simple confidence scale (>90% confidence) was used at the end of each phase to ensure communication between the player and therapist ensuring the player felt psychologically ready to start the next phase. The aim of grass Phase 1 in week five was twofold. Firstly, to reintroduce the player to ball activities and jogging on the grass whilst increasing his level of aerobic fitness and secondly to develop the necessary power qualities in the gym to start HSR and COD drills in grass Phase 2. In grass Phase 1 despite the player working on the grass, off-feet conditioning, and gym work continued in unison with very specific targets after the profiling completed in gym Phase 5. This player needed to accomplish the necessary power qualities assessed through the hop battery and SL countermovement jump profiling. Specifically achieving >90% LSI and pre-injury scores ipsilateral maximum scores in these key power tests was required to exit grass Phase 1 (Figure 5B). On the grass the player completed sessions that involved pitch length runs (1 pitch length 100m x 5 = 500m), and dribble circuits (Hoff dribble circuit 290m x 1 = 290m) at a low speed (<65% maximum speed <5.1 ms-1) to increase his aerobic fitness level. As the player progressed through grass Phase 1 the total distance he covered in each session improved by 1km each day to 6km from a starting point of 2km. Incrementally increasing the number of pitch runs and dribble circuits was conducting in a step by step process as this type of aerobic conditioning has proven to achieve a heart rate <85% maximum. Accompanying this he was reintroduced to simple passing (0-10m), ball manipulations and low-level patterning drills that were incremental advancements to the exercises he had completed during the indoor ball skills pathway. He had no exposure to HSR or high-level accelerations and decelerations (>2.5 ms-1) as the high control and low variability ball drills were confined to distances no greater than 4 meters. However, with the sensitivity of the global positioning system (GPS system - augmented 10 Hz Apex, Catapult Leeds, UK) he did record some low-level (<2.5 ms-1) COD (total in one session 47, 27% of match total volume, Figure 6C) and accelerations and decelerations (total in one session 49, 31% of match total volume, Figure 6B). All these short distance intensity type actions were controlled and included within the small area (4m maximum) patterning drills the player completed. Grass Phase 1 was conducted in week five post-surgery and contained in total of five grass sessions. Critically during Phase 1 aerobic conditioning was implemented in the form of 500m runs (1 pitch length 100m x 5) and Hoff dribble circuits. During this and simple passing drills the player regained some confidence in his body, had a reintroduction to ball drills and accumulated 18,800 meters at a low speed, with 5523m being the highest achieved in one session (Figure 6A). To complement the running and ball work the player also prioritized power work in the gym during grass Phase 1. Crucial to this whole RTP philosophy was the blending of the grass and gym exercises both being addressed simultaneously to prepare the player for the next phase he would progress onto. At this point in grass Phase 1 he needed to complete the necessary power profiling (hop battery and SL countermovement jump testing) to ensure the player was adequately prepared and safe to start grass Phase 2. During the morning sessions specific cueing was utilized to direct the players intent in producing explosive movements. The player completed three power sessions (day 1, day 4 and day 6 in the week) which consisted of the profiling criteria and supplementary power-based exercises (squat jumps, lunge jumps, step jumps, and hurdle hop variations etc). The power profiling (part of the plyometric pathway) specifically focused on the hop test battery and the SL countermovement jump. The results of the hop test battery significantly improved with the key hops for this injury being the SL triple hop (625cms) and the SL medial hop (152cms) both exceeding >90% LSI and pre-injury ipsilateral maximum scores (102 and 101% respectively, Figure 5B). Similarly, the SL countermovement jump height (24.2 cms) and the flight time:contraction time ratio (0.58 ms-1) for this player had achieved pre-injury levels of 94 and 95% respectively (Figure 5B). To exit grass Phase 1 the player had completed the GPS criteria (5-10m passing, low intensity COD, accels and decels, aerobic runs with a maximum of 6km in one session, all metrics <65% in speed, intensity, and volume) and also the necessary power criteria (Figure 5B) which were the prerequisites to start grass Phase 2. The aim of grass phase two was twofold. Firstly, it was on the grass to complete HSR (<85% of maximum speed), increase session volumes (<85% of match total volume in metres), complete reactive drills including CODs, accelerations and decelerations (<66% of match total volumes) and also to complete some longer kicking exercises (<40m) (Figure 1). All of these requirements were within the controlled chaos and multidirectional themes of the control-choas continuum . The second aim was in the gym where the final RFD qualities (SL drop jump, IKD quadriceps peak torque at 0.18ms and isometric hamstring RFD at 100ms) were achieved again with a prerequisite to exit grass Phase 2 being set at >90% LSI and pre-injury ipsilateral maximum scores (Figure 5C). During grass Phase 2 (week 6) the player continued the theme of DUP. On day 1 and day 4, the player completed more intensity-based drills including short distance (0-20m), accelerations, decelerations and CODs. Conversely on day 2 and day 5, he completed a more extensive HSR theme at the start of the session and an accumulation of low intensity meters towards the end of the session. Daily warmups of either rotational and more flexed positions or more upright HSR mechanics reflected these grass themes to prepare the player appropriately. Towards the end of the grass Phase 2 in the day 4 session the player had completed in total 91 accelerations and decelerations (57% of match total volume - Figure 5B) and 109 COD (62% of match total volume - Figure 5C). On day 5 the player accumulated 350m of HSR (peak speed 7.2ms-1 = 85% of maximum speed - Figure 5F) in this extensive day and a total of 6523m in his largest volume session (Figure 5A). Concurrent to the physical work was the ball work where the player completed longer passing type exercises specifically on the intensive days (day 1 and day 4). During grass Phase 2 in addition to the HSR and reactive drills the player also prioritized RFD work in the gym. RFD was deemed to be the last quality to be completed in the gym and a non-negotiable prerequisite to start the maximum speed work in grass Phase 3. The development of the player s RFD had started beginning at 10 days post-surgery as the player engaged in the plyometric pathway (Figure 2). Also, by undertaking all of the rehabilitation pathways and achieving qualities like capacity, strength (Figure 4A) and power (Figure 4B) this could finally be accomplished. By replicating the periodization of the power work in grass Phase 1 the player completed pre-grass sessions on day 1, day 4 and day 6 in the week programmed around the theme of RFD. A variety of exercises such as hamstring isometrics, drop jumps and hurdle bounds were employed to increase limb stiffness and utilize the fast stretch shortening cycle (<250ms ground contact times). Minimal repetitions (2-4) and maximum intent was employed as the player s RFD qualities were profiled in numerous ways. As Figure 5C highlights >90% LSI and pre-injury scores was specifically required in the SL drop jump (jump height and RSI), the RFD of the quadriceps peak torque on the IKD at 0.18ms (at 180 /s) and the isometric RFD in the hamstrings (3 x 3s isometric holds) on the force plates at 100ms (Figure 4F). By the end of week six the player had successfully completed grass Phase 2 as he had achieved the GPS criteria (Figure 1) and the necessary RFD criteria (Figure 5C) which were the prerequisites to start grass Phase 3. At seven weeks post-surgery, the player started grass Phase 3. The aim of this phase was to achieve maximum GPS metrics (Figure 1) and work on any rehabilitation residuals that he had not accomplished. On the grass the phase involved maximum speed work (>95% of maximum speed), increased session volumes (>95% of match total volume in metres), positional drills including CODs, accelerations and decelerations (>95% of match total volumes) and also to complete positional kicking in this case namely shooting drills (Figure 1). The second aim of grass Phase 3 was in the gym. If there are no major asymmetry to work on like in this case, then continuing to monitor essential variables is the focus such as RFD and maximum strength qualities for example. Grass Phase 3 was periodized in a similar theme (intensive days on day 1 and day 4 and extensive plus volume (low intensity) days on day 2 and day 5) to grass Phases 1 and 2. This was in alignment with the team's training schedule except the hardest day of the week in RTP was on day 5 as opposed to day 6 (match days) for the team. On the extensive days (day 2 and day 5) the player achieved a speed of 8.4 ms-1 (Figure 6F), 153m sprint meters (Figure 6E) and 580m of HSR (Figure 6D) which equated to 99%, 101% and 106% of his match metrics respectively. The second part of his day 5 session included conditioning (high volume at low intensity) as he accumulated a total session distance of 9515m (95% of match total metres). Conversely intensive metrics were similarly developed as he achieved in one session 139 accelerations and decelerations (Figure 6B) and 151 subsequent COD (Figure 6C) (87% and 85% respectively of match total volumes). Chaotic and highly variable movement patterns were individualized for the player through positional drills and shooting drills. Similarly controlled collision exercises with the physio and peers were designed to build confidence by replicating his injury mechanism and prepare him for team training in grass Phase 4. Despite the player achieving >90% LSI and pre-injury ipsilateral maximum scores in the maximum strength (Figure 5A) and RFD profiling (Figure 5C) the player subjectively wanted to maintain these training habits and qualities. He valued their link to performance and his preparation sessions on day 1 and day 4 continued to favor a RFD theme. Conversely after his grass sessions on the day 2 and day 6 he completed a concise maximum strength exposure (3-4 sets x 3-4 repetitions). Accompanying these positives themes the player subjectively felt 90-95% ready to train (Figure 5D) which is also another key psychological prerequisite to be achieved prior to starting with the team in grass Phase 4. To enter grass Phase 4 at eight weeks post-surgery the player had completed the three grass phases exposing him to the necessary GPS demands (Figure 1) and also accompanying gym profiling (Figure 5D). Clinically he presented with no pain or swelling in his knee. He had experienced no major setbacks during the 8 weeks post-surgery and self-rated his readiness to train at >90%. During grass Phase 4 he rejoined full team training, exposing him to full contact and the inevitable neurocognitive overload that team training brings. The training speeds, spaces and interaction with players and coaches' instructions undoubtedly overloaded the player, so unnecessary increases in the physical demands were not priortized. In the gym the player continued a bi-weekly prophylactic strength exposure in the key exercises he perceived to be benefiting his knee (RFESS, SL leg press, glut-hamstring bench raises, Nordic hamstring exercises, and the IKD, at 3 sets x 5 repetitions at 60 /s). His preparation sessions consisted of RFD exercises to ensure the RFD in the concentric and eccentric phases were continuing to improve. Both the strength and RFD sessions contained some of the key profiling tests (for example, strength exercises RFESS, SL leg press and IKD at 60 /s and RFD exercises such as SL drop jump and supine isometric hamstrings) now being employed as simple monitoring exercises to check for any subsequent trending patterns. The detection of any possible drop offs could be addressed early with the appropriately prescribed prophylactic strength or RFD sessions pre or post training. After two weeks of full team training the player took part in a behind closed door friendly match where he successfully played 45 mins. This was followed, five days later, with another 45 minutes in a friendly match situation. These match minutes were further increased to 75 and 90 minutes before the player played in his first full league match. Similarly, he built up his competitive match minutes from 25 to 45 to 75 as he regained match fitness.

anterior cruciate ligament, rehabilitation, return to performance, soccer

PMC3336246_01

Male

A 50-year-old male, smoker (50 p/y), with a history of alcoholism, severe COPD, bilateral pneumothorax, and tuberculosis due to mycobacterium avium infection, was admitted in our department eight months after antituberculosis treatment initialization due to one-month period of high fever, up to 39.6 C, loss of weight, almost 5 kgr, and productive cough with purulent sputum (Figures 1 and 2). Despite adequate treatment with antibiotics, in outpatient setting, he remained with no clinical improvement. Routine laboratory tests on admission revealed increased erythrocyte sedimentation rate (ESR = 134 mm/hr) and C-reactive protein (CRP = 112 mg/dL). A chest X-ray demonstrated cavitations, consolidation, and fibrosis at both upper lobes. Serologic tests for hepatitis A, B, C, D, and human immunodeficiency virus did not reveal any abnormality. Broad spectrum antibiotics were initialized during his hospitalization without any improvement. Finally in three different sputum samples Aspergillus flavius was isolated and, a CT scan demonstrated cavitary lesions with shadows, probably due to fungus contamination inside them, especially in the upper left lobe (Figures 3 and 4). These facts established a diagnosis of chronic cavitary pulmonary aspergillosis. Treatment with amphotericin B provided an initial clinical improvement but eleven days after a first episode of mild hemoptysis occurred and was controlled with conservative measures. Eighteen days after treatment initialization a second episode of hemoptysis occurred and, although he was intubated immediately, his cardiorespiratory system collapsed and he died.

PMC7677704_01

Male

A forty-six-year-old man suffered from a fever and nonproductive cough for 2 weeks. He noticed that his symptoms started two months after he started running an ultrasonic humidifier 24 hours a day in his home. He went to his local doctor and was prescribed medicine for bronchitis containing clarithromycin and amoxicillin. However, his symptoms worsened, and he visited our hospital in the winter, two weeks after his first visit. The patient, who was a smoker (10 pack-years), had a medical history of depression and sleep apnea syndrome, without medical treatment. His occupation was an automotive maintenance engineer. His vital signs on admission showed a low grade fever of 37.0 , moderate tachycardia of 98 beats per minute, tachypnea of 20 times/min, and hypoxemia with an oxygen saturation level of 88% on ambient air. Physical examination revealed no abnormalities except for inspiratory late crackles in both lung bases. An arterial blood sample showed a PaCO2 of 36.9 mmHg and a PaO2 of 59.8 mmHg. The laboratory findings showed an increased white blood cell count of 10700/muL with 72.8% polymorphic nuclear leukocytes and a C-reactive protein (CRP) concentration of 7.24 mg/dL. His serum levels of KL-6 (674 U/mL) and SP-D (151 ng/mL) were slightly elevated. The serum antibodies against Trichosporon asahii and Aspergillus were negative. Chest high-resolution computed tomography (CT) showed bilateral diffuse subpleural nonsegmental ground-glass opacities (Fig. 1). The pulmonary function test showed a restrictive pattern (predicted forced vital capacity 75.9%) with moderately reduced diffusion capacity (% single-breath carbon monoxide diffusing capacity 71.5%). Based on the clinical course and the findings of the examinations, we suspected HP associated with the ultrasonic humidifier and performed flexible bronchoscopy to obtain a definitive diagnosis. The bronchoalveolar lavage fluid (BALF) revealed an elevated cell count (16.4 x 106/mL) with lymphocytes (51.0%), neutrophils (11.4%), and eosinophils (8%). The ratio of CD4+ to CD8+ cells (CD4/8) of BALF was 1.60, which was normal. The histological examination of the transbronchial lung biopsy (TBLB) showed alveolitis with the infiltration of lymphocytes and plasma cells without granulomas or Masson bodies. We performed an inhalation challenge test with the ultrasonic humidifier (Fig. 2). Six hours after the test, he developed a high fever (38.1 Celsius), chills and dyspnea. The blood tests showed an increased white blood cell count (29950/muL) and CRP level (4.85 mg/dL) on the following day, while the serum KL-6 level did not change. Accordingly, we diagnosed the patient with humidifier lung. His symptoms, laboratory findings, and radiographic findings gradually improved after avoiding the use of the humidifier without taking medication. Acinetobacter junii, Bacillus spp, Cladosporium cladosporioides, Fusarium graminearum, and Mycobacterium gordonae were isolated from the humidifier water, while no pathogens except for normal flora were isolated from the BALF. The concentration of endotoxin in the humidifier water was high (more than 5000 pg/dL) (Table 1).

endotoxin, humidifier, hypersensitivity pneumonitis, kl-6, mycobacterium gordonae

Chest high-resolution computed tomography (CT). . The chest CT showed diffuse subpleural nonsegmental ground-glass opacities.

PMC4901174_02

Male

A 46-year-old man with no history of smoking was referred to our hospital in 2008 because of abnormal opacities on chest radiographs that were obtained at a local clinic where he had been treated for bronchial asthma. He had worked in an aluminum-processing factory for the past 6 years, from 1996 through 2001, where he had been exposed to aluminum dust. Beryllium was not used. He had not worn a protective mask. He had no signs of cough, dyspnea, fever, skin involvement, or arthritis. His past medical history included tuberculosis in childhood, gallstones at 21 years of age, and bronchial asthma at 43 years of age. His medications included theophylline, montelukast, olopatadine, beclometasone dipropionate, and fenoterol hydrobromide. With regard to family history, his mother had had tuberculosis. Physical examination revealed a well-developed, well-nourished man. Chest auscultation revealed no abnormal findings, and there was no evidence of uveitis, cervical or supraclavicular lymphadenopathy, arthralgia, skin eruption, or muscle weakness. Laboratory investigations showed the following values: WBC count 6280/mm3 with 0.6% eosinophils, Hb 16.8 g/L, C-reactive protein 0.1 mg/dL, aspartate aminotransferase 17 U/L, alanine aminotransferase 17 U/L, lactate dehydrogenase 195 IU/L, Upsilon-glutamyl transferase 21 U/L, creatinine 0.60 mg/dL, ACE 15.3 U/L, serum KL-6 291 U/mL, and SP-D 25.0 ng/mL. QuantiFERON TB-2G testing (Cellestis, Carnegie, Australia) was positive with culture filtrate protein-10 of 5.14 IU/mL, and the 6-kDa early secretory antigenic target of Mycobacterium tuberculosis was 0.20 IU/mL (normal range <0.35 IU/mL). PPD skin testing was positive for indurations of 27 mm x 24 mm. Arterial blood gas analysis while breathing room air did not reveal hypoxemia (PaO2 90.3 Torr), with PaCO2 39.7 Torr and pH 7.433. Pulmonary function tests showed the following values: VC 3.05 L (83.7%) and forced expiratory volume in 1 s 2.53 L (78.6%). Diffuse nodular shadows were found on chest X-ray (Fig. 4A), and chest HRCT showed diffuse nodular opacities with interlobular septal thickening (Fig. 4B). In BAL fluids there were 3.1 x 105 cells per mL, with 1.0% neutrophils, 18.5% lymphocytes, and 80.5% macrophages. The ratio of CD4 to CD8 T lymphocytes was 0.94. BAL fluid cultures and acid-fast bacillus PCR were free of pathogens. Histology performed on transbronchial biopsies did not reveal granuloma and no definite diagnosis could be made. Anti-tuberculosis drug therapy using rifampicin, isoniazid, ethambutol, and pyrazinamide for 3 months did not improve the chest HRCT findings. Then a video-assisted lung biopsy was performed. Results of histology of tissue obtained from the right S3 region are shown in Fig 5. Granulomatous lesions mainly composed of multinucleated giant cells were observed predominantly in the pulmonary interstitium. Results of microscopic examination of the tissue with special stains for mycobacteria and fungi were negative. Hemosiderosis and anthracosis with pneumoconiotic materials were also observed (not shown). Elemental analysis was performed for the granuloma (Fig. 6A) and the centrilobular fibrosing lesion (Fig. 6C). Silicon, aluminum, iron, and titanium were detected in both lesions (Table 1 Site 3 and 4). Especially wide distribution of aluminum was observed in the granuloma (Fig. 6B). The patient was followed up without special medication though 2014 when his chest HRCT findings showed no changes and he was without respiratory symptoms.

ace, angiotensin converting enzyme, aluminum dust, bal, bronchoalveolar lavage, dlco, carbon monoxide diffusing capacity, epma, electron probe microanalyzer, elemental analysis, granulomatosis, hrct, high-resolution ct, occupational lung disease, ppd, purified protein derivative, sp-d, surfactant protein d, sarcoidosis, vc, vital capacity, wds, wavelength dispersive spectrometer

PMC4639654_01

Female

Mrs. X, 35 years old, married for 6 years, case of primary infertility with hypothyroidism on levothyroxine 25 mcg, attended the infertility outpatient department of a tertiary care centre in May 2012. She had already undergone 2-3 cycles of ovulation induction. There was nothing significant in husband's history. The patient was investigated for primary infertility. Ultrasound on day 2 of menstrual cycle: uterus of normal size and endometrium thin, with antral follicle count of 3-4 follicles in each ovary and no hydrosalpinx or any adnexal mass. Premenstrual endometrial biopsy: PCR/TB positive with AFB stain negative. HPE: secretory endometrium and no granulomas. Hysterosalpingography: not done. Hysteroscopy: cervical canal was normal. Bilateral ostia seen. Fibrosis in endometrium. Endometrial biopsy taken and sent for HPE. Laparoscopy: uterus contour was normal. Tubercles were present all over. Biopsy was taken. In the left tube mild hydrosalpinx was present. Right tube was dilated. Both ovaries were stuck in POD. On chromopertubation with saline, bilateral spill was present. Her endometrial biopsy report showed proliferative endometrium with no granuloma. TB PCR was negative. Patient was started on category I antitubercular treatment in view of genital Koch's for six months. Treatment as per Revised National TB Control Program, in category I at the initial two months of therapy with INH (600 mg), rifampicin (450 mg), pyrazinamide (1500 mg), and ethambutol (1200 mg) in a thrice weekly schedule followed by INH (600 mg) and rifampicin (450 mg) in a thrice weekly schedule for the period of four months was given. After completion of her ATT course, her ultrasound showed uterus normal size with no evidence of tuboovarian mass or hydrosalpinx. Her antral follicle count was 3-4 follicles in each ovary. The patient was planned for ovulation induction with intrauterine insemination. Before intrauterine insemination, there were no signs and symptoms of pelvic inflammatory disease. Pelvic examination was normal. She had three cycles of ovulation induction with two cycles of intrauterine insemination. In her third cycle (August 2013), five days after intrauterine insemination the patient reported to the outpatient department with chief complaint of abdominal pain with fever. Acute pelvic inflammatory disease was diagnosed and the patient was admitted. Her laboratory investigations produced the following results: her blood cell counts were leukocytes of 12,000/muL (4-11000) with neutrophilia, polymorph count of 86, hemoglobin of 10 g/dL (12-16), and platelets of 206,000/muL (150-450,000). Her other serum parameters were within normal limits. Urine culture and blood culture were negative and ultrasound whole abdomen was within normal limits. She was started on intravenous antibiotics/antifungal. She became afebrile after 48 hours of intravenous antibiotics; TLC counts came down to 7700. She responded to treatment and was discharged. 24 days after intrauterine insemination (10 days after discharge from the hospital) the woman presented with low grade fever and abdominal pain. On her vaginal examination the uterus was of normal size. There was fullness and tenderness in pouch of Douglas. On ultrasound, the uterus was normal with endometrial thickness of 9.4 mm, right adnexa: 7 x 5.6 cm? tuboovarian mass. Left adnexa: hydrosalpinx of 7 cm adjacent to left ovary. There was suspicion of relapse of tuberculosis. The woman was started on ATT category II from DOTS (Directly Observed Treatment, Short-Course) centre. Treatment as per Revised National TB Control Program, in category II at the initial two months of therapy with streptomycin (750 mg) INH (600 mg), rifampicin (450 mg) pyrazinamide (1500 mg) ethambutol (1200 mg) in a thrice weekly schedule followed by INH (600 mg), rifampicin (450 mg), pyrazinamide (1500 mg), and ethambutol (1200 mg) in a thrice weekly schedule for period of one month followed by INH (600 mg), rifampicin (450 mg), and ethambutol (1200 mg) in a thrice weekly schedule for the period of five months was given. After 2 weeks of ATT the patient again presented with chief complaints of fever with chills and rigor and vomiting. On examination: per abdomen: 14-week palpable mass at the right side. On her vaginal examination uterus size was not made out. There was a firm mass with restricted mobility felt separately from the uterus. The patient was again admitted and started on intravenous antibiotics. The patient continued to have fever and ultrasound showed persistence of tuboovarian masses with increasing TLC counts from thirteen thousands to twenty two thousands (13,000 to 22,000). MRI of pelvis showed bilateral tuboovarian masses 8 x 6 cm in right, 9 x 7 cm in left adnexa suggestive of pyosalpinx likely tubercular with septations with endometritis (Figures 1, 2, and 3). The woman was taken up for exploratory laparotomy after four weeks of ATT. The intraoperative findings were kissing tuboovarian masses with a common cyst wall adherent to intestine and having loculated pus collection. 600 cc pus was drained and sent for AFB culture and Gram staining. The woman continued on ATT category II and was discharged on same. The purulent discharge culture reported pus cells and Gram negative bacilli. HPE of cyst wall showed fibroconnective tissue with multiple microabscess consisting of neutrophils and macrophages, hemorrhages, and foci of chronic inflammation. Few granulation tissue areas were present. The woman completed her ATT category II which she was given for one year. Now, she is doing well. Her ultrasound shows poor ovarian reserves with persistent tuboovarian masses (Figure 4). Hence, she is counselled for adoption/IVF with donor oocyte.

PMC2852770_01

Male

A 68-year-old male who had owned a bicycle shop for several decades visited our institute in March 2004 with a one-month history of swelling and pain of the right distal forearm. His dominant hand was right. On physical examination, an elastic soft mass, measuring 6 cmx4 cm, was observed on the palmar side of the right forearm. Motion of each finger was normal, but the range of motion of the wrist joint was slightly restricted. Skin color change and local heat were not observed around the mass. Laboratory data, including rheumatoid factor and C-reactive protein, were not contributory. He had no history of tuberculosis, and his tuberculin reaction on admission to the hospital was weakly positive. No hilar lymphoadenopathy was observed on a chest radiogram. Plain radiograms of the right wrist and hand showed degenerative changes and Heberden's nodes in the distal interphalangeal joints, but no apparent calcification was observed in the mass (Figure 1). On magnetic resonance (MR) imaging, T1-weighted images showed a low-intensity mass surrounding the flexor tendons (Figure 2A). On T2-weighed images, the mass partially showed high-signal intensity (Figure 2B). Sagittal T2-weighed images demonstrated an effusion in the sheaths of the flexor tendons and many small low-intensity bodies in the mass (Figure 2C). The mass was moderately enhanced by administration of intravenous gadolinium (Figure 2D), but the small bodies were not enhanced. An incisional biopsy was performed in June 2004. The mass existed adjacent to the flexor tendons and was encapsulated by a yellow fibrous wall. Many rice bodies had erupted from a small hole in the wall of the mass (Figure 3). Histological findings revealed hyperplastic tenosynovitis with fibrinous loose bodies (Figure 4). During the surgery, we confirmed that the flexor tendons were intact. In July 2004, he complained of disability to flex in his ring and little fingers. After physical examinations, we made a diagnosis of spontaneous rupture of the flexor tendons. An open repair was performed in August 2004. During the surgery, we observed granulation tissues proliferating around the flexor tendons (Figure 5) and a rupture of the flexor tendons of the ring and little fingers. The granulation tissues were removed, and the superficial flexor tendon was transferred to the ring finger. Tendon graft of the palmaris longus to the little finger was also performed. Histologically, the granulation tissues showed chronic synovitis (Figure 6), and acid-fast bacilli were negative. There was no apparent granuloma suggesting of sarcoidosis. The patient regained good function of the operated ring and little fingers with no evidence of recurrence at the latest follow-up in March 2009.

PMC6759875_03

Male

BK is a Caucasian male with no previous psychiatric problems, aged 18 years at presentation. His only medical problem was alopecia areata treated since age 12 years. Despite moderate-range intellectual disability (ID) based on school testing prior to development of catatonia, he demonstrated higher-than-expected adaptive functioning, including playing the piano, reading and working part-time. He pitched Special Olympics Softball and excelled in team soccer. Family history was positive for adult-onset hypothyroidism, Raynaud's and anxiety. There were no identifiable initiating stressors. Symptoms emerged at age 18 years, 4 months, with progressive psychomotor slowing, episodic immobility, freezing, reduced speech and eye-blink rate, loss of hedonic capacity, grimacing and holding his tongue out, repeated shrugging and turning of the shoulders, slow eating, and stereotyped movements of the fingers. He became negativistic. There were no sleep problems and minimal snoring. Neurological examination revealed overall motor slowing with general but mild body stiffness, anisocoria that was considered within normal range by neuro-ophthalmology and a change from right to left-handedness for eating. Neurologic studies were unremarkable, including brain MRI and routine and 24 hr EEGs. Extensive neurologic and medical evaluations, as described in Methods, to identify conditions that may cause or mimic catatonia failed to provide an alternative diagnosis. The pretreatment BFCRS Screening score was 8 and the Severity score 25. Based on these findings, his response to a diagnostic trial of lorazepam and lack of evidence to suggest another underlying medical or neuropsychiatric disorder, BK was diagnosed with unspecified catatonia. Lorazepam was titrated to a maximum dose of 20 mg/day over an 11-month period. Parental report, based on their subjective symptom levels endorsed a 75% return to baseline function. Other medications were tried including minocycline, which was discontinued within a week due to dizziness, and memantine, used for a short period, appeared to exacerbate catatonia symptoms. Due to failure to achieve baseline functions, bifrontal ECT treatments were initiated after 15 months resulting in an immediate and robust response, with more spontaneous speech and fluidity of movement. He maintained this response on no other catatonia specific treatments for approximately 2 years. Gradual reemergence of symptoms including loss of spontaneous speech, motor slowing and freezing, and decreased interest in activities led to reinstitution of medical treatment. Low dose lorazepam appeared to stabilize symptoms; he has returned to playing the piano, working part time and exercising. Parents did not see a benefit of NAC or dextromethorphan/quinidine and decided against repeat ECT, though he is not completely back to baseline. He is on 3.5 mg of lorazepam per day, which parents increase to 4.5 mg if symptoms increase. Current BFCRS Screening scale is 1 and Severity scale 2.5.

bush-francis catatonia rating scale, trisomy 21, benzodiazepines, dextromethorphan/quinidine, electroconvulsive therapy, lorazepam

PMC7081466_01

Male

This is a case of a 39-year-old male, a known patient with type 2 diabetes mellitus on metformin and gliclazide for 2 years, with optimal glycemic control, presented with a history of fever for 3 days and an abrupt onset of pain and swelling involving both the dorsum of the hands and wrist joints symmetrically. He also noticed pain and swelling in his left knee for 1 week. He was free from back pain, constitutional symptoms, and ankle swelling. He had good appetite and there was no significant history of weight loss. He denied any history of recurrent fever in the past, rashes, chronic cough, diarrhea, burning micturition, features of urinary outflow obstruction, urethral discharge, or sexual promiscuity. He had no family history of rheumatological disease or malignancies. He was a non-smoker and non-alcoholic. On examination, he was a well-built male and his vitals were stable with a blood pressure of 120/80 mmHg, a heart rate of 86 beats per minute, and a temperature of 37 degrees. He had tender pitting edema involving the dorsum of both hands symmetrically. An examination of the joints showed tenderness, warmth, and swelling, suggestive of synovitis with restricted movements in wrists, bilateral metacarpophalangeal (MCP) joint, proximal interphalangeal (PIP) joint, and the left knee. He had no ankle edema, lymphadenopathy, tenderness over the lower back and sacroiliac joints, and features of enthesitis. Rest of the clinical examinations including cardiovascular, respiratory, abdominal, and neurological examinations were unremarkable (initial presentation of the patient is shown in Figure 1). At this point, RA, seronegative spondyloarthropathy, reactive arthritis, and arthritis related to the chronic infections such as tuberculosis, polymyalgia rheumatica (PMR), and RS3PE were considered as differential diagnosis. The initial investigations were performed to confirm the diagnosis. His salient clinical and laboratory features are summarized in Table 1. Sonographic examination of both hands and wrists showed features of tenosynovitis with soft tissue edema and joint effusion. X-rays of the hands did not show any erosions and x-rays of the lambosacral spine and sacroiliac joints were normal. Further investigations revealed a negative RF (<20 IU/mL), anti-nuclear antibodies (ANAs), and anti-neutrophil cytoplasmic antibodies (ANCAs). Anti-cyclic citrullinated peptide antibody (anti-CCP Ab) level was negative. Venereal disease laboratory (VDRL) test and retroviral studies were also negative. Screening for tuberculosis was performed to exclude the possibility of Poncet's disease with three sputum direct smears, chest x-ray was normal, and tuberculin skin test was negative. At this point, the diagnosis of bilateral RS3PE was made. To evaluate the possible underlying cause and exclude the possible malignancies, other investigations including serum amylase, lactate dehydrogenase (LDH), blood cultures, antistreptolysin O titer (ASOT), thyroid-stimulating hormone (TSH), free T4, and serum uric acid were performed, which were unremarkable. Ultrasonography of the abdomen and pelvis revealed normal size and architecture of the liver, spleen and kidneys; there were no lymphadenopathy or tumors. Blood picture was obtained to exclude the possibility of hematological malignancies, which was normal. He was treated with both etoricoxib, a selective cyclooxygenase 2 (COX-2) inhibitor, and low-dose oral prednisolone. Initially, he was given 15 mg of prednisolone, which was continued for 2 weeks and then tailed off over the next 2 weeks. He showed a marked improvement clinically and his inflammatory markers returned to normal levels in 4 weeks. He became free of symptoms at 2 months and maintained the remission for 6 months of follow-up.

rheumatology/clinical immunology, pitting edema, remitting seronegative symmetrical synovitis with pitting edema, seronegative, symmetrical, young age

PMC4531775_01

Female

A 56-year-old woman was referred to our hospital with complaints of chronic diarrhea, weight loss, indigestion and abdominal pain lasting for 11 months. Before admission, the patient visited a private clinic and underwent gastroscopic and colonoscopic examinations. Gastroscopic examination showed small gastric ulcerations on the antrum and colonoscopic examination showed multiple punched-out ulcerations and erosions on the entire colon, including the sigmoid colon to the terminal ileum. Biopsy results were not diagnostic at that time. Under the clinical impression of intestinal tuberculosis, she received 2 months of antituberculosis medication without improvement of symptoms. The follow-up biopsy result of colonoscopic examination showed intestinal lymphoma of T-cell type. The patient was then referred for further evaluation. On admission, the patient looked pale, emaciated and dehydrated. An eleven kg weight loss was noted during the last 6 months (47kg--> 36kg). She denied fever or night sweating except complained of profuse watery diarrhea (5-6/day) and indigestion. She denied aggravation of diarrhea symptoms after wheat ingestion. No improvement of diarrhea was found by withdrawal of wheat intake. There was no palpable lymphadenopathy or hepatosplenomegaly. Diffuse abdominal tenderness on the whole abdomen was noted on abdominal physical examination. Initial laboratory findings were as follows: WBC 8,300/mm3, Hb 10.7 g/dL, Hct 32.6%, platelet 409,000/mm3, urine analysis was normal, stool occult blood was negative, serum total protein 5.2 mg/dL, albumin 2.3 mg/dL, serum LDH 128 IU, calcium 7.9 mg/dL, phosphorous 4.4 mg/dL, ALT/AST 12/13 U, cholesterol 101 mg/dL, BUN 13 mg/dL and creatinine 1.0 mg/dL. Chest X-ray was normal. Gastroscopic examination showed diffuse irregular nodular and depressed lesions on the angle and the lower body and multiple red spots on the antrum, suggesting erosive gastritis. But esophagus and stomach biopsies showed diffuse infiltration of lymphoma cells with epitheliotropic features (Figure 1, 2). Duodenal biopsy also revealed lymphoma cell infiltration, and villous atrophy and blunting were found. Colonoscopic findings were the same as noted previously (Figure 3) and the biopsy showed diffuse infiltration of small to medium-sized lymphoma cells (Figure 4). The infiltrated lymphoma cells were immunostained for UCHL-1 (+), CD 3 (+), MT-1 (+), L-26 (-) and MB-2 (-) (Figure 1.2.4). Small bowel series also showed chronic granulomatous lesions on the cecum and the distal ileum. Abdominal CT scan revealed diffuse wall thickening of the bowels, including the esophagus, the stomach and parts of the small bowel and colonic loop. There was no evidence of involvement of lymphoma on bilateral bone marrow biopsies. Finally, the patient was diagnosed as primary intestinal T-cell lymphoma involving the entire gastrointestinal tract (Ann Arbor Stage IVB) with malabsorption. She was treated with combination chemotherapy including cyclophosphamide, adriamycin, vincristine and prednisone (CHOP). Although after two cycles of chemotherapy the initially observed bowel wall thickening disappeared on follow-up abdominal CT scan and no definitive nodular or ulcerative lesions were noted, on follow-up gastro-and colonoscopic examinations lymphoma cells remained on the biopsy. Despite further treatment with 4 cycles of systemic chemotherapy, only a partial response was achieved. The patient was readmitted to our hospital with complaints of hematochezia. Colonoscopic examination showed internal hemorrhoid and diffuse hyperemic mucosa and multiple ulcerations were noted throughout the rectum to cecal area, suggesting relapse of lymphoma. After two cycles of salvage chemotherapy with etoposide, dexamethasone, adriamycin and cisplatin (EDAP), the bowel lesions were slightly improved but lymphoma cells were still found, indicating refractory to chemotherapeutic agents, agten then, the patient was treated without a specific treatment except supportive care. Eventually, the patient died of spontaneous bowel perforation.

PMC6952472_02

Female

A 4-month-old infant girl in good health was examined for hypopigmented macules on the face that had been noted at the age of 2 months. On physical examination, numerous confluent hypopigmented macules with fine scales located on the frontal area of the face were noted (Figure 1c). In both cases, examinations using a Wood's lamp showed hypopigmented processes in the aforementioned areas and also yellowish fluorescence on some lesions. A potassium hydroxide (KOH) examination revealed yeast and short mycelial forms resembling 'ziti and meatballs,' which supported the diagnosis of PV (Figure 1d). These patients were treated with 1% clotrimazole lotion (twice a day) for four weeks. After treatment, the lesions were still present but with less severity and KOH smears showed negative results for fungal elements. Written informed consent was given by the parents of the patients.

hypopigmented, infantile, pityriasis versicolor, tinea versicolor

PMC3544093_01

Male

A 70-year old man with history of chronic smoking was brought to the emergency department with acute painful swelling involving his right hand and the right knee. There was history of mild fever especially at night. There was no past history of injury, gout, rheumatoid arthritis or tuberculosis. Clubbing of the finger nails were noted ipsilaterally. Movements of the fingers of the involved hand and the knee were painfully restricted. The swelling in the right hand was especially in the first web-space [Figure 1]. In the right knee the swelling was more on the medial femoral condyle. On palpation the swollen areas were grossly tender and doughy. Differential diagnoses considered by the initial physicians attending the case were gouty arthritis, septic arthritis and acute osteomyelitis. Radiographs showed pure lytic bony lesion with complete disappearance of lower two third of the second metacarpal, trapezium and trapezoid bones of the right hand [Figure 2]. Radiograph of the right knee showed pure lytic lesion of medial condyle of femur with subarticular extension [Figure 3]. Chest X-ray showed no abnormal findings. Pain was unresponsive to Non steroidal anti-inflammatory drugs and it was severe at night disturbing his sleep. Intravenous Tramadol was started the next day with partial pain relief. In view of the evolving clinic-radiological findings a new set of differential diagnosis emerged that included metastatic diseases, multiple myeloma and remote possibilities of multi-centric GCT, multi-centric osteosarcoma, brown tumors and disseminated tuberculosis. Blood tests showed anemia, raised sedimentation rate (ESR) and positive C-reactive protein. Sample taken for bacteriology by needle aspiration were negative for sepsis from the inflammatory sites. Skull radiograph did not yield any abnormal findings (expected in myeloma). Sonography of thyroid and parathyroids ruled out any lesions like thyroid primary or parathyroid hyperplasia or adenoma. Tuberculin test (Mantoux skin test) widely used for detection of tuberculous infection was negative. Therefore, possibility narrowed down to bone secondary with unknown primary. Bone metastasis necessitated evaluation for prostate, lung, renal and thyroid primary. Abdominal sonography was done to rule out primary in abdomen and to look for possible secondaries in liver. Abdominal sonography readily revealed right-sided renal mass with loco-regional spread. Urine routine microscopy showed few pus cells and RBCs. Therefore primary renal tumor was provisionally diagnosed. Guided needle biopsy subsequently confirmed the renal mass as to be clear cell type of renal cell carcinoma. Urinary BenceJone's protein and serum Electrophoresis for M band were negative for myeloma. Biphosphonate (Osteofos) and nasal calcitonin spray (Calcinase) was started from the next day that provided good pain control within a couple of days. Needle biopsy from the lytic lesions taken later suggested metastatic disease of renal origin. Unfortunately, the patient refused any further treatment or intervention except medications for pain relief, after knowing that he is suffering from a malignant disease despite adequate counselling regarding potential treatment options.

acrometastasis, abdominal sonography, peripheral skeletal metastases, renal cell carcinoma

PMC9167125_01

Male

A 64-year-old male with a 10-year history of asymptomatic JAK-2-positive PMF under observation presented with progressive pruritus and jaundice for 3 days. Labs revealed ALT 49 IU/L, AST 35 IU/L, ALP 378 IU/L, total bilirubin (TB) 17 mg/dL, and direct bilirubin 10 mg/dL. LDH was 173 U/L, and the haptoglobin level was normal. Complete blood count with differential showed WBC 4.4 x 103/uL (85% neutrophils, 8% lymphocytes, and 4% monocytes), hemoglobin 7.4 g/dL, and platelets 103 x 109/L. Lipid panel showed total cholesterol 229 mg/dL, triglyceride 171 mg/dL, HDL 5 mg/dL, and LDL 193 mg/dL. Anti-mitochondrial antibody was negative with titer <1 : 20. Workup for metabolic, viral, autoimmune, alcoholic, and drug-induced liver disease otherwise was unrevealing. The patient denied the use of any drugs, including herbal supplements. CT scan showed hepatomegaly without biliary ductal dilatation, along with marked splenomegaly with a spleen size of 27 cm. MRCP failed to demonstrate findings of an obstructive etiology. Therefore, EUS and ERCP were performed which were also unremarkable. Given worsening hyperbilirubinemia, a liver biopsy was subsequently pursued which was suggestive of a nonspecific cholestatic liver injury (Figures 1-3). TB continued to increase to 25 mg/dL, and a repeat ERCP was performed which was unremarkable. During the ERCP, a sphincterotomy was performed with biliary sweep which was unremarkable with cytology showing benign reactive epithelial cells. Liver biopsy was also repeated which showed similar findings as prior. Throughout his course, the patient also did not have any fevers, right upper quadrant pain, or leukocytosis to suggest underlying infection including acute cholangitis. Bone marrow biopsy performed showed hypercellular (90%) with 3+ reticulin fibrosis and no increased blasts, consistent with underlying primary myelofibrosis. TB continued to rise to 29 mg/dL, and given negative extensive workup otherwise, the decision was made to start empiric treatment for possible PMF-related disease. Dynamic International Prognostic Scoring System (DIPSS) score was 2, correlating with intermediate risk. Ruxolitinib was initiated with significant improvement of TB to 18 mg/dL. 3 weeks after initiation, ruxolitinib had to be temporarily held due to adverse effects of bone marrow suppression, and TB subsequently increased to 35 mg/dL over the next 5 weeks. Ruxolitinib was then resumed at a lower dose with improvement again of TB to 17 mg/dL (Figure 4). The patient's course was unfortunately complicated by renal failure secondary to biopsy-confirmed bile-acid nephropathy, ascites, functional decline, and eventually was transitioned to hospice.

PMC3199829_01

Female

Rhinosurgery: Rhinosurgery in RP is based on a limited number of case reports only. Rapini refused reconstruction of saddle nose deformities in RP because of the relapsing character of the disease. By contrast, Haug and coworkers successfully reconstructed a saddle nose using iliac crest. A bony implant was chosen because the authors considered it more resistant and less resorpable compared with cartilage. Torossian and coworkers reconstructed a saddle nose deformity in a young patient using calvarial bone graft. The operation was performed 12 months after establishing the diagnosis of RP and in a state of stable remission. Experiences reported by Bell and coworkers argue against a theoretical superiority of bone implants. Usage of cartilage implants is possible in RP if relapsing episodes of nasal chondritis are prevented or reduced to a minimum by immunosuppressive therapy. Bell and coworkers used autologous costal cartilage to reconstruct a saddle nose in 14 years old patient. Although two more episodes of chondritis occurred no signs of resorption of the cartilaginous implant was observed one year after the operation. Epidemiology/pathogenesis: Systemic Lupus erythematosus (SLE) is an autoimmune disorder with potential manifestations at nearly all organs and tissues of the human body. The disease predominantly involves females. An annual incidence of 5/100,000 in Germany has been reported. Oral and nasopharyngeal ulceration are considered as diagnostic criteria for SLE. Nasal symptoms: Nasal symptoms are generally unspecific such as mild episodes of epistaxis or local tenderness or facial pain. The nasal mucosa may appear diffusely reddish and edematous or as atrophic rhinitis. Less than 70 cases of nasal septal perforation have been reported so far worldwide. Nasal septal perforation is even more rarely observed as a first symptom. In a retrospective study of the lupus clinic of the University of Toronto nasal septal perforation was discovered in 40/885 (4.6%) patients with SLE. These perforations usually remain asymptomatic since they are detected after a course of 6.1 years in the mean. In addition, nasal septal perforations occur during exacerbation of the disease or in the context of vasculitis. Oral ulceration often precedes nasal septal perforation. Epidemiology/pathogenesis: Crohn's disease (CD) is an inflammatory bowel disease and can involve all parts of the gastrointestinal tract. An annual incidence of 5.2/100,000 in Germany has been reported. Histopathology reveals non-caseating granuloma as a valuable diagnostic sign that however is detectable in 10% of the cases only. Extraintestinal spread has been observed. Aside from the oral cavity, the nose and the larynx may be involved in the head and neck region,,. Nasal involvement is extremely rare since less than 15 cases have been reported throughout the world so far,,,,,,,,. Nasal symptoms: The spectrum of nasal symptoms consists of nasal obstruction, rhinorrhea, hyposmia, epistaxis and complaints of sinusitis. The nasal mucosa may appear diffusely reddish and hypertrophic and easily starts bleeding. Erosion, ulceration and necrosis of the septum or inferior turbinates may be visible,,,,. In addition, nasal septal perforation and saddle nose deformity have been reported,,. It is worth to mention that nasal symptoms may precede gastrointestinal symptoms. An association with WG and RP has been observed. Book and coworkers retrospectively analyzed 160 patients suffering from inflammatory bowel disease. They observed chronic sinusitis particularly in those CD patients (23%) who suffered from obstructive bowel complications, whereas rhinosinusitis was observed only in 7% of patients without obstructive bowel complications. Rhinosurgery: To our knowledge reconstruction of saddle nose deformities or closure of nasal septal perforations has not been discussed in the literature so far. Partial turbinate resection has been reported. Sinus surgery may become necessary to reduce sinonasal symptoms and to control orbital complications. Epidemiology/pathogenesis: Aside from CD ulcerative colitis (UC) belongs to the group of inflammatory bowel disease. An annual incidence of 6/100,000 in Germany has been reported. Although aetiology of UC still remains unclear, an autoimmunepathogenesis has been suggested. An association of UC with chronic sinusitis has been hypothesized in some patients. Nasal symptoms: Nasal septal perforation is a rarity. Epidemiology/pathogenesis: Heriditary hemorrhagic telangiectasia (HHT, Osler's disease) is an autosomal dominant-disease of angiogenesis. The underlying genetic aberrations are associated with formation of endothelial-lined vascular lakes and dilatated vessels. Because the vessel's wall structure is abnormal due to the lack of muscular or elastic support rupture of these vessels already occurs by small trauma. This can lead to substantial bleeding although coagulation factors and platelets are normal because pathologic vessels do not retract or undergo vasospasm. Currently, an incidence of 1/10,000 has been reported. Nasal symptoms: Quality of life is of HHT patients is mainly determined by recurrent episodes of epistaxis,, although arteriovenous malformations of the gastrointestinal tract, lungs, liver and brain are often associated with higher morbidity and mortality. A variety of treatment options to control epistaxis in HHT patients are available. These include topical therapies, hormonal therapies with estrogens, laser coagulation as well as argon-plasma coagulation,,,,. Argon-plasma coagulation, bipolare coagulation as well as anterior and/or posterior nasal packing represent procedures to control acute episodes of epistaxis. Severe epistaxis can be controlled by interventional radiological embolization, and surgical arterial ligation. Rhinosurgery: Recently, new data have been published analyzing long-term results and quality of life in HHT patients treated by septodermoplasty or nasal closure. The main principle of septodermoplasty (SDP) is resection of diseased mucosa of septal areas II and III and implantation of an epidermal graft. Elimination of easily bleeding mucosal areas leads to a reduction of the frequency of bleeding within the first two years. After two years however, new formation of telangiectatic vessels dorsal to the epidermal graft is often observed. As a consequence, the frequency of bleeding increases again. Moreover, access to the bleeding vessel then is usually difficult. These arguments have been considered as major points of criticism of this method. By contrast, recently published studies emphasize the benefit of this method. Levine and coworkers retrospectively analyzed (mean follow-up 3.75 years) 50 HHT patients and found that 86% of patients reported increased quality of life following septodermoplasty although they also complained about impaired sense of smell (78%), crusting (72%), hyposmia (58%) and symptoms of sinusitis (30%). Harvey and coworkers reported on a collective of 131 HHT patients who were followed up for 60 months. Overall 268 KTP laser procedures were performed. In addition, 33 patients underwent SDP, which was significantly associated with a reduced number of laser procedures postoperatively. Fiorella and coworkers analyzed retrospectively 67 patients who received SDP. Again, a majority of patients (57/67) reported a higher quality of life. In addition, the authors found a significant reduction of blood transfusions with 12 months postoperatively compared with the 12 months period before the operation. Recently, a modification of SDP has been performed by Lesnik. He resected the remaining nasal septum and then performed SDP in nine patients. An increase of quality of life was observed as well as a reduction of the need of blood transfusion. Taylor and Young introduced the method of permanent closure of the nasal nostrils in 1961. The aim of this procedure is to prevent dryness and traumata of the nasal mucosa thereby reducing the frequency of bleeding. Young himself reported about the problem of permanent breathing through the mouth and re-opened the nasal cavity in five of his patients. Nevertheless, permanent nasal closure may be an option in refractory cases as suggested by several authors,,. Hitchings and coworkers performed a modified Young's procedure in eight patients with sever bleeding episodes. Complete cessation of bleeding was observed in 88% of patients (mean follow-up 22 months). A detailed analysis revealed that reduction of episodes of bleeding was associated with increased quality of life which was considered even more important than permanent nasal obstruction. Overall, SDP and Young's procedure are options for HHT patients with recurrent severe episodes of epistaxis refractory to local therapies and laser coagulation since in these patients reduction of bleeding obviously determines quality of life more importantly than nasal obstruction. Rhinosurgery in patients with systemic diseases may become necessary to reconstruct saddle nose deformities and nasal septal perforations. Sinus surgery plays a role in patients with orbital and intracranial complications. In addition, sinus surgery may be useful in some patients to reduce sinonasal symptoms thereby improving quality of life (Table 1 (Tab. 1)). Extended diagnostic is mandatory if an underlying systemic disease is suspected and in cases of aetiological unclear saddle nose deformity or nasal septal perforation to prevent failure of rhinosurgery in such patients. Furthermore, non-reflected rhinosurgery may camouflage the symptoms saddle nose or nasal septal perforation as manifestations of a yet localized systemic disease. Thereby, the chance to prevent a potential fatal systemic disease by early treatment could be missed or delayed. Because of the rarity of numerous systemic diseases recommendations on the treatment of nasal deformities caused by systemic diseases are based on single case reports or case series only. Therefore, no specific rhinosurgical techniques have been established so far. However, according the experiences published cartilage and bone grafts haven been implanted with success in stable remission in patients suffering from tuberculosis, leprosy,, Wegener's granulomatosis,,,, sarcoidosis and relapsing polychondritis,. Experiences gained from these patients suggest that traditionally-proven surgical techniques of rhinoplasty,, can also be applied in sytemic diseases as far as the underlying disease has been successfully treated previously. Rhinosurgery is performed ideally in a state of complete remission meaning during complete absence of clinical, serologic and radiologic signs of disease. Nevertheless revision surgery has to be expected more frequently compared to a normal collective of rhinoplasties. The question whether cartilage or bone grafts are associated with equal outcomes has not been answered so far since outcome also depends several factors including stage and severity of the underlying disease. In WG costal cartilage grafts were associated with a better transplant success rate (83%) compared with bone grafts (calvarial bone graft; transplant success rate 75%). However, Shipchandler and coworkers did not observe complications or resorption in four cases of WG and in one case of sarcoidosis associated saddle nose deformity treated by implantation of a split calvarial bone L-shaped strut. Bone grafts were advocated because of greater availability and less resorption which, however, is not corroborated by the studies of Congdon and coworkers. In general, infection and resorption is rarely observed following implantation of autologous cartilage,. In addition, cartilage grafts display favourable biomechanical properties particularly if used in the tip area. Although alloplastic materials are available in almost unlimited amounts, usage is associated with a high risk of infection and extrusion,,. Therefore, autologous cartilage is the material of first choice in the reconstruction of saddle nose deformities,,,,. According to the data presented in this review this statement seems to be valid for some systemic diseases as well,,,,. In the case of nasal septal perforation caused by systemic diseases recommendations on closure of perforations are only theoretical due to missing clinical data. In general, nasal septal perforation occurs as complication following septal surgery, trauma or because of other factors,,,,,. Aside from these factors systemic diseases can be associated with nasal septal perforation. In many cases series and reviews retrospectively analyzing the outcome of different techniques for closure of nasal septal perforation, included patients were always free of any systemic disease. According to such a selection of patients it can be assumed that active systemic disease is a contraindication for closure of nasal septal perforation. Closure of asymptomatic nasal perforations is not indicated. In the case of active systemic disease that cannot be controlled implantation of a septal button is an alternative option,. In the case of surgical closure the operation is only performed if the mucosa has been fully rehabilitated,. Since implanation of autologous cartilage or bone grafts is also an important step in most multilayer techniques for closure of nasal septal perforation, experiences gained from reconstructive surgery of saddle nose deformities should be considered. It is essential to identify, eliminate or at least diminish the aetiological factor causing a nasal septal perforation,,. Provided that there are optimal conditions the same surgical techniques that have been proven successful in the closure of iatrogenic or traumatic nasal septal perforations can be applied in systemic diseases. According to our personal concept surgical approach and technique are dependent on the localization and the size of a perforation (Figure 6 (Fig. 6)). Small perforations (type A) can be closed by exchange of cartilage as demonstrated in HIV positive patient (Figure 2 (Fig. 2)). Type B perforations can be closed using bipedicled gingivobuccal flaps (Figure 7 (Fig. 7)). Larger perforations (type C) can be closed by cartilage implant and bilateral inferior turbinate flaps as demonstrated in a patient with WG in remission (Figure 4 (Fig. 4)). In general, successful closure of nasal septal perforation has been observed if a multilayer technique was applied. These techniques have the following steps in common: a) extensive subperichondrial/periosteal dissection and mobilization of the nasal mucosa from the remaining septum, nasal floor and root, b) tension-free closure of mucosal borders, c) interposition of a connective tissue graft such as temporal muscle fascia, periosteum, cartilage grafts with perichondreum or a combination thereof,,,,,. Overall, reconstruction of nasal deformities and closure of nasal septal perforation associated with systemic diseases has to be always decided in consideration of the type of the disease, severity of the disease, frequency of recurrences and prognosis. Ideally, patients should be in complete remission supported by excellent compliance and long-term medication.

nasal septal perforation, rhinoplasty, saddle nose, sinusitis, systemic disorder

PMC3675438_05

Female

Patient 5 was a 17-year-old girl, born as the second of three children to non-consanguineous Norwegian parents. The mother had Sjogren syndrome. The pregnancy was complicated by episodes of maternal bleeding. Delivery was normal, with the following birth measures: weight 3800 g, length 52 cm (both at the 75th centile) and OFC unknown. She walked independently at 14 months, and developed the stereotypic habit of constantly walking around. At 3 years and 3 months she showed delayed language and motor development, and hyperactivity. Testing with Bayley-II gave a Mental Developmental Index of 55, corresponding to a developmental age of approximately 2 years. Her language development was particularly delayed, and she lacked concentration and impulse control. At 8 years WISC-R gave an IQ of 60. A recent testing with WISC-IV gave an IQ slightly below 70, and Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and other tests were in accordance with this, indicating mild intellectual disability (IQ 50-69). She attended a school for children with learning disabilities. A cerebral MRI examination at 6 years was normal. She has had episodes of uncontrolled anger outbursts, sometimes with violent behaviour, and at age 14 she had a psychotic episode. Over the years she has displayed stereotypic behaviour such as chewing on her fingers, but she has not been considered as having ASDs. At the last examination, at age 17 years, she was obese with a Body Mass Index (BMI) of 30.6 and height 162.5 cm (25th centile). She had a mild unsteadiness when standing with her eyes closed. Muscle tone was normal. Hearing and vision were normal. Testing for fragile X syndrome and work up for detection of abnormal metabolites in the urine were normal. Dysmorphic features were not noted (consent to publish photos of this patient was not obtained).

PMC6329029_01

Female

An 18-year-old girl with type 1 diabetes mellitus presented with focal convulsions in September 2012. She was detected to have multiple tuberculomas. Biopsy of one of the lesion grew MTB. She was on second-line ATT since September 2012 as drug-sensitivity testing (DST) of the tuberculous lesion showed resistance to isoniazid (INH), rifampicin (R), pyrazinamide (Z), ethambutol (E), moxifloxacin (Mfx), ofloxacin (Ofx) and ethionamide (Eth). Her cererbrospinal fluid (CSF) examination was normal. She was put on capreomycin, PAS, cycloserine (Cys), clofazimine and linezolid (Lnz) along with carbamazepine and levetiracetam and prednisolone (1 mg/kg/day for 30 days and then tapered off in next 1 month). In February 2013, she had moderate sensorineural hearing loss, and capreomycin was omitted. Her serial magnetic resonance imaging (MRI) brain till August 2013 showed decrease in size and number of the granulomas in the frontal periventricular parenchyma bilaterally, but the left frontoparietal granuloma remained the same. In February 2014, Lnz and Cys were stopped and clarithromycin was added due to tingling and numbness in the right leg. In February 2015, computed tomography (CT) brain still showed presence of left frontal granuloma. In May 2015, her ATT was stopped, as she had completed 2 years 6 months of therapy and was asymptomatic except for persistence of left frontal granuloma. In April 2016 (Figure 1), granulomas remained the same in the frontal parenchyma, while the rest of the lesions had calcified, but the patient remained asymptomatic.

anti-tuberculous therapy, children, tubercular meningitis, tuberculoma