Datasets:

moukaii

/

Tuberculosis_Dataset

like 16

PMC6424709_01

Male

A 39-year-old male presented to the Emergency Room complaining of progressive blurring of vision in the right eye. The patient underwent best-corrected visual acuity testing, full ophthalmic slit-lamp examination of the anterior and posterior segments, (SD-OCT), and fluorescein angiography. Visual acuity was 20/22 in the right eye and 20/20 in the left eye, without correction. Anterior segment examination in both eyes was unremarkable and intraocular pressure was 18 mmHg. Fundus examination of the right eye showed 1 disc diameter whitish yellow inflammatory lesion inferotemporal to the macula not involving the fovea with focal vitritis. The fundus examination of the left eye was normal. SD-OCT in the right eye showed subertinal fluid and retinal thichening indicating an active retinochoroiditis. Fluorescein angiography showed early hypofluorescence of the lesion and involved vessels with progressive hyperfluorescence due to leakage of the dye in addition to leakage from the involved blood vessels indicating vasculitis (Fig. 1). A serologic search for Toxoplasma gondii infection was positive for immunoglobulin G (133 UI/mL, reference value, 10 UI/mL), whereas immunoglobulin M levels were normal, indicating prior exposure to Toxoplasma. A syphilis screen and other tests, including for tuberculosis, toxocariasis, sarcoidosis and autoimmune diseases were all negative. A presumptive diagnosis of toxoplasma retinochoroiditis was made, and a regimen of spiramycin 1gm 3 times daily was started and planned for 6 weeks. Gradual reduction of the retinal edema was noted after 2 weeks of presentation and the patient was started on oral prednsolone 1 mg/kg/day with weekly tapering dose. 2 weeks later (1 month from presentation), mild reduction of visaul acuity in the left eye to 20/28 was noted and on fundoscopic examination, there was flattening and pigmentation of the lesion which indicate scarring, with the development superficial retinal folds involving the macula indicating traction at superficial macular layers. SD-OCT showed Vitreoretinal traction involving the superficial layers of the macula (Fig. 2). Patient was being closely followed up to detect any progression of traction. 2 months after complete resolution, the patient has developed a chorioretinitis lesion on the border of the previous scar which and on fundus fluorescine angiography it has shown a characteristic early hypofluoresence with late leakage (Fig. 3) indicating a toxoplasmosis satellite chorioretinal lesion for which another cycle of spiramycin has started for 45 days.

ocular toxoplasmosis, toxoplasma retinochoroiditis, vitreomacular traction

PMC5569944_01

Female

A 21-year-old woman of Cuban origin presented with multiple digestive complaints. Severe watery diarrhea and poor feeding tolerance were documented shortly after birth. During her childhood she adopted several dietary restrictions, avoiding gluten, lactose, and fruits with no significant improvement. At age 14 years, intermittent abdominal pain and refractory iron-deficiency anemia were noted. Her medications included oral and intravenous iron supplements. At age 20 years, esophagogastroduodenoscopy (EGD) showed diffuse severe inflammation with edema, erythema, and nodularity in the gastric body (Figure 1). Histopathology was positive for H. pylori and showed normal duodenal mucosa without villous atrophy. Serology was negative for celiac disease while on a diet containing gluten. Her autoimmune panel was unremarkable. H. pylori was successfully eradicated with triple therapy (clarithromycin, amoxicillin, and omeprazole), but severe cramping persisted. At age 21 years, she was referred to our clinic, with disabling abdominal pain that worsened after food ingestion. Additional symptoms included low-grade fevers, acid reflux, persistent hiccups, and postprandial diarrhea. Physical exam revealed a slim patient (body mass index 19.5 kg/m2). Laboratory studies showed hemoglobin and hematocrit on the lower-normal range. Serum immunoglobulin G (IgG), IgM, IgA, IgE, C3, and C4 were normal. Stool studies were negative for ova and parasites. A second EGD showed diffuse gastric atrophy and blotchy areas of erythema, with significant improvement from prior endoscopy (Figure 2). Prior gastric nodularity resolved, and both the esophagus and duodenum were normal. Histopathology revealed chronic gastritis with subepithelial collagen thickening that was confirmed with Masson trichrome stain. The collagenous band thickness measured 200 mum with a scattered infiltrate of plasma cells and eosinophils. H. pylori immunostaining was negative (Figure 3). Colonoscopy was normal, and random biopsies showed no evidence of collagenous colitis. Computed tomography enterography, a fructose intolerance test, and capsule endoscopy were unremarkable. CG was diagnosed. The patient was started on oral budesonide, delayed-release capsules, at a dose of 3 mg twice a day. The capsules were opened and the granules mixed with maple syrup. Six months later, the patient showed moderate improvement of abdominal pain, anemia resolution, and persistent heartburn.

PMC10294669_01

Male

A 58-year-old man was admitted to a local hospital in March 2022 due to nausea and vomiting. His blood test results showed that he had a white blood cell count (WBC) of 25.3 x 109/L, hemoglobin (HB) 65 g/L, and platelet (PLT) 190 x 109/L. At the time, the doctor considered the possibility of acute leukemia. He was then transferred to the Hematology Department of The First Affiliated Hospital, Zhejiang University School of Medicine. When the patient's bone marrow was examined, the findings revealed that there was clearly active mononuclear system hyperplasia, with 51% of original mononuclear cells and immature mononuclear cells. Bone marrow flow cytometry indicated that the original myeloid cell population accounted for 20.46% of non-erythroid cells, expressing CD117, CD34, CD33, CD13, HLA-DR, CD38, CD123, and CD56. The chromosome was a normal karyotype. BCR/ABL, AML1/ETO, and PML/RaRalphafusion genes were all negative. DNMT3A (mutation rate 48.02%), FLT3-TKD (mutation rate 36.3%), and IDH2 (mutation rate 45.95%) were found by next-generation sequencing (NGS). The patient was diagnosed as having acute myeloid leukemia (AML)-M5b with DNMT3A, FLT3-TKD, and IDH2 mutations. Following the admission, the patient's general condition was assessed and symptomatic supportive care was intensified. But chest computed tomography (CT) revealed two pulmonary tuberculosis (TB). In the sputum, acid-fast bacillus (AFB) 3+ was found. The patient received 2 months of TB pleurisy treatment 30 years ago and then stopped taking tuberculous drugs. On March 23, the patient was transferred to the TB Department of our hospital. Blood counts were WBC 29.9 x 109/L, neutrophils 17.9 x 109/L, HB 60 g/L, PLT 175 x 109/L, with manual classification showing abnormal cells in 15%. Two pulmonary TB lesions were visible on a chest CT, and the right upper lung cavity had formed (Figures 1A1, A2). The patient immediately received HRZE (Isohydrazide 0.3 g QD + Rifampicin 0.45 g QD + Pyrazinamide 1.5 g QD + Ethambutol 0.75 g QD) regimen anti-TB therapy. The patient's WBC did, nevertheless, reach a maximum of 99 x 109/L, and neutrophils reached 59.8 x 109/L. He was treated with hydroxycarbamide for the purpose of reducing his WBC count. When sputum smears were negative for 3 consecutive times, blood counts were WBC 11.9 x 109/L, neutrophils 7.8 x 109/L, HB 52 g/L, and PLT 74 x 109/L. On April 8, he was transferred to the Hematology Department of our hospital and started receiving VA (Venetoclax 100 mgd1, 200 mg d2-7+Azacytidine 100 mgd1-7) regimen anti-leukemia therapy immediately. Due to venetoclax and rifampicin conflict, the regimen of anti- TB regimen was adjusted to Levofloxacin 0.5 g QD + Isohydrazide 0.45 g QD + Pyrazinamide 1.5 g QD + Ethambutol 0.75 g QD. Following one course of the VA regimen, the bone marrow routine showed 4% primitive mononuclear cells and 35% naive mononuclear cells. A total 28% of juvenile mononuclear cells were identified by bone marrow flow cytometry. The chromosome was a normal karyotype. NGS highlighted DNMT3A (mutation rate 45.6%), FLT3-TKD (mutation rate 26.7%) and IDH2 (mutation rate 32.9%). On May 6, the patient was given HVA (Homoharringtonine 2 mg d1-7 + Venetoclax 100 mg d1, 200 mg d2-7 + Azacytidine 100 mg d1-7) regimen anti-leukemia therapy. On May 25, the blood counts routine showed WBC 5.2 x 109/L, neutrophils 4.7 x 109/L, HB 64 g/L, and PLT 336 x 109/L. The original mononuclear cells in the bone marrow routine were only 1%. Flow cytometry of bone marrow showed no blasts with obvious immunophenotypic abnormalities. NGS test exhibited DNMT3A (mutation rate 44.7%), and no mutation was detected in IDH2 and FLT3-TKD. After that, the patient underwent three cycles of the HVA regimen anti-leukemia therapy consecutively on June 1, July 8, and August 9, and no abnormalities were found in multiple bone marrow routines and flow cytometry. On August 23, NGS showed DNMT3A (mutation rate 46.5%), with no mutation detected in IDH2 and FLT3-TKD. Moreover, on July 5, and on August 3, respectively reviews of chest CT suggested the lung TB foci progressive reduction (Figures 1B1, B2, C1, C2). No AFB was repeatedly detected in the sputum. He was treated with intrathecal chemotherapy three times (cytarabine 50 mg + methotrexate 15 mg + dexamethasone 5 mg) for the purpose of preventing the growth of central leukemia. On September 15, the blood routine showed WBC 4.1 x 109/L, neutrophils 2.63 x 109/L, HB 121 g/L, and PLT 242 x 109/L. The patient has now had a bone marrow transplant. The adverse reactions of the patient during the use of HVA regimen are shown in Table 1.

dnmt3a mutation, flt3-tkd mutation, idh2 mutation, active pulmonary tuberculosis, acute myeloid leukemia, complete remission, homeharringtonine

PMC5932753_01

Female

A 24 year-old female was struck by a trolley as an adolescent and sustained a severe Grade 3C open femur fracture. After a multistage limb salvage procedure which required vascular repair and soft tissue reconstruction, she presented to our clinic more than a decade after the injury. The patient stood 1.6 m and weighed 64.8 kg, with a calculated Body Mass Index (BMI) of 25.3. She acquired a leg length discrepancy of 30 mm, right shorter than left, had right hip pain, walked with a limp and complained of symptomatic hardware about her hip (Fig. 1). She underwent a proximal femoral osteotomy and placement of a 10.7 mm antegrade PRECICE expandable femoral IMN (Fig. 2). Although she required four units of pRBC transfusion post-operatively, she tolerated the procedure well with no other complications. The femur was left in situ after the osteotomy to allow surgical wounds to heal. Ten days post-operatively, she followed up with uncomplicated healing wounds to begin her lengthening, 1 mm per day for a goal of 30 mm total lengthening. She was followed weekly with physical exams and plain film radiographs (Fig. 3). After four weeks of lengthening, physical exam demonstrated equal iliac crest height on standing and symmetric rotation. Bilateral long leg Weight-Bearing (WB) plain films demonstrated that the right femur was within 2 mm of length compared to the left femur (Fig. 4) and regenerate was visible in the osteotomy gap. There was some backing out of one of the distal interlocking screws. We believed that she had achieved goal length and started her on 25% WB and physical therapy for hip and knee range of motion and strengthening. Four weeks afterwards, the patient reported increased pain in her right thigh and felt that her right leg had shortened. On physical exam, she was grossly 2 cm short on her right lower extremity with tenderness to palpation over the distal interlocking screw. Plain films demonstrated a 25 mm leg length discrepancy (Fig. 5). Closer inspection of the radiographs revealed that the flange of the nail was flared distally (Fig. 6) and the lengthening mechanism had failed. We attempted to resume her original lengthening protocol, with the hope of regaining some of the lost length. She continued the protocol and stayed non-WB for the duration of her lengthening, however only an additional 5 mm were gained (Fig. 7) as the mechanism would not lengthen any further, presumably due to the mechanical failure. Over the next several months, she continued to have pain in her right thigh and was unable to weightbear without crutches. Her osteotomy went on to nonunion and she eventually underwent exchange nailing (Fig. 8).

distraction osteogenesis, femoral lengthening nail, nonunion

PMC8777097_01

Male

A previously healthy, 36-year-old Chinese man presented with papulonodules on his face and hands that had emerged over an 8-month period, along with experiencing polyarthritis for half a year. He reported smoking half a pack per day for 17 years. His family history was significant for malignancy in that his mother had breast cancer. On admission, a physical examination revealed multiple flesh-coloured to pinkish papules and nodules on his face ( Figure 1A ), distal interphalangeal and proximal interphalangeal areas, and papulonodular lesions arranged around the nail plica in a typical "coral bead" pattern ( Figures 1B, C ). The cutaneous lesions were tender but without pruritus. There was also significant tenderness noted in the bilateral interphalangeal joints, wrists, elbows, shoulders, ankles, knees and hips, with no signs of swelling. Laboratory tests showed slightly elevated inflammatory markers, including a C-reactive protein (CRP) level of 23.4 mg/L (reference range, <5 mg/L), erythrocyte sedimentation rate (ESR) of 49 mm/h (reference range, <21 mm/h), interleukin-6 (IL-6) level of 9.69 pg/ml (reference range, 0-7 pg/ml) and tumour necrosis factor (TNF) level of 9.26 pg/ml (reference range, <7 pg/ml). Routine blood, biochemistry, urinalysis, C3 and C4 levels were normal. The levels of tumour markers (CEA, AFP, CA125, CA19-9, CA72-4, CA15-3, CYFRA21-1 and PSA) did not exceed the reference range. Further analysis revealed that the patient showed ANA (titer 1:320), LA (1.93, reference range, 0.8-1.2, LA performed with dilute Russell's viper venom time [dRVVT] screen/confirm), PPD test and tuberculosis interferon-gamma release assay positivity. The level of fibrinogen was 5.47g/L (reference range, 2.0-4.0 g/L). Tests for anti-dsDNA, anti-Smith, anticentromere, anti-ribonucleoprotein, anti-Jo1, anti-neutrophil cytoplasmic antibodies, rheumatoid factor (RF), anti-cyclic citrullinated peptide antibodies (ACPA), anticardiolipin antibodies (IgG, IgM and IgA), anti-beta2-glycoprotein I antibodies (IgG, IgM and IgA) and HbsAg were all negative. Radiographs of the joints revealed osteoporosis in both hands and wrists and a slightly narrowed space between the first and second metacarpophalangeal joints of both hands ( Supplementary Material 1 ). High-resolution computed tomography (HRCT) of the chest revealed emphysema and an inconspicuous mass of lymphoglandula within the posterior mediastinum ( Figure 1D ). The patient underwent endobronchial ultrasound (EBUS) puncture biopsy of the mediastinal lymphoglandula to exclude cancer after consultation with the Department of Respiratory Medicine. Contrast-enhanced CT imaging of the whole abdomen revealed calcified plaques in the abdominal aorta and its branches, with mural thrombosis. The above indicators led to a presumptive diagnosis of undifferentiated connective tissue disease and possible antiphospholipid syndrome. On day 7, the histopathologic features of the papulonodular skin lesions showed proliferation of abundant foamy macrophages and the presence of histocytes ( Figure 1E ). These lesions contained CD68-positive cells ( Figure 1F ) that were negative for S100, CD1a, Langerin, and Factor VIII markers ( Supplementary Material 2 ). Thus, a histological diagnosis of MRH was made. The patient received methotrexate (15 mg once a week) accompanied by oral prednisone (10 mg twice a day) and was discharged after 20 days of treatment. He continued the above regimen after discharge according to his doctor's instructions. Approximately one month later, he was admitted again for assessment, which indicated that the papulonodular lesions had shrunk and that the inflammatory cytokines and molecules described above had returned to normal levels. Nonetheless, the patient's joint pain was not significantly relieved. The results of EBUS puncture biopsy of the mediastinal lymphoglandula were available at the second hospital admission and showed a small number of abnormal cells ( Supplementary Material 3 ). Immunohistochemistry showed cells positive for PCK, EMA, CK5/6 (focal), GATA-3, Ki67 and MIB-1 (20% positive). CR, TTF-1, P63, D2-40 and CgA were negative, and a diagnosis of epithelial neoplasia was made. To identify the primary lesion, fluorodeoxyglucose positron emission tomography/CT (FDG-PET/CT) was carried out, revealing increased glycometabolism in the soft tissue around the joints of the extremities and the mediastinal lymph nodes; the subcarinal lymph node findings confirmed the suspicion of malignancy ( Figure 2 ). However, the primary tumour was not found despite exhaustive tests. The patient discontinued methotrexate and prednisone according to the recommendations of the multidisciplinary treatment (MDT) team. To further clarify the diagnosis and treatment approach, the patient received video-assisted thoracoscopic surgery (VATS) to excise the mediastinal mass (6x3.5x2.8 cm) for genetic analysis. Malignant cells were identified in the background of abundant lymphoid tissue in the mediastinal mass ( Supplementary Material 4 ). Histopathologic features of malignant cells were positive for P63 (focal), CK5/6 (focal), PCK, GATA-3, and Ki-67 (MIB-1, 50-60%) but not CR, PAX-8, CD5, CD117, WT-1, CgA, or EBER1/2, resulting in a diagnosis of poorly differentiated adenosquamous carcinoma. Genetic analyses revealed the presence of mutations in the SMARCA gene A4 (NM_003072.3:c.2438+1G>A IVS16, mutation rate 36.4%), amplification of EGFR, and a lack of PD-L1. After discussion with oncologists, chemoradiotherapy was administered, namely, intravenous paclitaxel 210 mg for 1 day combined with intravenous carboplatin 450 mg for 1 day (once every 3 weeks) and radiotherapy for the mediastinal lymph nodes. After 6 months of follow-up from the diagnosis of malignancy (5 cycles of chemotherapy and 30 cycles of radiotherapy), the patient's joint pain was significantly reduced, and the papulonodular lesions had almost cleared, without any specific treatment. The latest re-examination on June 29, 2021, revealed that the patient was ANA negative and the LA level had decreased to 1.32, with no signs of tumour recurrence. The patient is still being followed-up. The changes to the lesions on the hands are presented in Supplementary Material 5 . The patient's clinical course is shown in Figure 3 .

case report, mediastinal malignancy, multicentric reticulohistiocytosis, paraneoplastic syndrome, rare disease

PMC4885692_01

Male

Avulsion calcaneal tuberosity fracture is an uncommon but potentially serious condition. Recent studies on the epidemiology of these specific fractures have demonstrated that avulsed calcaneal fractures account for 1.3% of all calcaneal fractures. It is therefore understandable that little has been written about these fractures. This type of injuries is usually caused by sudden muscular contraction of the Achilles tendon when the heel is flat on the ground. We report a very rare case of avulsion of the tuberosity of the calcaneus. A 47 year old male was admitted to the emergency department withpain and total functional impotence of his right lower limb after falling on the footduring a football game. The X-ray examination showeda displaced extra-articular fracture of the tuberosityof the calcaneus(A). The fixation of this fracture was carried out using an anterior-lateral approach, the large fragment wasstabilized with two kirschner wires (B). After reduction and healing, the patient recovered fully without clinical weakness of the triceps surae.

avulsion, calcaneus, tuberosity

PMC9329676_01

Female

A 61-year-old female with chills and fever was admitted to the emergency department of the first affiliated hospital of Zhejiang university school of medicine on December 27, 2021. She developed a sudden fever of 39.4 C with no apparent cause, accompanied by chills, malaise, cough, and a small amount of white mucous sputum. She had a history of rheumatoid arthritis for more than 15 years and had taken methylprednisolone (2 mg, twice a day) since then. She was diagnosed with allergic vasculitis about one year ago and the dosage of methylprednisolone was adjusted to 16 mg, twice a day. She had skin ulcers on her lower extremities one month before admission, and after regular treatment, the skin ulcers seemed healed upon admission to our emergency department. Laboratory findings upon admission to the emergency department were shown as follows: white blood cell, 21.52x109/L; neutrophils, 91.1%; lymphocytes, 5.5%; red blood cell, 4.33x1012/L; hemoglobin, 118 g/L; platelet, 172x109/L; C-reactive protein, 129.97 mg/L; and procalcitonin, 2.45 ug/L. Other laboratory results were within the normal range. The chest computed tomography (CT) demonstrated multiple nodular foci with partial cavitations in the lower lobes of both lungs (Figure 1A). Given the possibility that the above findings were caused by infection, the patient was then transferred to our respiratory ward for further treatment. Her vital signs were shown as follows: temperature, 36.2 C; blood pressure, 112/60 mmHg; pulse rate, 84 beats/min; and respiration rate, 20 breaths/min. She was conscious with no systemic symptoms. The chest CT demonstrated small nodules and pulmonary bullae in the right lower lung (Figure 1B). The abdominal enhanced CT showed a low-density focus in the right abdominal wall, small stones in the left kidney, a small amount of pelvic fluid, and low-density nodules next to the upper pole of the right kidney. The result of blood next-generation sequencing (NGS) from the emergency room revealed Nocardia farcinica (Table 1). Staphylococcus aureus and Nocardia farcinica were found in sputum culture. Antibiotic susceptibility testing revealed that the cultured bacterium was sensitive to trimethoprim-sulfamethoxazole (TMP-SMX), amikacin, linezolid, and imipenem (Table 2). Cryptococcus neofermans capsule antigen, fungal D-glucan, T-cell and gene Xpert for tuberculosis, autoantibodies, and rheumatoid factor tests were all negative. To counteract the infection, the patient was treated with TMP-SMX, linezolid, and imipenem based on the antibiotic susceptibility test. Given the patient's occult blood in the stool, the hormone was suspended on the advice of gastroenterology, rheumatology, and immunology consultants. On December 31, 2021, the patient experienced a sudden generalized seizure with loss of consciousness for approximately one minute. Her airway was immediately opened, and midazolam was used for anti-epilepsy. The brain-enhanced magnetic resonance imaging (MRI) revealed nodular and patchy abnormal signal lesions with clear boundaries were found in the left frontal lobe and right basal ganglia, and that the lesions appeared gyri-form, ring-like, and inhomogeneous after enhancement. The largest lesion was approximately 4.7x3.5 cm with a low signal on T1WI, a high signal on T2WI, and an inhomogeneous high signal on FLAIR (Figure 2A). The patient was diagnosed with disseminated nocardiosis and then transferred to the intensive care unit (ICU). In the ICU, she was performed with ventilator-assisted ventilation (BIPAP mode: FiO2, 25%; peak airway pressure, 20 cmH2O; PEEP, 5 cmH2O). The cerebrospinal fluid (CSF) test showed: pressure, 250 mmH2O; colorless and clear; Pan's test negative; erythrocytes, 40/L; nucleated cells, 2/L; chlorine, 122 mM; glucose, 3.2 mM; and protein, 0.36 g/L. The Cryptococcus neoformans capsular antigen and tubercle Bacillus tests in both CSF and blood were negative. Nocardia farcinica was also found positive in bronchoalveolar lavage fluid (BALF). Mycobacterium tuberculosis was negative in the sputum and the BALF. The patient was continuously given TMP-SMX, imipenem, and amikacin. Simultaneously, she was administered levetiracetam and topiramate for counteracting epilepsy, and mannitol for reducing intracranial pressure. During her 10-day stay in the ICU (from December 31, 2021 to January 10, 2022), the patient had no seizures but had a persistent fever (the highest body temperature was 39.4 C) and a large amount of yellow purulent sputum. Auscultation of both lungs revealed sporadic moist rales. The chest CT on January 10, 2022 revealed multiple nodules with partial cavities and lung vasculitis in both lungs (Figure 3A). In multi-repeated sputum cultures, Nocardia farcinica, Aspergillus flavus, and Burkholderia neocepacia were discovered (Table 3). Considering the progression of vasculitis and exudative lesions in lungs, a tracheotomy was performed and the ventilator parameters were adjusted (BIPAP mode: FiO2, 45%; peak airway pressure, 26 cmH2O; PEEP, 8 cmH2O). Amikacin was then suspended, and voriconazole was added for antifungal therapy. Since the patient had a history of allergic vasculitis, she was given methylprednisolone (40 mg, intravenously every 12 h) and mannitol (20 g, intravenously every 12h). Until January 17, 2022, the patient had no fever or seizures, and showed a great improvement in pulmonary ventilation function. The brain and chest CT on January 17, 2022 revealed a low-density lesion in the left frontal lobe of the brain and multiple infectious lesions accompanied by local cavities in both lungs (Figure 3B). Compared with the chest CT images on January 10, 2022 (Figure 1A), those on January 17, 2022 indicated a great alleviation of pulmonary infection in this patient (Figure 3B). The antibiotic regimen was then adjusted to TMP-SMX, linezolid, voriconazole, and methylprednisolone without mannitol. The patient was performed with high flow-assisted ventilation (oxygen concentration, 30%; flow rate, 50 L/min) after a spontaneous breathing trial, and the tracheostomy cannula was removed on January 21, 2022. The patient was then transferred to the general ward on January 21, 2022 as her condition became stable On January 27, 2022, the administration of linezolid was suspended. TMP-SMX, voriconazole, and methylprednisolone were orally administered to the patient for anti-infection and anti-allergic vasculitis. On January 29, 2022, Nocardia farcinica and fungi were not discovered in her BALF. However, the cytomegalovirus antigen (PP65) was detected positive in blood. We then supplemented the treatment regimen with ganciclovir (500mg, orally tid) for anti-virus. She had no fever within one week (February 1-7, 2022), and her chest CT imaging signs were greatly recovered on February 6, 2022 (Figure 3C). The patient was discharged on February 6, 2022. She continued taking TMP-SMX, ganciclovir, methylprednisolone, and voriconazole and had no obvious clinical symptoms including fever, cough, and seizure within the 2-month follow-up. The chest CT on April 16, 2022 showed several bronchial cavities in the lungs (Figure 3D). Her head MRI was gradually improving (Figure 4A and B). The treatment regimen was then changed to a combination of TMP-SMX and triamcinolone.

nocardia farcinica, disseminated nocardiosis, pulmonary fungus, secondary epilepsy

PMC3687409_01

Female

A 59-year-old woman after total strumectomy due to papillary thyroid carcinoma (pT1a,N0,M0) was admitted to the Department of Endocrinology to provide an ablative dose of radioactive iodine. Despite the 4-week thyroxine withdrawal, serum TSH was 7.24 microU/ml (normal 0.27-4.2 microU/ml) with normal concentrations of free hormones (fT3 4.98 pmol/l, fT4 12.09 pmol/l). In ultrasonography of the neck thyroid tissue in the thyroid bed with dimensions 11 x 13 x 20 mm was detected. Serum concentration of thyroglobulin was 102.7 ng/ml, autoantibodies against Tg (anti-Tg) 30 U/ml. In the study of whole-body scintigraphy with 131-I, out of focus tracer accumulation in the thyroid bed, there were no further outbreaks of tracer uptake. In the imaging studies of the neck and chest metastases were not found. Gynecological ultrasound revealed the presence of bilateral ovarian tumors with dimensions 6 x 4 cm in the right ovary, 7 x 3 cm in the left one. Due to the lack of TSH stimulation radioiodine treatment was abandoned. The patient underwent gynecological surgery - total hysterectomy with appendages was performed. Histopathological diagnosis was bilateral ovarian teratomas with the presence of thyroid tissue. The patient was re-admitted to the Department of Endocrinology for subsequent radioactive iodine therapy. After 4-week levothyroxine withdrawal the following results were obtained: TSH 36.34 microU/ml, Tg 16.85 ng/ml, aTg 24 U/ml. The patient received 150 mCi of 131-I, then suppressive doses of thyroxine. Diagnosis after a control period of 12 months is currently planned.

tsh stimulation, differentiated thyroid cancer

PMC7530215_01

Female

A 27 years old female patient presented with kyphotic deformity of 86.6 degree at the thoracolumbar area from thoracal (Th)10 - Lumbar (L) 2, with destruction of Th11, 12, and L1 due to spine tuberculosis as demonstrated in Fig. 1. Preoperative evaluation showed her neurologic status was without abnormality. She underwent laminectomies, PVCR, one level Smith Peterson Osteotomy (SPO), posterior instrumentation by pedicle screws from Th 8,9,10 and L2,3,4, and fusion by local bone graft. Intraoperatively, the intraoperative nerve monitoring (IONM) showed normal finding without any disturbance, with SSEP (somatosensory-evoked potential) and TcMEP (trans cranial motor-evoked potential) values were as baseline and FrEMG (free-running electromyography) value was without spontaneous activity throughout the operative procedure (Fig. 2). Pedicle screws insertion were confirmed by fluoroscopic guidance and were in good position, the correction was performed by cantilever technique. After the procedure, there were no pathological changes in SSEP, and TcMEP was preserved. A piece of absorbable gelatin sponge approximately in the size of laminectomy defect was applied over the exposed dura in order to control bleeding and prevent adhesion of soft tissues. During surgery the haemodynamic was good. Blood loss during surgery was 1500 cc, and packed cells replacement of 1500 cc was given. The wound was closed and a drain was placed properly beforehand. Five h postoperatively after patient woke up, motoric power grade 5 was scored for both lower extremities with no abnormalities and with good hemodynamic status. Drain output was recorded to be 480 cc for 24 h, with continuous flow and with no obstruction. Early during postoperative care within 24 h, patient showed gradual neurological deficit. In left lower extremity, the muscle power decreased from grade 5 to 2, whereas the muscle power of right lower extremity was still normal. Within 48 h after surgery, the muscle power score of 2 involved the right lower extremity, following the contralateral side.

absorbable gelatin sponge, case report, postoperative neurological deficit, spinal cord compression

PMC3030507_01

Female

The index case was a one-year-old female from Xixiang County, Hanzhong, Shaanxi Province. She had an onset on 15 January with an admission to Hanzhong Central Hospital with complaints of cough, expectoration asthma with a fever for 5 days. The clinical diagnosis was acute bronchitis with heart failure and toxic encephalopathy where the patient died on 30 January. Thirty-two cases of severe acute lower respiratory tract infections were reported through 9 February 2009; and another thirty-eight cases were found in four hospitals in Hanzhong city of Shaanxi Province with the definition of severe pneumonia: 1. Prolonged fever continuing at 37.5 C - 40 C. 2. Iconographic pneumonia with apparent respiratory symptoms. 3. Normal or lower total WBC. 4. No apparent improvement or became more severe after 3-day treatment with antibiotics. During the outbreak of the disease, 21 pharynx swab specimens and 21 acute-phase sera samples were collected from 21 patients; and 12 returning patients gave convalescent-phase sera. The pharynx swab specimens were collected and transferred to 1 ml viral transport medium. The 21 pharynx swab specimens collected from the patients were inoculated onto HEp-2 cells and were cultured in a maintenance medium (Minimal Essential Medium containing 2% fetal calf serum, 100 U/ml penicillin G and 100 mug/ml streptomycin) at 37 C in a closed system without added CO2. Cultures exhibiting an adenovirus-like CPE were passed again to confirm the presence of the virus. Primary identification of positive isolates was performed using PCR with adenovirus-specific primers. The stored serum samples were inactivated at 56 C for 30 min; diluted eight times with the maintenance medium; and filtered through a 0.22 mum filter membrane. Dilutions of the serum samples (1:8 to 1:1,024) were prepared and 50 mul of each dilution was added to four wells of a 96-well microplate. The entire virion of the HAdV strain isolated and identified was used as the neutralization virus. The 50% cell culture infective dose (CCID50) per 50 mul was calculated using the formula of Karber. An ELISA Classic adenovirus IgA kit (Institute Virion/Serion GmbH, W.rzburg, Germany) that enables the detection of serum antibodies against all serotypes of HAdV pathogenic for humans was used to detect HAdV immunoglobulin A (IgA) from the 21 acute phase sera samples from 21 patients. The viral nucleic acid was directly extracted from the clinical specimens using a QIAamp mini-viral RNA extraction kit or a QIAamp DNA mini kit (Qiagen, Valencia, CA). Reverse transcription-PCR (RT-PCR) or PCR was performed using the Seeplex RV Detection Set I (RV6C00Y, Seegene, USA) that is designed to detect 11 types of RNA viruses and one type of DNA virus responsible for most respiratory diseases. The 11 RNA respiratory viruses include influenza A and B virus, human respiratory syncytial virus A and B, human metapneumovirus, human parainfluenzavirus, human rhinovirus A, and human coronavirus 229E/NL63 and OC43. The DNA respiratory virus was human adenovirus. We also used the adenovirus species-specific PCR that can distinguish the six species of adenovirus and type-specific PCR of species B described by Pring-.kerblom. The PCR was performed using primer pairs ADSD/AD52 as described by Zhen. The PCR reaction was performed using a GeneAmp 9700 thermal cycler (Applied Biosystems). The amplification products were analyzed by electrophoresis of the samples in 1% agarose gels; and they were visualized with ethidium bromide under UV light. The PCR products were sequenced directly after purification (QIA gel extraction kit; Qiagen, KK, Japan) using the dye terminator method (Big Dye Terminator, version3.1, cycle sequencing kit; Applied Biosystems) with an ABI Prism 3100 genetic analyzer (Applied Biosystems). The primers of adenovirus used for sequencing are shown in Table 2. The primers of human respiratory syncytial virus, human parainfluenzavirus, human rhinovirus and enterovirus were donated by colleagues in other laboratories in the Institute. The sequence data were stored as standard chromatogram format files (.ab1) and were analyzed using Sequencer soft ware (version 4.0.5; Gene Codes, Ann Arbor, MI). The nucleotide sequence homology was inferred from the identity scores obtained using the BLASTn program (National Center for Biotechnology Information, Bethesda, MD). Sequence alignments were created with BioEdit Sequence alignment editor software (version 5.0.9; Tom Hall, North Carolina State University); and a phylogenetic dendrogram was constructed using the neighbor-joining method with the MEGA program (Sudhir Kumar, Arizona State University); and the reliability of the tree was estimated with 1,000 bootstrap pseudo-replicates. The nucleotide sequence of the entire hexon gene for strain HAdV7-HZ/SHX/CHN/2009 determined in this study was deposited in the GenBank nucleotide sequence database under accession number GU230898.

PMC8649718_01

Male

Our patient was a 61-year-old male. He was admitted into the cardiac care unit (CCU) of our hospital because of more than 16-h precordial pain. Sixteen hours ago, the precordial pain with no obvious cause occurred. The pain was persistent and accompanied by a radiation pain in left shoulder. There were no other concomitant symptoms, including chest tightness, panic, fever, nausea and vomiting, dizziness, headache, etc. There was no significant relief in the pain after taking "SUXIAO JIUXIN PILL." Then, the patient called an ambulance and went to the local hospital. After the electrocardiogram examination, the local hospital considered the diagnosis as acute myocardial infarction, and oral doses of aspirin and clopidogrel were prescribed. For further diagnosis and treatment, the patient was transferred to the emergency department of our hospital. Electrocardiogram (ECG) examination showed that ST segment elevated in the lead of AVR and V1 and depressed in other leads. The laboratory examination showed that troponin was elevated, so he was admitted to the CCU of our hospital. Asking patients and his family members carefully, the patient underwent coronary angiography in our hospital 11 years ago, showing that 40% stenosis occurred in the distal segment of the left main coronary artery (LM); the stenosis of the proximal segment of LAD was 40%; long lesions in the proximal and middle left circumflex branch (LCX), the narrowest part of LCX was about 80%, and the distal segment of LCX was about 70%; nearly 70% stenosis occurred in the obtuse marginal branch 1 (OM1); the proximal segment of the RCA was completely occluded and the distal segment was visualized through the left coronary collateral branch. After evaluation, CABG was performed on him in our hospital. The patient had a history of hypertension for 11 years, and the blood pressure was as high as 180/110 mmHg. He took felodipine-sustained release tablets and irbesartan to control blood pressure and said that his blood pressure was well-controlled. He also had a history of diabetes for 11 years, and took Metformin and Acarbose for treatment, and his daily blood glucose was controlled at 7-8 mmol/L. He denied a history of chronic obstructive pulmonary disease (COPD), cerebrovascular disease, and other chronic diseases. The patient had 30 years of smoking history, about 20 cigarettes per day. At present, he had quit smoking for 11 years and drunk occasionally. Other family members had no similar clinical manifestations. Past medical history and family history revealed nothing significant. On admission, his body temperature was 36.4 C, the pulse was 96 beats per minute, his respiratory rate was 18 times per minute, his blood pressure was 150/85 mmHg (1 mmHg = 0.133 kPa). Physical examination showed that the patient was in a poor state of mind and spirit. The patient had a mild coarse breath sounds on auscultation and obvious moist rales could be heard. The heart boundary (cardiac dullness) was not big. The heart rate was 96 beats per minute. The heart sounds were normal, and the rhythm was regular. There was no pathological murmur in each valve auscultation area. No edema was found in both lower limbs. There was no distension of jugular vein and no sign of hepatic jugular vein reflux. Laboratory examination: the results of myocardial enzyme spectrum showed that cardiac troponin I (cTnI) was 3.8 mug/L (reference value was 0-0.023 mug/L), creatine kinase isoenzyme (CK-MB) was 38 mug/L (reference value was 0-7.2 mug/L), NT-pro BNP was 5,530 pg/ml (reference value was 0-300 mug/L); liver function revealed an ALT level of 11 mu/L, an aspartate aminotransferase (AST) level of 28 mu/L, an albumin (ALB) level of 40 g/L; renal function showed an serum urea nitrogen (BUN) level of 5.2 mmol/L, a serum creatinine (Cr) level of 48 mumol/L; blood sugar (BS) was 9.37 mmol/L; blood biochemistry revealed a total cholesterol (TC) level of 3.7 mmol/L, a low-density lipoprotein (LDL-C) level of 2.98 mmol/L, a sodium (Na+) level of 133 mmol/L, a potassium (K+) level of 3.98 mmol/L. Blood routine showed that the white blood cell count (WBC) was 10.60 x 109/L (reference value was 125-350 x 109/L), the proportion of neutrophils (NEU%) was 81.40%; ESR was 106 mm/h; CRP was 107 mg/L; other examinations were in the normal range. The 12-lead electrocardiogram showed normal sinus rhythm, ST segment depression in lead V4-V6, T wave flattening or inversion in chest lead and limb lead, abnormal Q wave in lead III and AVF (Figure 1). Echocardiography revealed multiple abnormalities: (i) enlargement of the left heart, with a left atrium diameter of 45 mm and a left ventricular diameter of 48 mm; (ii) the inferior wall of left ventricle became thinner, and the motion almost disappeared; (iii) the activity of myocardium near the apex of interventricular septum decreased. The estimated left ventricular ejection fraction (LVEF) was 45%; (iv) moderate pulmonary hypertension; (v) mild-to-moderate mitral regurgitation, mild-to-moderate tricuspid regurgitation. No obvious abnormality of heart and lung was found in chest X-ray at the bedside. Based on the main symptoms of the patient, typical ECG manifestations and changes of myocardial enzyme spectrum, and previous CABG operation history, the main diagnosis of the patient was acute non-ST segment elevation myocardial infarction (NSTEMI); the following diagnoses were made: (i) acute non-ST segment elevation myocardial infarction; (ii) hypertension (Grade 3, very high risk); (iii) Type 2 diabetes. Aspirin and clopidogrel were used to antiplatelet therapy, low molecular weight heparin (LMWH) was used to anti-coagulation, atorvastatin, and ezetimibe were used to decrease the serum lipid level. We used metoprolol, isosorbide mononitrate-sustained release tablets, and trimetazidine to relieve the symptom of angina pectoris; "metoprolol, valsartan, and amlodipine" were used to reduce blood pressure and improve ventricular remodeling; creatine phosphate was used to nourish the myocardium, nicorandil to improve microcirculation of coronary artery. Furosemide, spironolactone, and nesiritide can improve cardiac function, Dapagliptin, acarbose, and metformin were used to treat diabetes. After treatment, the condition of the patient was more stable than before. So, the patient underwent coronary angiography, showing that 50% stenosis occurred in the LM; the left anterior descending branch is small, with a stenosis of about 80% in the proximal segment and irregular in the middle and distal segments. The most severe stenosis is about 70%, and it can be seen that the distal part of the lad is retrograde to the right Corus artery; in LCX, the wall of proximal segment was irregular, the lesions in middle and distal segments were longer, and the most severe stenosis was about 90%; the wall of OM was irregular, and local stenosis was 40%; RCA was occluded from the proximal segment; the LCX bridge was unobstructed. We reexamined the echocardiography of the patients and found: (i) it was in accordance with the echocardiographic findings of myocardial infarction; (ii) enlargement of the left heart, with a left atrium diameter of 41 mm and a left ventricular diameter of 45 mm; (iii) segmental dyskinesia of left ventricular wall and decreased left ventricular diastolic function was found. The LVEF was 51%; (iv) mild pulmonary hypertension; (v) mild mitral and tricuspid regurgitation (Figure 2). The reexamination of cTnI was 0.01 mug/L (reference value was 0-0.023 mug/L), NT-pro BNP was 4,380 pg/ml (reference value was 0-300 mug/L); ESR was 109 mm/h; CRP was 107 mg/L. After the above positive treatment, the symptoms of precordial pain were significantly improved; the indexes related to myocardial enzyme spectrum were reduced to normal. The renal function and urine volume were acceptable. But the decrease of NT-pro BNP was not obvious; CRP and ESR were significantly increased during the treatment. We considered that pulmonary infection, tumor, and rheumatic disease could lead to significant increase of CRP and ESR. For this reason, we took chest X-ray at the bedside, and the inflammatory indicators were redetected. However, the results of Chest X-ray and the inflammatory indicators showed no signs of acute pulmonary infection or pulmonary tuberculosis. Therefore, the hypothesis that the significant increase of CRP and ESR was due to pulmonary infection was excluded. At the same time, male tumor markers and CT examination showed no obvious abnormality, so the increase of CRP and ESR caused by tumor was also excluded. Based on this, we conducted a careful physical examination of the patients. Palpation of bilateral radial artery showed that the pulsation of bilateral radial artery was inconsistent, the pulsation of dorsalis pedis artery was not touched, and vascular murmur could be heard by auscultation of carotid artery. Further detection of the blood pressure of the limbs: the left upper limb was 137/64 mmHg, the right upper limb was 132/52 mmHg, the left lower limb was 90/23 mmHg, and the right lower limb was 113/28 mmHg. We can find that the lower limb blood pressure is significantly lower than the upper limb blood pressure. According to the results of blood pressure and physical examination of limbs, and the increase of ESR, CRP, and other inflammatory indicators, we considered that the patient may be TA. Therefore, we improved CT angiography (CTA) examination; the results showed aortic atherosclerosis and multiple stenosis of its branches, and some showed moderate-to-severe stenosis, bilateral renal arteriosclerosis and multiple stenosis (Figure 3). And the results of carotid artery ultrasound showed stenosis in the initial segment of left internal carotid artery, left external carotid artery, and right external carotid artery (Figure 4).

takayasu's arteritis, takayasu's arteritis with coronary artery involvement, acute myocardial infarction, case report, coronary artery bypass grafting

PMC6402545_01

Male

A 9-year-old boy (45 kg,1.49 mts), full-term normal delivery, 2nd child in the family, born of the nonconsanguineous marriage, having good intelligence (std 5, rank holder in the class), completed all the immunization without any complication and was apparently healthy. He presented with recurrent episodes of abdominal pain, moderate grade fever(37.5-38 C), complete loss of appetite with nausea but no vomiting for last two years along with a feeling of soreness all over the body. This paroxysmal presentation was coming on once every 4-6 weeks without any apparent relation to food, weather or other environmental or extraneous factors. The paroxysm lasted for 3-4 days, without any skin rash, aphthous ulcers in the mouth, or a sore throat. There were no cold sores. He did not have any skin rash or skin ulcers. There were no sore throat or lymphadenopathy. He was clinically examined during 3 of his attacks when he was found to be withdrawn, apparently suffering continuous pain by his expression. His clinical examination showed a well-built child with hyper stretchable skin, fish mouth scars, and hypermobile joints. There was no iridodonesis, and his vision was normal (6/6 both eyes), there was no other suggestion of Marfan's syndrome on various measurements of the body. Mild diffuse tenderness was found all over the abdomen with normal bowel sounds. There was no organomegaly, and the pain was poorly localized. There were no cardiac murmur, respiratory abnormality, focal neurological abnormality, and the rest of the clinical examination was essentially normal. He recovered automatically after 3-4 days of the ordeal. He had history neither of any serious illness nor of food or drug allergy. Elder brother (14 years of age) and parents had no such illness, but the mother has lax joints and skin. There were no pets in the house and no family history of a similar disease in the extended family. His complete blood count showed neutrophilic leukocytosis (TLC 14-15000/ul with 76 percent polymorphs and no eosinophils during the acute stage) with normal hemoglobin and platelet counts. There were no abnormalities in the morphology of any of the cells seen. His biochemical investigations which involved the liver, renal function tests, electrolytes also showed no abnormality. Blood and urine culture and routine urine examination were unremarkable. Urine for porphobilinogen showed a mild increase (Figure 1) however the quantitation of PBG (porphobilinogen) on 24-hour urine during acute stage was normal so also the blood lead levels (<10ugm/L). Serum amylase, lipase, and lipid profile were normal. CRP levels were raised during the acute stage (170mg/L) and was quickly normalized(3mg/L) within 72 hours of resolution of abdominal pain. Upper GI endoscopy and fundoscopy (eye) showed no abnormality. Serum immunoglobulins including IgD levels were normal. Ultrasound examination of abdomen and pelvis, CT scan with contrast and MRI scan of chest and abdomen was essentially normal. Because of the paroxysmal nature of the attack, a provisional diagnosis of acute intermittent porphyria or one of the autoinflammatory syndromes was made. Targeted sequencing of exome involving porphyrin metabolism, autoinflammatory conditions, and immunologically important 280 genes was executed following transposase digestion of isolated DNA from the peripheral blood mononuclear cells of the patient on Illumina 2500 Hi seq platform. Except for nine genes (CD55, CFHR1, CORO1A, ITCH1, MAGT1, TNFRS11A, TBX1, FCGR1A, NCF1, 85-98 % coverage), all genes were covered to the tune of 100 % of the exomes including intron-exon boundaries. Except for common polymorphisms, none of the genes showed any harmful sequence changes or known mutations. However, there was a heterozygous mutation of NLRP12 gene in exon 3 (c 779C>T, p Thr 260> Meth) in the evolutionarily conserved nucleotide sequence on NACHT1 domain of the molecule. This sequence change has not been described previously and was found to be harmful by using Polyphen 2 Sift, Mutation tester-2 software. This sequence change was confirmed using Sanger sequencing but was not found in any of the parents or his elder brothers DNA sequences. Hence it presented a de novo change. So a final diagnosis of NLRP12 associated autoinflammatory syndrome was made. The patient did not respond to colchicine, and by trial and error with various combinations of anti-inflammatory medicines, Naproxen gave a partial response with a combination of a short course of corticosteroids (Prednisolone, 15 mg/day, administered when paroxysms started once in the morning after breakfast and was continued for seven days.

autoinflammatory syndrome, hypermobility, new mutation, porphyria, stretchable skin

PMC5519473_01

Female

A 73-year-old Japanese woman complained of a fever >=38C and exertional dyspnea at her regular clinic visit in the middle of July 2014. In May 2014, she had started fifth-line systemic chemotherapy of weekly irinotecan monotherapy (60 mg/m2, Days 1, 8 and 15, every 4 weeks) for her metastatic thymic carcinoma (squamous cell carcinoma type). These symptoms appeared on the 23rd day of the second cycle in the middle of July 2014. We found these symptoms on the 29th day of the second cycle. Chest X-ray suggested light ground-glass shadow, especially in the right upper lung field. Computed tomography (CT) showed diffuse ground-glass shadow spreading in all of the lung fields, in addition to shrinkage of the lung metastases (Fig. 1). The differential diagnoses based on her clinical course and these chest image findings included congestive heart failure, drug-induced pneumonia and pneumocystis pneumonia. We discontinued the chemotherapy and recommended her immediate hospitalization. However, she declined immediate admission at that time. During the four days she waited until ultimately allowing admission, her symptoms, respiratory conditions and abnormal shadow on chest X-ray did not change remarkably. Since April 2007, she had undergone thymectomy, left upper lung partial resection, left lower lobe resection, stereotactic radiation therapy to the right lung metastases and systemic chemotherapies, including the administration of carboplatin plus paclitaxel twice, cisplatin plus etoposide and gemcitabine. Except for febrile neutropenia, she did not experience severe toxicities during her previous treatment. Her medical, family and social histories were unremarkable. Her current medication included loxoprofen sodium, rebamipide and pregabalin. These medications had been administered for years. Except for anti-tumor drugs, she had not started any new regular drugs for more than three years. She was not using any anticoagulants or antiplatelet agents. Her vital signs on admission were as follows: heart rate 68 beats/min with a regular rhythm, SpO2 95% (on room air) and blood pressure 124/60 mmHg. A physical examination revealed neither murmur in her heart sound nor rale in her breath sounds. Her blood cell counts were as follows: hemoglobin 9.6 g/dL, hematocrit 28.6%, white blood cells 6,300/mm3 (neutrophils 50.7%, lymphocyte 30.6%, eosinophils 2.2%), platelets 288,000/mm3. Her C-reactive protein and lactate dehydrogenase were slightly elevated to 1.91 mg/dL and 311 U/L, respectively. Pneumocystis pneumonia and anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis were unlikely because beta-D-glucan, proteinase-3 and myeloperoxidase ANCA were undetectable. Congestive heart failure was also doubtful because her brain natriuretic peptide levels were slightly elevated to 46.7 pg/mL (<18.4 pg/mL). Coagulation was also within the normal range. Her uridine diphosphate glucoronosyltransferase (UGT1A1)*28 and *6 gene polymorphisms were wild-type. We performed bronchoscopy on the 33rd day of the second course, in late July 2014. This examination did not find any apparent bleeding in the airway, trachea and bronchus. Bronchoalveolar lavage fluid (BALF) recovered from B4 in the right middle lobe, with a recovery rate of 40% (60 mL/150 mL of saline), gradually became bloody (Fig. 2). The routine microbiology culture of BALF did not detect bacterial or fungal infection. The cell count analysis (total cell count 5.1x105 cells/mL) of BALF indicated the following: alveolar macrophages 58%, neutrophils 3%, lymphocytes 38% and eosinophils 1%. BALF contained macrophages with positive staining of iron (Berlin blue) but no atypical cells suspected of malignancy (Fig. 3). We also performed a transbronchial lung biopsy (TBLB) from the right B2, B8 and B9. Although a small number of lymphocytes were scattered in the alveolar interstitium and immunochemical staining for Pneumonositis jirovecii was negative, we could not detect hemosiderin-laden macrophages in the TBLB specimens. Based on these bronchoscopic findings, we diagnosed the patient with drug-induced DAH and discontinued irinotecan and started oral prednisolone (0.5 mg/kg/day). Prednisolone was gradually tapered and discontinued two months later. CT in late August 2014 showed disappearance of the ground-glass shadows (Fig. 1). We did not try a challenge re-administration of irinotecan. Thereafter, she received docetaxel in September 2014 and S-1 in November 2015 but did not suffer from alveolar hemorrhage from these drugs. She died due to a worsening of thymic carcinoma in March 2016 at another hospital.

bronchoalveolar lavage, diffuse alveolar hemorrhage, drug-induced, irinotecan, steroid, thymic carcinoma

PMC5771930_01

Male

In September 2016, a 60-year-old male Austrian patient presented at the Department of Internal Medicine, Medical University of Graz, Graz, Austria, with a three-week history of fever of unknown origin, fatigue, and unintentional weight loss of 6 kg. Initial physical examination was inconspicuous. Concomitant diseases were adequately treated diabetes mellitus type 2 and hypothyroidism. Travel history revealed a two-week trip to the south of Crete in September 2015 and a two-week trip the south of Spain in May 2016. Laboratory parameters showed elevated C-reactive protein (CRP) ranging between 94.2 and 188.9 mg/L (normal range 0-5 mg/L), slight hypochromic, normocytic anemia without signs of hemolysis (hemoglobin 12.5 g/dL), mild thrombopenia (127,000/muL; normal range 140,000-440,000/muL) and a discreetly elevated gamma-glutamyltransferase (GGT) but were otherwise inconspicuous. The soluble interleukin 2-receptor (IL-2R) was elevated (5156.1 pg/mL, reference range 458.0-1997.0). Chest X-ray, urine analysis, abdominal sonography, transthoracic as well as transoesophageal echocardiography showed no focus of infection but revealed splenomegaly (7.2 x 16.4 cm). Serial blood cultures were negative, as were tests for influenza (negative PCR), other viral infections (negative IgM antibody test for Puumala, Dobrava, and Hantaan virus, negative PCR for cytomegalovirus and Epstein-Barr virus), leptospirosis (negative antibody test), malaria (negative blood smear), tuberculosis (negative interferon-gamma release assay), and human immunodeficiency virus (HIV) (negative antibody). Empiric antibiotic therapy with initially ampicillin/sulbactam and later piperacillin/tazobactam plus vancomycin did not lead to improvement. Interestingly, in the course of the following 3 weeks, discrete bicytopenia turned into severe pancytopenia requiring blood transfusions. Lactate dehydrogenase (LDH), initially normal, increased to 1107 U/L (reference range 120-240). Liver enzymes including GGT, alkaline phosphatase (AP), aspartate transaminase (AST) also increased. Fever persisted with levels up to 40 C. Positron emission tomography-computed tomography (see Fig. 1A and B) showed tracer enhancement in the central and peripheral bone marrow. Bone marrow biopsy revealed microorganisms within macrophages (Fig. 2). PCR from peripheral blood and bone marrow confirmed infection with Leishmania donovani. Therapy with liposomal amphotericin B was initiated, causing rapid cessation of fever and a significant drop in CRP levels within days. Blood count ameliorated rapidly, and transfusions were no longer required. After release from hospital, regular follow-up visits at the outpatient clinic ensued. Until today, VL has not recurred.

leishmania, pancytopenia, splenomegaly, visceral leishmaniasis

PMC6812348_01

Male

A previously healthy 57-year-old gentleman presented with a 3-month history of progressive rhinosinusitis including nasal obstruction with bloody discharge, anosmia, and ageusia. He developed night sweats, a 25-pound weight loss, and a productive cough with blood streaked sputum (producing 5-15 mL of blood per day). There was no associated shortness of breath, chest pain, wheezing, rash, ocular, gastrointestinal, urinary, or neurologic symptoms. Social history revealed a 30 pack-year smoking history and previous exposure to aluminum dust and chemical sealants while working at a sheet metal company. There were no risk factors for tuberculosis infection. Initial antibiotic treatment for pneumonia and sinusitis was prescribed, with no subsequent clinical improvement. Urgent referral to respiratory medicine was requested. On physical examination in the respiratory clinic, the patient's heart rate was 112 beats per minute, and there was a visible ulcer in the right nare, with bloody crusting. The remainder of the physical exam was unremarkable. Laboratory investigations revealed a reduced hemoglobin of 122 g/L, elevated white blood cell count of 19.1 x 109 L-1, and platelet count of 624 x 109 L-1. Electrolytes, creatinine, and liver enzymes were normal. There was a positive c-Antineutrophil Cytoplasmic Antibody test (c-ANCA) with an elevated anti-PR3 antibody titre (253 CU). The anti-MPO and anti-GBM antibodies were negative. Urinalysis revealed no blood or casts, but was positive for protein (1+). Fig. 1 presents a computed tomography (CT) scan of the chest at the time of initial presentation which showed multiple bilateral mass-like lesions measuring up to 5cm, some demonstrating central necrosis and cavitation with thick and irregular walls. Some of the lesions were pleural-based with suggestion of chest wall extension and there was no pleural effusion. An urgent bronchoscopy was arranged and showed friable and bloody mucosa in the upper lobes bilaterally (Fig. 2a and b). Endobronchial biopsies were taken in the upper lobe airways and sequential washings did not reveal evidence of pulmonary hemorrhage (successively bloody returns from saline bronchoalveolar lavages). Biopsies demonstrated large areas of neutrophilic necrosis (so called "basophilic necrosis"), granulomatous inflammation with multi-nucleated giant cells, mucosal ulceration, and squamous metaplasia (Fig. 3). There was no necrotizing vasculitis in the sample. Staining and cultures were negative for acid fast bacilli and fungus. Given the constellation of endobronchial tissue with neutrophilic necrosis and granulomatous inflammation, positive c-ANCA, and clinical presentation with sino-pulmonary symptoms, the diagnosis of granulomatosis with polyangiitis (GPA) was made. Glucocorticoid treatment with prednisone 60 mg daily was promptly initiated, and after consultation with rheumatology, oral methotrexate was added. Twenty days later, the patient returned for follow-up after an episode of sudden onset shortness of breath with right scapular chest pain that radiated anteriorly. An urgent chest radiograph revealed a large right sided loculated pneumothorax with small fluid component (Fig. 4). A chest tube was inserted immediately, and pleural fluid studies revealed pH of 6.9, glucose level <0.1 mmol/L, and predominant fluid neutrophils of 89%. Pleural fluid cultures were negative for bacterial growth. A chest CT was performed, demonstrating enlargement of two pre-existing pulmonary cavities with air fluid levels, open communication with an adjacent bronchus, and hydropneumothorax (Fig. 5). The remaining pulmonary lesions demonstrated improvement when compared with previous imaging (Fig. 5). The pneumothorax and empyema resolved over time with pleural drainage and broad-spectrum intravenous antibiotic treatment.

empyema, granulomatosis with polyangiitis, pneumothorax

Pneumothorax with small pleural effusion from a chest radiograph. Posteroanterior chest radiograph demonstrates a large right pneumothorax with small pleural effusion. There are parenchymal abnormalities in the right upper lobe and left perihilar lesion corresponding to residual lesions seen in previous CT.

PMC6812348_01

Male

A previously healthy 57-year-old gentleman presented with a 3-month history of progressive rhinosinusitis including nasal obstruction with bloody discharge, anosmia, and ageusia. He developed night sweats, a 25-pound weight loss, and a productive cough with blood streaked sputum (producing 5-15 mL of blood per day). There was no associated shortness of breath, chest pain, wheezing, rash, ocular, gastrointestinal, urinary, or neurologic symptoms. Social history revealed a 30 pack-year smoking history and previous exposure to aluminum dust and chemical sealants while working at a sheet metal company. There were no risk factors for tuberculosis infection. Initial antibiotic treatment for pneumonia and sinusitis was prescribed, with no subsequent clinical improvement. Urgent referral to respiratory medicine was requested. On physical examination in the respiratory clinic, the patient's heart rate was 112 beats per minute, and there was a visible ulcer in the right nare, with bloody crusting. The remainder of the physical exam was unremarkable. Laboratory investigations revealed a reduced hemoglobin of 122 g/L, elevated white blood cell count of 19.1 x 109 L-1, and platelet count of 624 x 109 L-1. Electrolytes, creatinine, and liver enzymes were normal. There was a positive c-Antineutrophil Cytoplasmic Antibody test (c-ANCA) with an elevated anti-PR3 antibody titre (253 CU). The anti-MPO and anti-GBM antibodies were negative. Urinalysis revealed no blood or casts, but was positive for protein (1+). Fig. 1 presents a computed tomography (CT) scan of the chest at the time of initial presentation which showed multiple bilateral mass-like lesions measuring up to 5cm, some demonstrating central necrosis and cavitation with thick and irregular walls. Some of the lesions were pleural-based with suggestion of chest wall extension and there was no pleural effusion. An urgent bronchoscopy was arranged and showed friable and bloody mucosa in the upper lobes bilaterally (Fig. 2a and b). Endobronchial biopsies were taken in the upper lobe airways and sequential washings did not reveal evidence of pulmonary hemorrhage (successively bloody returns from saline bronchoalveolar lavages). Biopsies demonstrated large areas of neutrophilic necrosis (so called "basophilic necrosis"), granulomatous inflammation with multi-nucleated giant cells, mucosal ulceration, and squamous metaplasia (Fig. 3). There was no necrotizing vasculitis in the sample. Staining and cultures were negative for acid fast bacilli and fungus. Given the constellation of endobronchial tissue with neutrophilic necrosis and granulomatous inflammation, positive c-ANCA, and clinical presentation with sino-pulmonary symptoms, the diagnosis of granulomatosis with polyangiitis (GPA) was made. Glucocorticoid treatment with prednisone 60 mg daily was promptly initiated, and after consultation with rheumatology, oral methotrexate was added. Twenty days later, the patient returned for follow-up after an episode of sudden onset shortness of breath with right scapular chest pain that radiated anteriorly. An urgent chest radiograph revealed a large right sided loculated pneumothorax with small fluid component (Fig. 4). A chest tube was inserted immediately, and pleural fluid studies revealed pH of 6.9, glucose level <0.1 mmol/L, and predominant fluid neutrophils of 89%. Pleural fluid cultures were negative for bacterial growth. A chest CT was performed, demonstrating enlargement of two pre-existing pulmonary cavities with air fluid levels, open communication with an adjacent bronchus, and hydropneumothorax (Fig. 5). The remaining pulmonary lesions demonstrated improvement when compared with previous imaging (Fig. 5). The pneumothorax and empyema resolved over time with pleural drainage and broad-spectrum intravenous antibiotic treatment.

empyema, granulomatosis with polyangiitis, pneumothorax

Large cavity lung lesions and right pneumothorax. A, Axial CT scan demonstrates the large cavitary lesion in the right lung with direct communication with a segmental right upper lobe bronchus (arrow).

PMC7586010_01

Unknown

A 62 years old patient arrived at the Centre for Diabetes, Nutrition and Metabolic Diseases presenting with fatigability, headache, dizziness, dyspnea during moderate effort, palpitations, nausea, bloating and epigastric pain and in the right hypochondrium. We mention that no other neurological signs have been described. Given the symptoms, it was decided to admit the patient in the Diabetes, Nutrition and Metabolic Diseases Clinic for further investigations and establishing the correct course of treatment. The patient included in the study signed the informed consent for the acquisition, analysis, and publishing of the anonymized data collected. Since no personal identification data were used in this manuscript, the ethics committee approval is not needed. It needs to be mentioned that the patient had been diagnosed with Type 2 Diabetes Mellitus in 2015 and was undergoing treatment with metformin 1 g twice a day and sitagliptin 100 mg once a day. Metformin treatment had been initiated at the time of diagnosis (2015), and sitagliptin had been added to the therapeutic plan in 2018. The patient had been presenting for evaluation visits every three months since being diagnosed with Type 2 Diabetes Mellitus. Also, the patient was receiving treatment with beta-blocker (Bisoprolol 5 mg/day), ACE inhibitor (Perindopril 10 mg/day) as well as a thiazide diuretic (Indapamide 1.5 mg/day). The patients' history did not reveal alcohol abuse or smoking, the physical exam revealed obesity grade II (BMI=37 kg/m2) and an abdominal circumference (AC) of 116 cm, skin paleness and slight dehydration, rhythmic heartbeat, blood pressure of 105/70 mmHg, a pulse of 92 b/min, no pathological heart murmurs and a glycaemia equal to 220 mg/dl. Blood tests revealed an unsatisfactory glycemic control, quantified by an HbA1c of 9.8% as well as a low HDLc level of 29 mg/dl, while renal function and hepatic function were normal. The blood panel presented severe modifications prompting more detailed investigations in order to determine the cause of the anemia: Hb= 8.7 g/dl, Ht= 29%, H= 2.3 x106/microL, L= 5.9x103/microL, T= 191 x103/microL, MEV= 119.6 fl, MEH= 39 pg, MECH= 34 g/dl. Iron levels were normal 77 microg/dl (normal values being between 50 and 170 micro/dl). According to WHO, anemia is defined by a Hb level under 13 g/dl in men and under 12 g/dl in women. If the mean volume of erythrocytes is greater than 100 fl, one could consider macrocytic anemia, the most common form encountered being megaloblastic anemia. Given the hematologic panel, a peripheral blood smear was performed, and it identified anisocytosis with hypochromic erythrocytes, macrocytes, codocytes, isolated thrombocytes as well as thrombocytes in small or medium groups. Considering the poor glycemic control, as well as high glycemic values and clinical symptoms, treatment with oral antidiabetics drugs was stopped, and insulin therapy was initiated in a basal-bolus regimen, with dosages adjusted according to glycemic values. Consecutive to treatment modification, it was noticed that the patients' symptoms had significantly improved, dyspnea and gastric discomfort were disappeared. An EKG, chest X-ray, abdominal echography and gastroscopy were performed. These investigations did not reveal any notable pathological changes, significant to other conditions. Vitamin B12 and folate were measured. Results showed that the concentration of B12 was very low: 113 pmol/l (normal values are between 191 and 663 pmol/l for the European population) and serum concentration of folate was in normal range: 18.6 ng/mL (normal values are between 4.6 and 34.8 ng/mL). Substitution treatment with vitamin B12 was initiated in the form of intramuscular injection, initially with 1000 microg/week, over the first 2 months, consecutively the dosage being reduced to 1000 microg every 2 weeks. For obtaining a good glycemic control, the administration of a long-acting insulin analogue (Glargine) once daily (at bedtime) in association with sitagliptin 100 mg/day (in the morning) was the preferred option. After 3 months the patient was re-admitted in the Diabetes Clinic for re-evaluation: Table 1 presents the main biological parameters investigated at the time of diagnosis as well as 3 months after substitution treatment. Glycemic control was significantly improved, having a decrease of HbA1c of 1.6 pp (from 9.8% to 8.2%) (Table 2).

megaloblastic anemia, metformin, vitamin b12 deficiency

PMC7251582_01

Male

A 49-year-old male had end-stage renal disease and secondary to diabetic nephropathy, and was undergoing maintenance HD. His general condition was stable. He was admitted to the hospital on January 31, 2020, with complaints of intermittent cough. However, he had no fever, chills, myalgia, or anorexia before admission. He had undergone chest computed tomography (CT) scan because of a history of contact with a COVID-19 patient (his mother) 5A days earlier. His CT scan showed a small cotton-wool spot in the right lobe of the right lung and he was suspected to have ACOVID-19 (Fig.A 1a). The reverse transcription polymerase chain reaction (RT-PCR) of the patienta$ s pharyngeal swab was positive for the COVID-19 nucleic acid 2 days after hospitalization. The patient was treated with lopinavir plus ritonavir combined with interferon alfa-2b inhalation as antiviral therapy, and continued on HD (see below). However, 5 days after admission, he began to develop fever and his condition worsened rapidly. A repeat chest CT showed scattered ground-glass opacities in both lungs 8 days after admission (Fig.A 1b). He was transferred to the intensive care unit and required endotracheal intubation and mechanical ventilation. At 14 days after admission, chest radiography showed several reticular shadows in both lung fields (Fig.A 1c). Unfortunately, after 15A days of admission, the patient developed multiple organ dysfunction syndrome and died. Precautionary measures were applied in our HD center during the COVID-19 outbreak in late December 2019, a month before this patient was confirmed to have COVID-19. These included enhanced environmental cleaning, exclusion of visitors, and monitoring of hand hygiene. All patients undergoing HD had their body temperatures monitored and were asked to put on masks; patients with fever had to undergo chest CT and blood cell analysis. This allowed shifting of suspected patients into an isolated dialysis unit in isolated wards. Since an outbreak of the COVID-19 developed in Hubei, China, especially after presence of the first COVID-19 positive patient in our HD unit, some maintenance HD outpatients worried about becoming infected and prolonged their HD interval. The dialysis unit staff followed the recommendations of the WHO for infection control including the use of waterproof disposable gowns, gloves, caps, goggles, and N95 masks. Once the diagnosis of COVID-19 was confirmed, the patient was kept in the COVID-19 isolation ward along with other non-dialysis COVID-19 patients; the dialysis machine was kept in the COVID-19 isolation ward between dialysis sessions and was used only for COVID-19 patients requiring HD. All staff involved in the direct care of patients affected by COVID-19 had to undertake full protection (see above) and strictly implemented hand hygiene. We performed continuous venovenous hemodiafiltration using the Fresenius multiFiltrate dialysis machine (Fresenius Medical Care, Bad Homburg, Germany). A commercial carbonate replacement fluid (QingShanLiKang, Chengdu, China) was used and Fresenius AV600S dialyzer (Fresenius Medical Care) was employed without reuse. After each HD session, the dialyzer, all blood tubing, and the spent dialysate were discarded as infectious waste and the dialysis machine was disinfected with sodium hypochlorite solution according to the manufacturera$ s instructions.

coronavirus disease 19, end-stage renal disease, hemodialysis, severe acute respiratory syndrome-cov-2

Radiographic images of the patient. a; An axial CT of the thorax on admission showing a small cotton-wool spot in the right lobe of the right lung.

PMC7251582_01

Male

A 49-year-old male had end-stage renal disease and secondary to diabetic nephropathy, and was undergoing maintenance HD. His general condition was stable. He was admitted to the hospital on January 31, 2020, with complaints of intermittent cough. However, he had no fever, chills, myalgia, or anorexia before admission. He had undergone chest computed tomography (CT) scan because of a history of contact with a COVID-19 patient (his mother) 5A days earlier. His CT scan showed a small cotton-wool spot in the right lobe of the right lung and he was suspected to have ACOVID-19 (Fig.A 1a). The reverse transcription polymerase chain reaction (RT-PCR) of the patienta$ s pharyngeal swab was positive for the COVID-19 nucleic acid 2 days after hospitalization. The patient was treated with lopinavir plus ritonavir combined with interferon alfa-2b inhalation as antiviral therapy, and continued on HD (see below). However, 5 days after admission, he began to develop fever and his condition worsened rapidly. A repeat chest CT showed scattered ground-glass opacities in both lungs 8 days after admission (Fig.A 1b). He was transferred to the intensive care unit and required endotracheal intubation and mechanical ventilation. At 14 days after admission, chest radiography showed several reticular shadows in both lung fields (Fig.A 1c). Unfortunately, after 15A days of admission, the patient developed multiple organ dysfunction syndrome and died. Precautionary measures were applied in our HD center during the COVID-19 outbreak in late December 2019, a month before this patient was confirmed to have COVID-19. These included enhanced environmental cleaning, exclusion of visitors, and monitoring of hand hygiene. All patients undergoing HD had their body temperatures monitored and were asked to put on masks; patients with fever had to undergo chest CT and blood cell analysis. This allowed shifting of suspected patients into an isolated dialysis unit in isolated wards. Since an outbreak of the COVID-19 developed in Hubei, China, especially after presence of the first COVID-19 positive patient in our HD unit, some maintenance HD outpatients worried about becoming infected and prolonged their HD interval. The dialysis unit staff followed the recommendations of the WHO for infection control including the use of waterproof disposable gowns, gloves, caps, goggles, and N95 masks. Once the diagnosis of COVID-19 was confirmed, the patient was kept in the COVID-19 isolation ward along with other non-dialysis COVID-19 patients; the dialysis machine was kept in the COVID-19 isolation ward between dialysis sessions and was used only for COVID-19 patients requiring HD. All staff involved in the direct care of patients affected by COVID-19 had to undertake full protection (see above) and strictly implemented hand hygiene. We performed continuous venovenous hemodiafiltration using the Fresenius multiFiltrate dialysis machine (Fresenius Medical Care, Bad Homburg, Germany). A commercial carbonate replacement fluid (QingShanLiKang, Chengdu, China) was used and Fresenius AV600S dialyzer (Fresenius Medical Care) was employed without reuse. After each HD session, the dialyzer, all blood tubing, and the spent dialysate were discarded as infectious waste and the dialysis machine was disinfected with sodium hypochlorite solution according to the manufacturera$ s instructions.

coronavirus disease 19, end-stage renal disease, hemodialysis, severe acute respiratory syndrome-cov-2

Radiographic images of the patient. b; An axial CT of the thorax recorded 8 days after admission showing diffuse large regions of ground-glass opacification with partial consolidation in the lower lobe of both lungs.

PMC5546083_02

Female

A 66-year-old Afro-Caribbean woman presented to the Emergency Department with complaints of weakness, fever, fatigue, myalgia, hypotension x 2 weeks, and increased urinary frequency. The patient has a past medical history of hypertension, hypothyroidism, hearing loss, tinnitus, and "benign pulmonary nodules." Two weeks prior to presentation, the patient began experiencing daily fevers of 102 degrees Fahrenheit (38.9 degrees Celsius), severe body aches, nonproductive cough with pleuritic chest pain, and low blood pressure (90-100 mmHg systolic) without ingestion of antihypertensive medications. She visited her primary care physician three days prior to presentation and was given amoxicillin for presumed upper respiratory infection; however her symptoms continued to worsen. The patient disclosed a two-year history of intermittent episodes of bronchitis and haemoptysis, which were treated with multiple courses of oral antibiotics. She had presented to our institution twice for evaluation of haemoptysis. On the first occasion, 1 year ago, she had minimal bloody expectorant and was treated for bronchitis. On her second presentation, three months ago, frank haemoptysis was present and the patient was admitted. Sputum samples were negative for acid fast bacilli and cultures were negative for tuberculosis. The patient was ultimately treated for community acquired pneumonia. Pulmonary nodules noted on radiographic imaging had been evaluated in an outpatient setting, and the patient indicated that she had been informed that these were "benign." The patient was a nonsmoker and did not consume alcohol. She worked as a patient care technician in a hospital and had a history of positive purified protein derivative skin test for tuberculosis (PPD+). She recently traveled to Haiti. In the Emergency Department, the patient was afebrile (had just taken paracetamol), with respiratory rate = 23, blood pressure 114/67, white blood cell count (WBC) 24,000/muL, 87% neutrophils, 4% lymphocytes, 7% monocytes, haemoglobin 9.1 g/dL with +anisocytosis and target cells, platelets 513,000/muL, troponin 0.11 ng/mL (normal 0.00-0.04 ng/mL), AST 399 IU/L (normal 8-26 IU/L), ALT 368 IU/L (normal 6-51 IU/L), alkaline phosphatase 131 IU/L (normal 33-92 IU/L), total bilirubin 0.4 mg/dL (normal 0.4-1.1 mg/dL), 0.1 mg/dL direct bilirubin (normal 0.1-0.2 mg/dL), and albumin 2.5 g/dL (normal 3.6-4.6 g/dL). Physical exam was notable for decreased breath sounds over the right lower lobe and minimal lower extremity oedema bilaterally. There were no rashes, swollen joints, digital ulcers, or loss of digit pulp. Initial workup was significant for a urinary tract infection. Despite appropriate antibiotic therapy the patient continued to be intermittently febrile accompanied by increasing leukocytosis, with neutrophil counts ranging from 80 to 86%. Repeat urine culture was negative. No source of infection was found despite extensive investigation. Multiple blood cultures were negative. CT chest demonstrated chronic scarring and architectural distortion of the right upper lobe, thought to be due to prior granulomatous disease, which was unchanged from a prior CT. A left lung nodule was noted, unchanged from the patient's previous CT on 10/2015. Sputum samples were negative for acid fast bacilli by fluorochrome methodology. Further diagnostic studies were initiated due to the persistence of fever. Echocardiogram was negative for valvular vegetation. CT scan of the abdomen and pelvis was negative for occult abscess or osteomyelitis. MRI of the abdomen and pelvis was negative for infectious processes and pelvic ultrasound did not reveal gynecologic pathology. A peripheral blood smear examined by a haematology/oncology consultant was interpreted as reactive, without signs of neoplasia, and therefore there was no indication for bone marrow biopsy. WBC count continued to increase from the admission level of 24,000/muL to a peak of 47,000/muL. Haemoglobin and haematocrit values gradually declined from admission values of 9.1 g/dL and 29.9% to 6.6 g/dL and 20% (Figure 1); schistocytes and target cells were identified on peripheral smear. Coombs test was negative for direct and indirect antibodies. LDH rose from 251 IU/L to 409 IU/L (normal 84-193 IU/L) and haptoglobin was <3 (normal 34-200 mg/dL), consistent with microangiopathic haemolytic anemia (MAHA). Other relevant laboratory findings included serum iron 14 mcg/dL (normal 64-196 mg/dL), transferrin 105 mg/dL (normal 192-321 mg/dL), TIBC 147 mcg/dL (normal 279-449 mcg/dL), ferritin 452 ng/mL (normal 4.8-94.4 ng/mL), and reticulocyte count 5.6%, with absolute reticulocytes 0.160, and corrected reticulocyte count 2.9%. Liver enzymes and cardiac troponin levels decreased to normal. Serological testing was negative for acute or chronic viral hepatitis, Epstein Barr virus, or cytomegalovirus infections. Creatinine gradually increased from baseline 0.9 mg/dL (normal 0.5-1.2 mg/dL) to peak of 3.4 mg/dL. Urine microscopy revealed 5-10 red cell casts/LPF and 2-5 coarse granular casts/LPF. Urine protein : creatinine ratio was 1.8-gram protein/gram creatinine (normal <0.16 g/g creatinine) and increased to 2.4-gram protein/gram creatinine. Markers of inflammation revealed ESR 67 mm/hr (normal 0-42 mm/hr) and CRP 17.5 mg/dL (normal 0.02-1.20 mg/dL). Inflammatory markers were only measured once during the patient's hospital course. ANA was weakly positive 1 : 80 (homogenous) and p-ANCA was positive, 1 : 160, with MPO 115.2 units (normal <= 20.0 units). Pertinent negative laboratory values included c-ANCA negative, PR3 negative, C3 113 mg/dL (normal 75-161 mg/dL), C4 22 mg/dL (normal 14-45 mg/dL), Rheumatoid Factor negative, antiglomerular basement membrane antibody negative (<0.02), and urine eosinophil smear negative. Renal biopsy demonstrated pauci-immune necrotizing glomerulonephritis with crescents and vascular and interstitial necrosis. There was full thickness fibrinoid necrosis of the vessels with surrounding interstitial necrosis. There was 30% interstitial fibrosis associated with tubular atrophy and dense lymphocytic inflammatory infiltrate. Fibrinogen staining showed crescents and necrosis of an artery (Figures 2-4). The patient was treated with methylprednisolone 1000 mg IV x 5 days. Rituximab 375 mg/m2 was started while being inpatient and was continued weekly for a total of 4 weeks. The patient had been manifesting frequent fevers within the range of 100.4-102.7 degrees Fahrenheit (38.0-39.3 degrees Celsius). The day following solumedrol infusion fevers ceased and patient's body temperature thereafter remained in the normal range. WBC count initially rose from 35,000/muL with 87% neutrophils to 47,000/muL with 82% neutrophils after methylprednisolone administration for two days and after the first dose of rituximab was administered. The following day WBC count declined to 31,500/muL with 83% neutrophils and continued to decline gradually. One week after beginning methylprednisolone and rituximab therapy WBC count was 25,700/muL with 81% neutrophils and declined to 20,100/muL with 86% neutrophils following the second dose of methylprednisolone. Creatinine slowly declined and haemoglobin and haematocrit levels slowly rose. Urine protein : creatinine ratio declined to 1.6-gram protein/gram creatinine. Corticosteroids were gradually tapered. The patient tolerated the treatment well and clinical symptomatology resolved. Lab values, 5 months after hospitalization, revealed WBC 8.2k/muL, haemoglobin 12.8 g/dL, haematocrit 39.2%, platelets 210k/UL, BUN 22 mg/dL and creatinine 1.4 mg/dL, AST 23 IU/L, and ALT 16 IU/L (Figure 1). Over a 2-year period, the patient experienced limited lung disease and developed hearing loss and tinnitus. She then abruptly developed a sepsis-like condition, which rapidly progressed to include persistent fever, increasing leukocytosis, MAHA, and acute necrotizing pauci-immune glomerulonephritis. The lack of response to antibiotic therapy prompted a search for occult infection or malignancy. Despite multiple blood and sputum cultures, extensive imaging studies (including a CT of the chest, abdomen, and pelvis, an MRI of the abdomen and pelvis, and a pelvic ultrasound), and peripheral blood smear evaluation by an oncologist, no source of abscess, infection, or neoplasm could be found to explain the patient's fevers and leukocytosis. The increase in creatinine and onset of proteinuria with active urinary sediment led to renal biopsy, the histology of which supported the diagnosis of GPA in the setting of the past history of haemoptysis, hearing loss, tinnitus, and positive serological markers for p-ANCA and MPO. GPA is an uncommon autoimmune disease most prevalent in Caucasian patients with disease onset usually between 45 and 65 y. Notably, the prevalence of GPA is very low in non-Caucasians, and this patient is Afro-Caribbean. In a survey of 701 patients in North America, only 2% of patients diagnosed with GPA were not Caucasian. The diagnosis of GPA can be challenging, as the entity commonly presents with nonspecific symptoms such as fatigue, joint pains, and sinusitis. Organ systems involved at the time of diagnosis are the upper and lower airways, ears, lung, joints, and kidneys. Most patients are diagnosed within 3-12 months from the onset of symptomatology, and on average two organ systems are involved at time of diagnosis. Our patient had a two-year indolent phase with minor exacerbations prior to her acute presentation. Isolated organ system involvement, such as isolated lung nodules, is rare in GPA. The French Vasculitis Study Group identified 16 patients with isolated GPA occurring for as long as 58 months without progression to systemic disease. However, such patients may progress if followed long enough. One case report described a patient with limited tracheobronchial disease which then suddenly flared twenty years after the initial presentation. Unexplained fever and increasing leukocytosis were significant features of our patient's presentation and course. In one retrospective survey, fever was described as the first symptom in 33% of patients. Fever suggestive of an infectious aetiology is not uncommon in GPA. Several case reports describe fever and pulmonary symptoms with abnormal chest imaging studies (often initially interpreted to be pneumonia), as in our patient's diagnosis from her prior admission. Tuberculosis was suspected in our patient on both hospitalizations due to exposure risks in Haiti and in her role as a healthcare worker, along with the presence of a positive tuberculin skin test. Occasionally GPA can present with protracted fever without localizing signs, as in our patient, although this is uncommon. Pyrexia of unknown origin (PUO) is most commonly secondary to infectious disease. Fever secondary to occult collagen vascular disease is less common. In a retrospective cohort of 857 patients, 16% (137 patients) had fever due to collagen vascular disease. Only 3/137 (0.3% of the entire cohort) had fever secondary to GPA. Our patient's fever resolved completely after the first dose of methylprednisolone. Our patient's course was unusual in that her WBC count increased to 47,000. As such, there was significant concern for infectious or neoplastic source. We were unable to find an infectious source despite extensive microbiologic studies and imaging. The decision to begin treatment with high dose corticosteroids remained difficult in face of the florid leukocytosis, despite the negative sepsis workup. To our knowledge, leukocytosis at this level has not been previously described in the literature in association with GPA. The leukocytosis resolved completely after treatment with rituximab, further supporting its association with GPA. Neutrophilic leukocytosis is commonly seen in association with an acute infectious process. At times inflammatory processes or physiologic stressors can stimulate leukocytosis. For example, patients with rheumatoid arthritis, adult Still's disease, and noncystic fibrosis bronchiectasis have been found to develop leukocytosis with disease flare-ups. Trauma patients have also been observed to have sterile neutrophilia with negative blood cultures. In our patient, a possible mechanism for the observed leukocytosis could be as a response to extreme physiologic stress causing a profound inflammatory response and upregulating the immune system. Additionally, stimulation of bone marrow, such as that seen in haemolytic anemia, can rarely precipitate significant leukocytosis, possibly via overstimulation of the bone marrow in response to the anemia. The patient's haemoglobin/haematocrit had declined in comparison to levels during the previous months. Her red blood cell levels continued to decline with schistocytes and target cells identified on peripheral smear. Laboratory evidence of MAHA included elevated LDH, undetectable haptoglobin, and negative Coombs test. MAHA is a rare complication of the immune activation in GPA and has been reported occasionally. In our patient the haemolytic anemia resolved completely after treatment with rituximab, further supporting the association. Finally, c-ANCA with PR3 positive autoantibodies are diagnostic markers for GPA and are present in 70% to 90% of patients. Our patient was p-ANCA MPO+, which is unusual in GPA, although it has been reported in 5% to 10% of cases. In non-Caucasian populations, MPO+ p-ANCA may be more common. In a case series from China 60% of GPA patients were MPO+ p-ANCA. Those patients were more likely to have elevated serum creatinine at the onset of illness and less likely to have arthralgia, rash, and ophthalmic and ear involvement. Our patient did not have arthralgia, rash, or ophthalmic involvement; however she did have tinnitus and a history of decreased hearing acuity.

PMC4303756_01

Female

A 57 year old female presented with complaints of abdominal pain for 3 weeks. The pain was dull, aching, and intermittent. She reported a history of constipation, chronic hypertension diagnosed 4 years ago and no history of TB. A history of night sweat, fatigue, weight-loss, and chronic cough or any contact with a pulmonary TB patient was denied. The patient had a previous history of hemorrhoid surgery only. On clinical examination was the blood pressure 110/70 mmHg, heart rate 76/min and the body temperature 36.8C. The abdomen was soft, no distended, non-tender and no mass was palpable; but there was a presence of small amounts of ascites. There was no palpable cervical lymph node. Other systemic examinations including cardiovascular system and lungs showed normal results. Biochemically, her hemoglobin was 13.3 g/dL, total white cells were 11,940 103/microL and the C reactive protein was 4.05 mg/dL, otherwise all values were normal. Serum CA-125 levels were elevated (228.6 IU/mL) and serum CA-19-9 levels were normal (<2.0 IU/mL). The chest X-ray was normal. An abdomen CT revealed the presence of an enhancing thickening of the peritoneum, hepatic capsule, omentum and ascites and calcific lymph nodes of the lower abdominal and pelvic cavity (Fig. 1). CT findings suggested a tuberculous peritonitis, but could not rule out a tuberous peritonitis or Fitz-Hugh-Curtis syndrome. The tuberculin skin test result (Mantoux skin test) was positive and interferon-gamma release assays (QuantiFERON TB Gold, Cellestis, Victoria, Australia) were positive as well. So, a tuberculous peritonitis was suggested for this patient. Under this impression, we performed an exploratory laparoscopy for an accurate diagnosis before the TB treatment. There was no mass was observed, neither in the uterus, both ovaries, both salpinges, omentum nor in the peritoneal surface which could be considered as an intraperitoneal malignancy (Fig. 2A, B). Intraperitoneal severe adhesions and small amounts of ascites raised the suspicion of an intra-abdominal tuboovarian abscess. Also suspicious lesion of TB peritonitis was seen (Fig. 2C). Peritoneal washing and peritoneal adhesiolysis was done and a peritoneal ascites probe was sent for bacteriologic and TB evaluation. Also tissue biopsies of the adhesion sites were sent. The acid fast bacilli stain smear test in the peritoneal fluid was negative and the results of Gram stain & bacterial culture were negative as well. The adenosine deaminase in the peritoneal fluid was with 14.0 U/L (6.8-18.2 U/L). No histopathologic evidence of tuberculous granuloma was observed on microscopic examination in the peritoneal fluid. The culture and the examination for a polymerase chain reaction of the sputum did not reveal TB. There was no evidence of TB detected in the lung or pelvic cavity and the patient was subsequently not diagnosed with TB peritonitis but with latent TB therefore. The pelvic cavity biopsy confirmed the diagnosis of a serous papillary adenocarcinoma. A positron emission tomography (PET)-CT at another hospital revealed a malignancy of both ovary with lymph node metastasis and peritoneal carcinomatosis. After the diagnosis as ovarian cancer, paclitaxel and carboplatin were administered every 3 weeks for treatment.

peritoneal carcinomatosis, peritoneal tuberculosis

PMC9720556_01

Female

A 19-years-old female presented to our center with a one-month history of abdominal pain which was generalized and associated with progressive abdominal distension, pain on passing stool, and difficulty in breathing on lying flat. There was no history of cough, fever nor chest pain. She denied any abnormal vaginal discharge. Nine months ago she had a cesarean section due to obstructed labour in a peripheral hospital after which she developed peritonitis and was referred to our center. She underwent an emergency midline laparotomy whereby a gauze was found in the peritoneal cavity with multiple pus pockets and a biopsy of the omentum was obtained to rule out malignancy. This was complicated by a burst abdomen five days later for which she was operated on again followed by delayed wound healing. She was then discharged only to develop abdominal pain and distension in the current presentation. On admission, she was fully conscious and alert, mildly pale, and tachypnoeic with a respiratory rate of 26 breaths/min, an axillary temperature of 36 C, blood pressure of 98/67 mm Hg, pulse rate of 137 beats/min and was saturating at 97 % on room air. She also had bilateral, non-tender lower limb pitting edema up to the level of her knees. Her abdomen was globally distended with a healed midline and Pfannenstiel surgical scars from previous surgeries, symmetrical abdominal contours, tenderness over the umbilical and flank areas with a dull percussion note, and positive fluid-thrill. Her bowel sounds were heard normally. Her cardiovascular exam revealed a gallop rhythm with raised JVP with no hepato-jugular reflux. There were no positive findings in her respiratory examination. Ascitic fluid tapping was done under sterile conditions using a large bore cannula (16G) attached to a collecting bag and drained 5 L of milk-like fluid (chyle) (Fig. 1). Her laboratory investigations revealed a white blood cell count of 5.91 x 109/L, hemoglobin of 16.2 g/dL, and a platelet count of 437 x 109/L. Her hepatitis panel was negative for hepatitis B and C. Her aspartate transaminase of 16.09 U/L, alanine transaminase of 20.88 U/L and serum albumin of 22.1 g/L. Her serum creatinine was 75 mumol/L, BUN of 1.01 mmol/L, lactate dehydrogenase of 350.54 IU/L, and Prolactin of 317.5 mug/L. Peritoneal fluid triglyceride level was 201 mg/dL, negative gram-stain, serum-ascites-albumin-gradient of 1.2 g/dL and Gene Xpert was negative for Mycobacterium tuberculosis. Cytology of peritoneal fluid revealed an inflammatory effusion mixed with fresh RBC. Histology of the omental specimen ruled out malignancy. Ultrasound of the abdomen revealed a massive anechoic collection in the whole abdomen with an impression of ascites. CT scan of the abdomen and pelvis revealed a substantial amount of free fluid within the peritoneum, suggestive of severe ascites (Fig. 2). The echocardiogram showed a small pericardial effusion with an ejection fraction of 66 %. Throughout admission, she was kept on oral spironolactone and furosemide for the ascites as well as Ceftriaxone, Metronidazole, and Gentamicin to prevent spontaneous bacterial peritonitis. She faired well on conservative management, whereby she was discharged on oral furosemide, and spironolactone and was advised on a high-protein diet. She was reviewed weekly at the surgical outpatient unit initially and was tapped of which the frequency of ascetic tapping gradually decreased over two months from 2.5 L/week to less than 500 mL/week. She is currently on observation with no medical intervention.

ascites, chyle, management, resource-limited

PMC5907520_01

Female

A previously healthy 12-year-old female presented to the emergency department 4 days after completing a 3-day course of trimethoprim/sulfamethoxazole prescribed for a urinary tract infection. She complained of a 9-day history of fever and 3-day history of left hip pain associated with joint movement. The patient denied trauma, erythema, or swelling in the area of pain, but exposure history uncovered prolonged cat contact. Her initial exam revealed full range of motion of all extremities though she exhibited tenderness to palpation of her left hip. The remainder of the exam was unremarkable, including absence of any lymphadenopathy, bruising, erythema, or edema of the affected joint. The patient's initial workup was significant for normocytic anemia (hemoglobin of 11.9 g/dL and hematocrit of 34.5%) and normal liver function tests. She was noted to have elevated inflammatory markers:an erythrocyte sedimentation rate greater than 120 mm/h and C-reactive protein of 68.6 mg/L. Urinalysis showed small amounts of leukocyte esterase and bacteria but only 0-5 white blood cells (WBCs). Urine and blood cultures were obtained and showed no bacterial growth. An X-ray of the hip showed no acute abnormalities; however, a subsequent MRI showed a small left sacroiliac joint effusion with mild marrow edema that was concerning for infectious or inflammatory sacroiliitis (Figure 1(a)). Scattered small round lesions replaced bone marrow throughout the iliac architecture. The patient was admitted with a working diagnosis of septic arthritis and received clindamycin intravenously. Joint fluid obtained via CT-guided aspiration revealed clear fluid with 15 WBCs, 200 red blood cells, and sterile cultures. Antibiotics were discontinued given that these findings were inconsistent with pyogenic arthritis, and she was improving clinically. Concern for possible leukemia based on the abnormal bony lesions led to an oncologic evaluation, including a chest X-ray, peripheral blood smear, and measurement of lactate dehydrogenase and uric acid, all of which were within normal limits. Due to recrudesce of fever following the discontinuation of antibiotics, Epstein-Barr virus, cytomegalovirus, and B. henselae antibodies were measured. The patient's fever again declined without directed therapy, and she was discharged home with a diagnosis of transient synovitis. The patient had intermittent low-grade fevers the week following her discharge. Her B. henselae titers were suggestive of recent infection (IgG > 1 : 1024, IgM negative). Due to known hepatic involvement of B. henselae in association with disseminated Bartonella disease, imaging (abdominal ultrasound followed by CT scan; Figure 1(b)) was performed and showed multiple liver lesions thought to be consistent with disseminated B. henselae infection. Cytopathology of the biopsied sample taken from the hepatic lesions revealed scars consistent with resolving Bartonella liver lesions. While we observed inflammation, we did not observe the granulomatous inflammation that is a more classic sign of CSD. PCR of the lesions was negative for B. henselae. Further oncologic evaluations of the hepatic lesions were negative, as was a QuantiFERON-Gold test for tuberculosis. The patient had clinical resolution after a 6-week azithromycin regimen. An MRI of the patient's pelvis at the end of therapy showed near complete resolution of the abnormalities in the iliac bones, which were fully resolved in an MRI obtained one year later. Furthermore, a CT of the patient's abdomen obtained at the end of therapy revealed that the liver lesions were decreasing in size, consistent with resolving infection. The patient's inflammatory markers also were normal.

PMC5468774_02

Male

Laboratory investigation showed 17-hydroxyprogesterone 16 ng/dL, testosterone 5 ng/dL (normal for 17-year-old male is 348-1197 ng/dL), and renin 10.47 ng/mL/hr. Adrenal hormone assays were done by liquid chromatography tandem mass spectrometry at Esoterix Laboratory Services in Calabasas Hills, California, United States. Bone age of left hand was 17 years of age, consistent with his chronological age. We decreased his hydrocortisone dosage to 20 mg twice a day (equivalent 25 mg/m2/day) with the goal of 17-hydroxyprogesterone level between 100 and 1000 ng/dL and androstenedione level normal for age and sex. His electrolytes were Na+ 135 mEq/L, Cl- 100 mEq/L, CO2 27 mEq/L, and K+ 4.3 mEq/L. Hologic DEXA scan showed bone mass density below expected range for age. Femoral neck Z-score was -3.2, total hip Z-score was -3.3, and total body Z-score was -1.7 (-1.0 to -2.5 SDS). He returned to our clinic six months later and his laboratory work-up showed 17-hydroxyprogesterone 23 ng/dL, androstenedione < 10 ng/dL (normal 17-72 ng/dL for Tanner 3), renin 3.43 ng/mL/hr, IGFBP-3 2.8 mg/L (normal 2.5-4.8 mg/L), and IGF-1 252 ng/mL (normal 161-467 mg/mL, mean 290 mg/mL). We further decreased hydrocortisone dose to 20 mg in the morning and 10 mg in the evening (equivalent 18 mg/m2/day), which resulted in normal adrenal control (17-hydroxyprogesterone 426 ng/dL). Pituitary gonadal axis evaluation showed LH 9.6 mIU/mL, FSH 21 mIU/mL, testosterone 139 ng/dL, and androstenedione 35 ng/dL, suggesting primary gonadal dysgenesis. Patient has not had testicular ultrasound to evaluate for testicular adrenal rest tumor (TART). An ACTH stimulation test to confirm the CAH diagnosis was done after stopping hydrocortisone for 24 hours. Results were consistent with simple-virilizing CAH due to 21-hydroxylase deficiency (Table 1). Genetic testing for mutations in the 21-hydroxylase gene has not been obtained. Testosterone cypionate 50 mg IM every four weeks was started. This resulted in more aggressive behavior and violent outbursts prompting discontinuation of testosterone treatment.

PMC6365391_01

Male

A 73- year -old retired civil officer presented to the emergency department with bilateral thigh swellings for 8 months. The swelling initially appeared in the left mid-thigh, progressively increasing without associated redness, tenderness or discharge. Two months later he noticed a similar swelling in the right thigh. Additionally, he had a one year history of knee swelling and mild pain. He denied history of trauma, fever or any other body swelling. Systemic review was unremarkable apart from anorexia and weight loss of 7Kg.There was a remote history of animal contact but he did not consume raw milk or undercooked meat. The vital signs were normal. Local examination revealed bilateral mid-thigh swellings. The swellings were pulsatile, oval in shape 6 x 4 cm and 4 x 4cm in the left and right thigh respectively. There was no erythema, discharge or sinuses. All peripheral pulses were bilaterally palpable with no delays. Rest of the systemic examination was normal. Routine investigations including CBC, chemistry and lipid profile were normal. C-reactive protein was 54 mg/dl, erythrocyte sedimentation rate 64mm/hr. CT scan at presentation to our hospital showed fusiform aneurysms involving both SFA measuring 2 cm in the right and 1.7 cm in the left side. The aneurysm dilatation is surrounded by multiloculated collection about 4 by 3cm which was consistent with a haematoma. In addition there was evidence of right knee joint effusion. The rest of the CT scan of chest, abdomen and pelvis were reported as normal (Fig. 1). The differentials diagnosis included atherosclerosis, vasculitis, infective endocarditis, mycotic aneurysms secondary to tuberculosis, brucellosis, and syphilis. The autoimmune workup for vasculitis was all negative. Blood culture was sterile including prolonged incubation for brucella. HIV, brucella and syphilis serology were also negative. Both trans-thoracic (TTE) and transoesophageal (TEE) echocardiography were normal. He was planned for surgical correction of the aneurysm, debridement and to obtain tissue for histopathology, microbiology and molecular testing. Unfortunately, the patient rejected surgery but agreed for conservative management. Bilateral stenting of the superficial femoral arteries was undertaken and placement of a flexible, self-expanding endoluminal endoprosthesis with heparin bioactive surface was carried out with preservation of peripheral pulses. The stents consisted of an expanded polytetrafluoroethylene (ePTFE) lining with an external nitinol (titanium). Post operatively the patient remained stable however he started complaining of (L) scrotal swelling and pain. Ultrasound scrotum revealed bilateral epididymitis and two left testicular fluid collections (Fig. 2). Fluid aspirate gram stain and culture did not grow bacterial pathogen. He was discharged home on oral ciprofloxacin. 6 weeks later, he presented with worsening thigh swellings. A repeat CT angiogram showed development of a new pseudo aneurysm at the proximal segment of inferior mesenteric artery. A new enlargement of necrotic aorto-caval lymph nodes was also noted. Multiple collections were observed in the left testis (Fig. 3A and B). There was increase in the size of the multiloculated collection surrounding the femoral aneurysms of both the thighs however no leakage from the stent was identified(Fig. 4). In addition a whole body PET scan confirmed an enlarged (L) adrenal with a hypermetabolic activity. A reddish brown fluid was aspirated from the femoral perianeurysmal collection. PCR for MTB was reported as positive; fortunately, the gene for rifampicin resistance was not detected. CT Chest showed innumerable miliary nodules particularly in the upper lobes (Fig. 5B). In retrospect the lower CT chest cuts of the initial admission CT angiogram showed more extensive miliary shadows than the current one (Fig. 5A). He was started on Isoniazid 300mg, rifampicin 600mg, ethambutol 1200mg and pyrazinamide 1.5 gm once daily. Eventually cultures of sputum, right and (L) thigh drainage grew fully sensitive MTB. On follow up after 2 weeks, the patient complained of pain and further increase in the size of femoral swellings. At this point he was prescribed anti-inflammatory agent and advised to continue on his antitubercular medications and attend the infectious disease clinic. Unfortunately, approximately 6 weeks later he developed a massive gastrointestinal bleeding from which he could not be resuscitated and died.

PMC1874669_01

Female

A 55-year-old postmenopausal woman, gravida 5 para 5, menopausal for 3 years presented with irregular vaginal bleeding for the past one month associated with passage of clots. There was no pain at abdomen, foul smelling discharge, fever, loss of weight, loss of appetite, or prior postcoital bleeding. The patient was otherwise well and had no significant medical history. She had no personal or family history of gynecological or other malignancy. She was not smoking or had alcohol and substance abuse. She has never used oral contraceptives or HRT. General physical and systemic examination detected no abnormality. On per speculum examination vagina was healthy and there was some bleeding from the cervix. Uterus was anteverted, 8-10 weeks in size and bilateral fornices free. Pap smear could not be performed because of vaginal bleeding. A Pap smear performed in another clinic four months ago was normal. Transvaginal pelvic ultrasound was performed and showed an anteverted uterus with a grossly abnormal endometrial echo pattern. The endometrium was heterogenous and had an irregular surface (Figure 1). After the history and physical examination, endometrial biopsy was performed with profuse, curettings obtained. Blood loss was not excessive and the patient was discharged home the same day. Histopathology of the curettings showed epithelioid cell granulomas with Langhans giant cells (Figure 2). The patient's hepatitis and HIV status were negative. All hematological and biochemical investigations were normal. PCR was performed on the formalin-fixed paraffin-embedded tissue for diagnosis of tuberculosis. PCR was positive for Mycobacterium tuberculosis in the endometrium. Other tests for tuberculosis, namely, Mantoux was positive at 32mm and ESR was 77mm. A chest X-ray showed mild cardiomegaly but no evidence of pulmonary tuberculosis. The patient received antituberculosis treatment (4 drugs: isoniazid, rifampicin, ethambutol, and pyrazinamide) for six months and it has been learned that her bleeding ended in the fourth week of her treatment. At subsequent follow-up visits, patient is doing well and has been disease-free for 10 months.

PMC5337466_01

Female

A 56-year-old Japanese woman was referred because of severe lower-limb edema and general fatigue. She had been healthy prior to admission with no history of renal disease. One year before admission, laboratory data showed no abnormalities, with a serum creatinine level of 0.68 mg/dL, serum total protein level 7.0 g/mg, low-density lipoprotein (LDL)-cholesterol level 110 mg/dL, and no urinary protein excretion. An examination showed a body height of 152 cm, weight 60 kg (gained about 6 kg in the month after onset), blood pressure (BP) 132/84 mmHg, and heart rate 104 beats/min. Chest and abdominal X-ray showed no abnormalities. The laboratory data revealed severe proteinuria (6.8 g/day), hypoproteinemia (serum total protein 4.2 g/dL, albumin 1.8 g/dL), normal renal function [serum creatinine level 0.66 mg/dL, estimated glomerular filtration ratio (eGFR) 72.2 mL/min/1.73 m2], and dyslipidemia [LDL-cholesterol level 300 mg/dL, triglyceride (TG) level 220 mg/dL, high-density lipoprotein (HDL)-cholesterol level 56 mg/dL]. Serology was negative for anti-nuclear, anti-glomerular basement membrane, myeloperoxidase anti-neutrophil cytoplasmic (MPO-ANCA), proteinase 3-ANCA, hepatitis C antibodies, and hepatitis B antigen. Serum complement factors and IgG, IgM, IgA levels were within normal limits. Thus, she had no findings suggestive of infection such as hepatitis B and C viruses, malignancy, collagen diseases including systemic lupus erythematosus and rheumatic arthritis, or drug-induced secondary MN. She was therefore diagnosed with IMN. Despite being treated with conventional diuretics, including a loop diuretic and thiazide (on admission, furosemide 40 mg/day and trichlormethiazide 2 mg/day were administered, and the furosemide dose was increased to 80 mg/day on the 3rd day), her lower-limb edema and urinary volume remained unchanged. On the 5th day, renal biopsy was performed. Histopathology showed typical stage II MN including diffuse thickening of the basement membrane and a large number of electron-condensing substances on the subepithelium. An immunofluorescence examination showed granular IgG and C3 deposition on the capillary loops. IgG subclasses were also stained. IgG1, and IgG3 were negative in the glomeruli, but IgG2 and IgG4 were strongly positive (Fig. 1). AQP-2 immunohistochemistry was performed via the following method (polymer technique): The kidney tissues were fixed in 20% neutral buffered formalin and embedded in paraffin, and sections 2-3 mum in thickness were prepared. The details of the method have been reported previously. Briefly, the simple statin MAX-PO (MULTI) (NICHIREI BIOSCIENCES INC., Tokyo, Japan) Polymer reagent instillation was performed as follows: incubation at room temperature for 30 minutes, and then washing with TBS for 5 minutes, 3 times. The samples then underwent color development with adjusted DAB substrate solution. The reagent on the slide was washed for a few minutes with purified water and then immersed in purified water. The specimens were finally stained with Hematoxylin and Eosin staining as a contrast agent and then washed for 2 minutes, the color enhanced, and the specimens dehydrated, penetrated, and mounted. The specimens were observed using light microscopy. The primary antibody was anti-AQP-2 antibody (NB110-74682, 1:200, Novus Biologicals, Littleton, Colorado, USA). Case 2 was also stained under the same conditions. AQP-2 immunostaining in the kidney was strongly positive in the collecting duct cells (Fig. 2A). The urinary AQP-2 levels were 3.20 ng/mgCre and urine osmolality 510 mOsm/kgH2O. After the renal biopsy, tolvaptan 15 mg/day was initiated, and the furosemide dose was reduced to 40 mg/day and trichlormethiazide discontinued due to a marked increase of urine volume. Three days later, the urine volume increased markedly to 3,800 mL/day (Fig. 3, blue line), and tolvaptan was reduced to 7.5 mg/day and then discontinued on the 14th day along with furosemide. The urinary AQP-2 level and urine osmolality also decreased to 0.88 ng/mgCre and 188 mOsm/kgH2O, respectively, on the 14th day. The patient's urine volume was maintained at approximately 2,000 mL/day by the 56th day. The urinary protein excretion decreased in a serial manner without the administration of an immunosuppressant such as prednisolone (PSL) and had reduced to approximately 0.5 g/day by the 56th day (Fig. 3, blue bar). The changes in the serum sodium level are shown in Fig. 4. Serum BNP levels were reduced from 250 to 44 pg/mL after tolvaptan treatment on the 14th day. The cardiac function measured by echocardiography remained unchanged within normal limits throughout the treatment period [baseline: left ventricular end-diastolic dimension (LVDd) 48 mm, left ventricular ejection fraction (LVEF) 66%, E/e' 6.6; 14th day: LVDd 47 mm, LVEF 68%, E/e' 6.5].

PMC7341039_01

Female

A previously healthy, 26-year-old female presented with a 2-year history of right 5th toe pain and progressive swelling, but walked well with normal gait. Radiographs revealed expansile geographic osteolytic lesions of the proximal phalanx of the right 5th toe (Fig. 1). Open biopsy confirmed a diagnosis of GCTB. No distant metastasis was detected. She did not take medication regularly and denied family history of genetic disorders. Patient understood her health condition and agreed to undergo wide resection and reconstruction with customized, 3D-printed toe prosthesis after critical discussion of possible methods of treatment. Denosumab was not administered preoperatively.

case report, giant cell tumor of bone, metatarsophalangeal joint replacement, phalangeal tumor, three-dimensional printed prosthesis

PMC6343163_01

Female

A 30-year-old Filipino woman with no known comorbidities and good baseline functional capacity was admitted in our institution for a one-year history of intermittent high-grade fever (Tmax 40 C), malaise, generalized weakness, anorexia, unintentional weight loss, alopecia, throat discomfort, exertional dyspnea, easy fatigability, and additive arthritis of bilateral knees, elbows, and small joints of both hands. Two months prior to admission, she consulted at a private clinic where a battery of tests showed negative Salmonella and dengue IgM and IgG, normal C-reactive protein, and normal rheumatoid factor. The patient does not smoke, drinks alcoholic beverages once a month, and denies illicit drug use. She previously worked as an adult entertainer in Japan during the early 2000s, during which she had more than 50 heterosexual partners. Her obstetric score is G2P2 (2002), with no previous fetomaternal complications. Family history is unremarkable. On admission, she was noted to have tachycardia, fever (38.9 C), hyperemic conjunctivae, facial flushing, bilateral cervical lymphadenopathies, and arthritis of both knee joints. The initial working impression was fever of unknown origin with infection (tuberculosis and HIV), connective tissue disorder, and occult malignancy as major differential diagnoses. Initial laboratory studies showed normocytic, normochromic anemia (hemoglobin 116 g/L), trace result on direct antiglobulin testing, and a 3.9 times elevated AST (145 U/L; reference range 15-37 U/L). Stool analysis was unremarkable, and fecal occult blood test was negative. Chest X-ray showed nonsignificant chest findings. Holoabdominal ultrasound revealed hepatomegaly with a liver span of 17.4 cm with smooth borders and a normal echo pattern but with a normal spleen. Multiple sets of sputum, stool, and urine acid-fast bacilli smears were all negative. Urinalysis showed minimal bacteriuria. ESR and CRP were both elevated. HIV antigen/antibody testing was negative. RPR, anti-HBs, anti-HCV, and HBsAg were all nonreactive. Three sets of blood cultures also turned out negative. Work-ups for infection and malignancy were unremarkable. She was initially started on piperacillin/tazobactam, omeprazole, tramadol, paracetamol, and naproxen. Naproxen was discontinued because of increase in facial flushing and periorbital edema. On the 10th hospital day, the patient was noted to have pancytopenia (hemoglobin 108 g/L, platelet count of 139 x 109/L, WBC 3.18 x 109/L) with leukoerythroblastosis. Laboratory testing during this time revealed an increase in ESR (from 47 to 92 mm/h), increase in AST (from 145 to 553 U/L), and an increase in ALT (from 32 to 189 U/L). LDH was noted to be markedly elevated (9680 U/L; reference range 100-190 U/L). Triglycerides (3.26 mmol/L) and serum ferritin (>4500 pmol/L) were also markedly elevated. 24-hour urine collection showed total protein of 900 mg with a total volume of 1500 mL. Repeat direct and indirect antiglobulin tests were negative. Anti-cyclic citrullinated peptide was negative. Antinuclear antibody was positive but anti-double-stranded DNA was negative, and C3 was normal. Bone marrow aspiration (BMA), and biopsy was done. The BMA smear revealed a normocellular marrow with trilineage hematopoiesis and the presence of hemophagocytosis (see Figure 1). The bone marrow trephine biopsy revealed a normocellular marrow with megakaryocytic hyperplasia with moderate myelofibrosis (WHO MF Grade 2) (see Figure 2). The bone marrow acid-fast bacilli smear was negative. Having satisfied the 2012 SLICC revised diagnostic criteria, she was then diagnosed as a case of systemic lupus erythematosus with concomitant autoimmune-associated hemophagocytic syndrome (HScore of 229 with 97.8% probability of HLH) and autoimmune myelofibrosis. She was then started on intravenous hydrocortisone (prednisone 1 mkd equivalent), hydroxychloroquine, and calcium plus vitamin D supplements. During treatment, all clinical findings (e.g., malaise, generalized weakness, throat discomfort, fever, facial flushing, lymphadenopathies, and arthritis) and laboratory data (e.g., blood counts, LDH, and liver enzymes) gradually improved. No significant treatment-related side effects were noted. She was discharged on the 19th hospital day on oral prednisone (1 mkd), hydroxychloroquine, and calcium plus vitamin D. She was closely followed at the outpatient clinics with note of continuous improvement in symptoms and laboratory findings. Prednisone was slowly tapered down. Hydroxychloroquine and calcium plus vitamin D were continued. Good adherence to treatment plan was noted. No significant therapy-related side effects were reported by the patient. A repeat bone marrow biopsy was done four months after discharge, which revealed normocellular marrow with trilineage hematopoiesis with complete resolution of myelofibrosis and hemophagocytosis (Figure 3).

PMC5337467_01

Female

In December 2014, a 71-year-old Japanese woman presented with severe, dry cough and left chest pain. She had received the seasonal influenza vaccine at another clinic 36 days before visiting our clinic, and the local injection site reaction was mild. She developed a dry cough the following day, and it gradually worsened. Two days before the first visit, she developed left chest pain. Her medical history revealed well-controlled diabetes mellitus and dyslipidemia. She had undergone right nephrectomy for renal tuberculosis 37 years ago and had been prescribed rosuvastatin and linagliptin for the past 12 months. At the first visit, all her vital signs and physical features were normal. A complete blood count revealed mild leukocytosis (white blood cell count, 11,400/mm3) with normal white blood cell differentiation. Blood chemistry showed no abnormalities, including a normal lactate dehydrogenase (LDH) level. Serological tests revealed the following: C-reactive protein (CRP), 5.54 mg/dL; soluble interleukin-2 receptor (sIL-2R), 1,086 U/mL; and surfactant protein-D, 178.2 ng/mL. Her serum surfactant protein-A (SP-A) and Krebs von den Lungen-6 (KL-6) levels were normal. Chest roentgenography (Fig. 1A) and computed tomography (Fig. 1B) showed patchy, peribronchial consolidations with air bronchograms and ground-glass opacities without pleural effusion in both lungs. Electrocardiogram and ultrasonic echocardiogram were normal. The severe cough followed by musculoskeletal chest pain precluded pulmonary function tests. Bronchoalveolar lavage fluid (BALF) examination revealed 65% lymphocytes, 15% eosinophils, 19% macrophages, and 1% neutrophils, with no infectious organisms or malignant cells. The CD4+/CD8+ ratio was 2.1. Transbronchial lung biopsy revealed lymphocytic alveolitis and granulation tissue plugs within airspaces, suggesting organizing pneumonia (Fig. 1C). A drug lymphocyte stimulation test (DLST) performed using peripheral lymphocytes showed a positive reaction to the influenza vaccine, with a stimulation index of 190% (normal, <180%). Oral prednisolone at 35 mg (0.8 mg/kg/day) was administered daily, and within a week, our patient's symptoms and abnormal radiography and laboratory findings began resolving. We then performed pulmonary function tests and found a forced vital capacity (FVC) of 2.07 L (normal, 79.6% predicted), forced expiratory volume in 1 s (FEV1) of 1.68 L (normal, 88.0% predicted), and an FEV1/FVC ratio of 81.1%. Oral steroid therapy was tapered on an outpatient basis. Ten months after the treatment, her prednisolone dose was tapered. The patient remains healthy with no further symptoms or radiographic abnormalities (Fig. 1D), and she did not receive the annual influenza vaccine the following year.

PMC9941144_01

Male

A 66-year-old man with a 4-year history of refractory diarrhea was admitted to the Department of Gastroenterology, The Third Xiangya Hospital of Central South University, with complaints of yellow-appearing diarrhea occurring 4-6 times per day. He also reported 10-kg of weight loss over the last 8 months. He denied any abdominal pain, abdominal distention, nausea, vomiting, fever, hematochezia, or melena. The patient was initially misdiagnosed with anorexia nervosa due to poor appetite and low BMI, but later revealed his reluctance to eat was secondary to his fear of developing diarrhea after food ingestion. Due to his malnourished state, a nasogastric tube was inserted under EGD guidance for enteral nutrition. The patient was diagnosed with non-atrophic gastritis and colonic polyps a year ago and subsequently had the colonic polyps removed by high-frequency electrocoagulation 6 months later. He denied any history of medications, including anti-hypertensives, magnesium supplements, and non-steroidal anti-inflammatory drugs (NSAIDS). There was no known history of drug or food allergies. The patient had a 25-year history of smoking tobacco but had quit 3 months prior to admission. He only occasionally drank alcohol and denied any exposure to radioactive or toxic materials. On admission, the patient's temperature as 36.5 C, with heart rate of 65 beats per minute, and respiratory rate of 20 breaths per minute. His blood pressure was 99/67 mmHg, and oxygen saturation was 98% on room air. The patient was 41 kg, 167 cm, hence BMI of 14.7. On physical exam, cardiac and respiratory examinations were unremarkable. The abdomen was soft, non-tender on palpation, and without rebound tenderness, or masses. The liver and spleen were impalpable. The patient's white-cell count (WBC) was 3,660 per cubic millimeter (29.7% neutrophils, 54% lymphocytes, 8.5% monocytes), hemoglobin (Hgb) was 9.8 g per deciliter (g/dl), and the platelet count was 159,000 per cubic millimeter. The alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (T. Bili), blood urea nitrogen (BUN), creatinine (Cr), serum glucose level, lipid panel, thyroid stimulating hormone (TSH), C-reactive protein (CRP), and electrolyte levels were all within normal limits. Serum CEA, AFP, CA12-5, and CA19-9 were also normal. Albumin level was slightly decreased to 3.4 g per deciliter (g/dL). Fecal elastase-1 level was 165.77 mug/g. Levels of serum gastrin 17 and fecal calprotectin were normal (Table 1). The enzyme linked immunosorbent assay (ELISA) test for IgG antibodies to 90 unique food allergens (Allerquant 90G ELISA Kit, BIOMERICA) in his serum was negative. Meanwhile, we reviewed his test results from an outside hospital. The esophagogastroduodenoscopy (EGD) and colonoscopy a year ago showed non-atrophic gastritis and colonic polyps. Fluorine 18 fluorodeoxyglucose (FDG) PET/CT showed no abnormal FDG uptake in gastrointestinal tract, pancreas, liver, spleen, gallbladder, kidneys, adrenal glands, or bladder. The laboratory data were consistent with mild-moderate pancreatic exocrine insufficiency, given the elastase-1 level was less than 200 mug/g. The patient was treated by oryz-aspergillus enzyme and pancreatin tablet (Combizym, Daiichi-Sankyo Europe, Munich, Germany), however, his diarrhea did not improve. On the fifth day after admission, the patient spiked a fever (Tmax 39.5 C) and reported chills. He denied cough, sputum, canker sores, pollakiuria, and dysuria. Faint bibasilar rales were noted on auscultation. The white-cell count was 6,530 per cubic millimeter (56.1% neutrophils, 34.6% lymphocytes, 6.3% monocytes) and CRP 0.99 mg/dL (normal value, < 0.5). The erythrocyte sedimentation rate (ESR) was 33 mm per hour (normal range, 0-28), the procalcitonin (PCT) level was 2.25 ng per deciliter (ng/dL), and blood cultures were obtained. The patient received empiric antibiotic treatment with piperacillin-tazobactam for possible pneumonia. Two days later, the fever resolved. However, on the twelfth day, the patient had a fever again, with peak temperatures of 40.0 C. The white-cell count was 2,070 per cubic millimeter (59.6% neutrophils, 30.6% lymphocytes, 5.1% monocytes), the hemoglobin level 8.6 g/dL, and the platelet count 149,000 per cubic millimeter. Liver and renal function measurements remained normal except for a lower albumin level of 3.2 g/dL. Comprehensive metabolic panel (CMP) showed potassium of 4.31 mmol per liter (mmol/l), sodium of 111.4 mmol/l (normal range, 137-147), chloride of 79 mmol/l (normal range, 99-109), phosphorus of 0.46 mmol/l (normal range, 0.85-1.51), calcium 1.81 of mmol/l (normal range, 2.2-2.7), and magnesium of 0.63 mmol/l (normal range, 0.75-1.02). The anion gap was 9.7 mmol/l. The PCT level was 2.87 ng dL and CRP was 2.66 mg/dL (normal range, < 0.5). Urinalysis showed no protein, red cells, or white cells per high-power field. Fecal studies showed no fecal leukocytes, ova or parasites, and the fecal occult blood test (FOBT) were negative. A sputum culture, two sets of blood and stool cultures were negative, as were serologic tests for mycoplasma, chlamydia, varicella-zoster virus, adenovirus, coxsackie virus, influenza virus, epidemic hemorrhagic fever virus, mumps virus, respiratory syncytial virus, measles virus and echovirus. Testing for HIV and HCV antibody, HBsAg and clostridium difficile (C. diff) toxin were negative. The T-cell spot test for tuberculosis infection (T-SPOT.TB), and polymerase-chain-reaction (PCR) assays for epstein-barr virus and cytomegalovirus were all negative. 1,3-beta-D-glucan and galactomannan content detection were within normal range. High resolution computed tomography (HRCT) of the chest showed bilateral moderate pleural effusion and pneumonia. CT of abdomen with of contrast showed an enlarged liver without masses and a small amount of ascites. The antimicrobial regimen was replaced with intravenous meropenem. Meanwhile, the patient began to receive 50% saline orally, 500 ml of hypertonic saline (4.5%) intravenously, and 10 ml of 2.16 g sodium glycerophosphate in 500 ml dextrose 5% in water intravenously. The level of blood sodium rose by 9 mmol/l on the first day, then by 3-5 mmol/l daily until it was normalized. The hypophosphatemia was also gradually resolved. The fact of simultaneous pleural effusion, peritoneal effusion, and hepatomegaly raised the possibility of the diffuse serosal inflammation (e.g., SLE). So some tests for connective tissue diseases were done. The C3 level was 0.6 g per liter (g/L) (normal range, > 0.79), and the C4 level was 0.2 g/L (normal range, > 0.16). Test for ANA (nuclear granular type) was present at a titer of 1:320. Test for anti-SSA antibodies and anti-mitochondrial antibodies were positive. Anti-SSB antibodies, antineutrophil cytoplasmic antibodies (ANCA), rheumatoid factor, cyclic citrullinated peptide (CCP) antibodies and anti-dsDNA antibodies were not detected. The level of IgG4 was normal. After focused history taken for rheumatic and autoimmune diseases, a 9-year history of a persistent dry mouth was reported by the patient, so Schirmer's test was positive (Figure 1). Then biopsy of minor salivary glands was performed, showing focal lymphocytic sialadenitis (FLS). Focus score was 1 (Figure 2). A presumptive diagnosis of primary Sjogren's Syndrome related fever and diarrhea was made. The patient's diarrhea resolved and fever subsided with initiation of glucocorticoids (methylprednisolone tablets orally, 12 mg/day). By the time he was discharged from our hospital, his bowels had been regular and the level of electrolytes returned to normal range. He felt well and gained 5.5 kg in weight at 1-month follow-up.

sjogren’s syndrome, cachexia, diarrhea, nutrition, refeeding syndrome

PMC5738569_01

Male

A 57-year-old man was admitted to our hospital with a four-week history of nonproductive cough and dyspnea. His past medical history was notable for type II diabetes mellitus, chronic kidney disease with a baseline creatinine of 1.3 mg/dL, and untreated HIV/AIDS, which had been diagnosed 20 years previously. Prior opportunistic infections included oral candidiasis and cryptococcal meningitis. He was allergic to sulfonamides and had been prescribed dapsone for PCP prophylaxis, but he was not taking it reliably. His most recent known CD4 count and HIV viral load, 11 months prior to admission, were 15 cells/uL and 148,582 copies/mL, respectively. Four days prior to presenting to our emergency department, the patient was admitted to another hospital with the same symptoms of nonproductive cough and shortness of breath. Chest radiograph at that time showed diffuse micronodules, greater in the right lung (Figure 1). There, he was empirically treated for both community-acquired pneumonia and PCP with ceftriaxone, azithromycin, clindamycin, primaquine, and steroids. He was also given fluconazole for thrush. Unfortunately, he left that facility against medical advice after 48 hours. He took no further treatment before coming to our hospital two days later. When he subsequently came to our emergency department complaining of ongoing shortness of breath and cough, temperature was 35.9 degree Celsius, heart rate 119 beats per minute, blood pressure 107/71 mmHg, respiratory rate 18 breaths per minute, and oxygen saturation 96% while breathing ambient air. He was ill-appearing with conjunctival pallor and oral thrush. The remainder of his physical examination was normal, including chest auscultation, which revealed good air movement without wheezing, rales, or rhonchi. Laboratory analysis was notable for white blood cell count of 6,200 cells/uL with 63% neutrophils, 19% lymphocytes, 13% monocytes, and 3% eosinophils, elevated lactate dehydrogenase of 385 u/L, and positive beta-D-glucan of 389 pg/mL (Table 1). Chest roentgenogram revealed diffuse micronodules with confluent areas of nodular opacities (Figure 2). On the basis of these findings, the patient was admitted to our medical service and treated empirically for community-acquired pneumonia with ceftriaxone and doxycycline, for thrush with fluconazole, and for PCP with clindamycin and primaquine. On hospital day 2, the patient developed worsening shortness of breath with hypoxemia requiring supplemental oxygen. A noncontrast, volumetric chest CT scan (Figure 3) revealed diffuse micronodules with central cavitation and bronchial wall thickening, most suspicious for mycobacterial or fungal infection. Notably, there were no ground glass opacities. Based on this CT and the lack of ground glass opacities, the treating team discontinued PCP therapy, initiated tuberculosis treatment, and consulted the pulmonary service for assistance and consideration of bronchoscopy. The patient underwent bronchoscopy with bronchoalveolar lavage (BAL) and transbronchial biopsy the following day. Pathologic analysis of the transbronchial biopsy specimen demonstrated foamy exudates on hematoxylin and eosin- (H&E-) stained sections, and silver stain revealed Pneumocystis jirovecii-type fungal organisms confirming the diagnosis to be PCP (Figure 4). No concurrent infections were found on cultures or pathologic samples (Table 2). The patient was treated with three weeks of clindamycin, primaquine, and prednisone. He was discharged home on hospital day 10 without requiring supplemental oxygen and did well thereafter, with a resolution of radiographic abnormalities on imaging obtained four months later (Figure 5).

PMC3949550_01

Male

A 26 year old male was admitted with fever, chills and worsening cough for 2 weeks. He had a chronic cough which started 2 years prior to presentation and became progressively worse 2 weeks prior to presentation. He reported purulent sputum production with occasional streaks of blood in the sputum. There was no history of tuberculosis or tuberculosis exposure. He was tested tuberculin negative. His past medical history was not significant and his family history was noncontributory. His physical exam was remarkable for reduced air entry in the left upper lung field. Laboratory studies showed leukocytosis of 18,300 cells/ul. Sputum and blood cultures were negative. Sputum smear and culture for acid fast bacilli (AFB) were negative. The mass is separated medially from the vessels by the mediastinal fat plane and is posteriorly outlined by the major fissure Presence of endobronchial lesion and dilated cystic spaces suggest a bronchus filled with mucous. Chest radiograph (CXR) (Fig. 1A) demonstrates luftsichel sign, which signifies left upper lobe collapse with an area of lucency around the aortic arch created by the hyperinflated left lower lobe, a portion of which wraps around the medial side of the collapsed left upper lobe. However, overall there is no significant volume loss of left upper lobe due to the presence of an expansive underlying mass. Lateral Chest radiograph (Fig. 1B) showed major fissure pulled anteriorly with hyper-inflated left lower lobe. Computed Tomography (CT) (Fig. 2A and B) of chest showed a large heterogenous mass with an endobronchial component and dilated cystic spaces. These cystic spaces demonstrate a branching pattern and appear to be the dilated bronchus filled with mucous secretions. There are signs on CT chest which helped to distinguish it as a lung mass Pulmonary function test was consistent with mild obstructive airway disease with FEV1 of 2.87 L (76% predicted). Lung volumes were normal. Positron emission tomography (PET) scan with 18F-flurodeoxyglucose showed increased uptake only over left hemi-thorax with no other areas of uptake indicating metastasis. Flexible bronchoscopy was performed for further evaluation of this mass. There was a large pinkish polypoidal mass obstructing the left upper lobe bronchus with thick purulent secretions (Fig. 3). Endobronchial biopsy showed (Fig. 4A and B) malignant epithelial neoplasm infiltrating the fibrous hyaline stroma. The neoplasm is composed of multiple glandular structures lined by mucous secreting cells with interspersed stroma which has squamoid and clear cells with minimal mitosis which is consistent with the diagnosis of low grade primary salivary type lung cancer: mucoepidermoid carcinoma. Thoracic surgery was consulted for left upper sleeve lobectomy. Unfortunately there were extensive adhesions which limited the separation of vascular planes between the left upper and lower lobe and thus complete pneumonectomy was performed. Extensive lymph node sampling did not reveal any regional spread. His postoperative course was uneventful and did not require any adjuvant therapy.

luftsichel sign, mucoepidermoid carcinoma, pneumonectomy

A - CT chest cross sectional view: Large heterogenous left upper lobe mass (white arrow) with endobronchial lesion (black arrow).

PMC3949550_01

Male

A 26 year old male was admitted with fever, chills and worsening cough for 2 weeks. He had a chronic cough which started 2 years prior to presentation and became progressively worse 2 weeks prior to presentation. He reported purulent sputum production with occasional streaks of blood in the sputum. There was no history of tuberculosis or tuberculosis exposure. He was tested tuberculin negative. His past medical history was not significant and his family history was noncontributory. His physical exam was remarkable for reduced air entry in the left upper lung field. Laboratory studies showed leukocytosis of 18,300 cells/ul. Sputum and blood cultures were negative. Sputum smear and culture for acid fast bacilli (AFB) were negative. The mass is separated medially from the vessels by the mediastinal fat plane and is posteriorly outlined by the major fissure Presence of endobronchial lesion and dilated cystic spaces suggest a bronchus filled with mucous. Chest radiograph (CXR) (Fig. 1A) demonstrates luftsichel sign, which signifies left upper lobe collapse with an area of lucency around the aortic arch created by the hyperinflated left lower lobe, a portion of which wraps around the medial side of the collapsed left upper lobe. However, overall there is no significant volume loss of left upper lobe due to the presence of an expansive underlying mass. Lateral Chest radiograph (Fig. 1B) showed major fissure pulled anteriorly with hyper-inflated left lower lobe. Computed Tomography (CT) (Fig. 2A and B) of chest showed a large heterogenous mass with an endobronchial component and dilated cystic spaces. These cystic spaces demonstrate a branching pattern and appear to be the dilated bronchus filled with mucous secretions. There are signs on CT chest which helped to distinguish it as a lung mass Pulmonary function test was consistent with mild obstructive airway disease with FEV1 of 2.87 L (76% predicted). Lung volumes were normal. Positron emission tomography (PET) scan with 18F-flurodeoxyglucose showed increased uptake only over left hemi-thorax with no other areas of uptake indicating metastasis. Flexible bronchoscopy was performed for further evaluation of this mass. There was a large pinkish polypoidal mass obstructing the left upper lobe bronchus with thick purulent secretions (Fig. 3). Endobronchial biopsy showed (Fig. 4A and B) malignant epithelial neoplasm infiltrating the fibrous hyaline stroma. The neoplasm is composed of multiple glandular structures lined by mucous secreting cells with interspersed stroma which has squamoid and clear cells with minimal mitosis which is consistent with the diagnosis of low grade primary salivary type lung cancer: mucoepidermoid carcinoma. Thoracic surgery was consulted for left upper sleeve lobectomy. Unfortunately there were extensive adhesions which limited the separation of vascular planes between the left upper and lower lobe and thus complete pneumonectomy was performed. Extensive lymph node sampling did not reveal any regional spread. His postoperative course was uneventful and did not require any adjuvant therapy.

luftsichel sign, mucoepidermoid carcinoma, pneumonectomy

B - CT chest cross sectional view: The mass is separated medially from the vessels by the mediastinal fat plane (arrow head), posteriorly outlined by the major fissure (white arrow) and contains dilated cystic spaces with branching pattern suggestive of dilated bronchus filled with mucus (black arrow).

PMC3491191_01

Female

A 20-year-old woman presented with left arm and leg numbness and weakness for 1 month. One week before admission, the symptoms had become particularly severe; they had been accompanied by a mild headache. The patient had a history of previous brucellosis. The diagnosis of brucellosis was first made 4 months previously. At that time, she was treated with rifampicin 600 mg/day and doxycycline 200 mg/day for 45 days. She had remained free of symptoms until 1 month previously. Upon examination, the patient was afebrile, and neurological examination showed left hemiparesis. Routine laboratory analyses indicated only leukocytosis (19,500/mm3). The differential blood count indicated 85.6% neutrophils and 4.8% lymphocytes. The C-reactive protein (CRP) value (40 mg/dl) and sedimentation rate (38 mm/h) were elevated. An initial serological titer for Brucella was positive at 1:640 via Wright's agglutination test. Then, blood cultures were sent for Brucella. Magnetic resonance imaging (MRI) showed a 1.5 x 1.5 cm enhancing nodular lesion with moderate surrounding edema in the right parietal lobe (Fig. 1). These findings suggested a cerebral tumor. The patient underwent a right parietal craniotomy with the total excision of the neoplasm. The final examination of the pathological specimens showed a nongranulomatous encephalitis that consisted of diffuse lymphocytic infiltrates and perivascular lymphocytic cuffing (Fig. 2). The stains for mycobacteria, bacteria, fungi, and spirochetes were negative. These observations led us to investigate the etiology of encephalitis. Then, a lumbar puncture was performed. Examination of the CSF showed no pleocytosis, a protein concentration of 48 mg/dl, and a glucose level of 52 mg/dl. CSF samples were sent for Gram and Ziehl-Neelsen staining and bacterial, mycobacterial, and fungal cultures. Polymerase chain reaction (PCR) testing for Mycobacterium tuberculosis was performed as well. All results, as well as those of the CSF serologies for cytomegalovirus (CMV), Epstein-Barr virus (EBV), herpes simplex virus type 1 and 2 (HSV-1 and HSV-2), rubella, and toxoplasmosis, were negative. Serum serologies for human immunodeficiency virus, serum hepatitis C, CMV, EBV, HSV-1 and HSV-2, rubella, Borrelia burgdorferi, toxoplasmosis, and syphilis, except for serum hepatitis B, were negative. Wright's agglutination test in the CSF was positive at 1:320 titers. Eventually, Brucella melitensis was isolated in the blood culture. Based on these findings, the patient was diagnosed with neurobrucellosis, presenting as nongranulomatous encephalitis. Therapy with rifampin (600 mg/day), trimethoprim-sulfamethoxazole (640-3,200 mg/day), and ceftriaxone (2 g/day) was started and continued for 3 weeks. Thereafter, therapy with rifampin (600 mg/day) and trimethoprim-sulfamethoxazole (640-3,200 mg/day) was maintained, but ceftriaxone was replaced with doxycycline (200 mg/day), and the new antimicrobial combination was planned to be continued for 6 months. On hospital day 14, the patient's symptoms had apparently subsided. During the next 6 months, the patient will be followed up closely with serological, microbiological, and MRI imaging assays until complete recovery.

PMC5266195_01

Male

A 75-year-old Chinese Han man weighting 65 kg came to the Department of Ophthalmology, Beijing Tsinghua Changgung Hospital on March 11, 2016, and complaint of mistiness of vision since February 2016. He received treatment of ethambutol (1500 mg/day) from April 2015 to December 2015 because he suffered from tuberculosis. He did not have any family history of neuropathy. This study was approved by the Institutional Review Board for the Protection of Human Subjects of Beijing Tsinghua Changgung Hospital and adhered to the tenets of the Declaration of Helsinki. The patient signed an informed consent before the start of examinations. We performed series of ophthalmic examinations to see the severity of his ocular condition. His BCVA (best-corrected visual acuity) was 0.12 (OS) and 0.15 (OD), whereas the IOP (intraocular pressure) was 10.4 mm Hg and 12.2 mm Hg (Goldmann applanation tonometry, Suzhou City, Jiangsu Province, China), respectively. The slit-lamp microscope examination of bilateral anterior segments indicated no abnormity. The pupils were normal with no relative afferent pupillary defect (RAPD). The funduscopy examination did not indicate any abnormity, either (Fig. 1). Automated perimetry (Humphrey Field Analyzer, Carl Zeiss Meditec, Inc, Dublin, CA, and Octopus Perimeter, Haag-Streit, Mason, OH) indicated typical cecocentral visual field defects (Fig. 2). The retinal nerve fiber layer (RNFL) thickness was measured using optical coherence tomography (OCT) (spectral-domain OCT, Heidelberg Engineering, Heidelberg, Germany). The results showed that the bilateral RNFL thickness was within the normal range (Fig. 3). Furthermore, we took electroretinogram (ERG) examination and found that the amplitude of b-wave was definitely decreased. Based on the ocular examinations listed above, this patient was diagnosed as EON. Since he stopped taking ethambutol in the end of 2015, we just offered some neurotrophic agents to him and asked him to come back for return visit within 1 month. On May 5, 2016, the patient came back to the Department of Ophthalmology, Beijing Tsinghua Changgung Hospital for return visit. This time, his BCVA (best-corrected visual acuity) was 0.8 (OS) and 0.8 (OD), whereas the IOP was 11.9 mm Hg and 11.2 mm Hg (Goldmann applanation tonometry), respectively. The examinations of bilateral anterior segments and fundus also indicated no abnormity. The Goldmann perimetry was performed again to see the outcome of therapies with neurotrophic agents. The results showed completely recovery of cecocentral scotoma (Fig. 4). Thus, the prognosis of the disease in the present case-report was pretty good.

PMC10241203_01

Female

A 72-year-old female patient with a history of coronary artery disease with stent placement, hypertension, hyperlipidemia, anemia, diabetes, atrial fibrillation, and paroxysmal atrial tachycardia presented to the clinic six weeks following the implantation of an automatic implantable cardioverter-defibrillator (AICD) with complaints of muscle spasms on her back and right side of the chest. The patient reported experiencing a thumping sensation from her back that radiated to the frontal side of her chest. On physical examination, it was noted that the muscle spasms occurred simultaneously with heartbeats and would cease upon laying in a supine position. The muscle spasms also were found to be fainter upon sitting upright and twisting the torso to the right. The patient denied dyspnea, palpitations, or syncope. She denied previous manual manipulation of her AICD. Vital signs were stable upon presentation. Electrocardiogram revealed a ventricular paced rhythm at a rate of 65 beats per minute (bpm). Interrogation of the AICD revealed that the right ventricular (RV) lead was not sensing. The percentage of ventricular pacing was 0.2%, in comparison to 10% atrial pacing. P-wave sensing was detected at 0.9 millivolts (mV) while an R-wave was not detected. Fluoroscopy confirmed that the RV lead was coiled around the AICD device and not placed in the right ventricle (Figure 1). Based on these findings, a diagnosis of Twiddler Syndrome was made. The patient underwent AICD system extraction, and an endocardial leadless pacing system was implanted. The post-operative course was uncomplicated.

artificial pacemaker, complications, implantable cardioverter-defibrillator, rare disease, syndrome

PMC4857353_01

Female

A 61-year-old Japanese woman was admitted to our hospital complaining of fever and polyarthralgia. She had had arthralgia of her proximal interphalangeal joints and ankles for the past 3 years. Two years before admission, she was diagnosed with gouty arthritis because her excided left elbow node showed tophus with sodium urate crystals. She had suffered from polyarthritis, and serum creatinine concentration was already elevated due to renal dysfunction. She was found to have symmetric polyarthritis of the elbows, knees, ankles, and metatarsophalangeal (MTP) joints of both feet. In addition, subcutaneous granulomatous nodules were detectable in her hands, ankles, and feet. Her serum laboratory data showed C-reactive protein (CRP), 29.8 mg/dL; ferritin, 2660 mg/L; creatinine, 2.46 mg/dL; blood urea nitrogen (BUN), 23.6 mg/dL; uric acid (UA), 8.7 mg/dL; aspartate aminotransferase (AST), 152 IU/L; and alanine aminotransferase (ALT), 245 IU/L. Her serum concentrations of cytokines measured by enzyme-linked immunosorbent assay (ELISA) were as follows: IL-1beta, under the detectable level; IL-6, 371 pg/mL; and tumor-necrosis factor (TNF)-alpha, 3.6 pg/mL (Table 1). Her synovial fluid IL-6 concentration was 62,800 pg/mL. An X-ray image of her feet showed subcutaneous crystals around the first MTP joints and the overhanging margin in her right first metatarsal bone (Figure 1(a), Before, arrow). After admission, medication of prednisolone at 20 mg/day and colchicine at 0.5 mg/day improved her fever, joint swelling and joint tenderness. Colchicine had to be stopped because of hair loss after six weeks of medication. We reduced the dose of prednisolone gradually, and then her arthritis flared up when the dose of prednisolone was 5 mg/day. Treatment of tocilizumab (8 mg/kg, every 4 weeks) was started 4 weeks after admission with two intraarticular injections of 20 mg of methylprednisolone in the 8 weeks after tocilizumab treatment. As a result, her arthritis gradually improved, subcutaneous nodules were reduced in size as determined by an X-ray image (Figure 1(a), After) and the patient's laboratory data were also improved 24 weeks after starting the treatment of tocilizumab (Table 1) (Figure 1(b)). There was no fever or acute attack during the tocilizumab treatment (Figure 1(b)). Time course of medication and plotted body temperature, serum UA (mg/dL), serum CRP (mg/dL) and serum IL-6 (pg/mL) concentrations are indicated (Figure 1(b)). The analyses of patient materials were approved by the Human Research Ethical Committees of Ehime University and Dogo Spa Hospital. We measured the concentrations of IL-1beta, IL-6, and TNF-alpha in the patient's serum before and after tocilizumab treatment (Table 1), and synovial fluid before tocilizumab treatment by ELISA. Peripheral blood mononuclear cells (PBMCs) were separated by Ficoll-gradient centrifugation (GE Healthcare Bio-Sciences AB, Piscataway, NJ). Synthetic N-acetylmuramyl-l-alanyl-d-isoglutamine, muramyl dipeptide (MDP) and lipopolysaccharide (LPS) from Escherichia coli O55:B5, cell culture tested, purified by trichloroacetic acid extraction and gel filtration chromatography, were purchased from Sigma-Aldrich (St Louis, MO). The cells were cultured in 24-well flat-bottom plates (BD Biosciences, San Jose, CA) with a final cell density of 1 x 106/mL in a volume of 1 mL of RPMI1640, including 10% fetal bovine serum (FBS) with MDP, LPS or left untreated for 8 h at 37 C in a humidified atmosphere with 5% CO2. Concentrations of IL-1beta, IL-6, IL-8, and TNF-alpha in the culture supernatant were measured by ELISA using IL-1beta-, IL-6-, IL-8-, and TNF-alpha-specific ELISA sets according to the manufacturer's instructions (BD Biosciences). PBMCs isolated from the patient did not spontaneously secrete IL-1beta, IL-6, IL-8 or TNF-alpha without any stimuli, and secreted these cytokines due to MDP (10 ng/mL or 1 microg/mL), LPS (0.1 ng/mL or 10 ng/mL) or a combination of MDP (10 ng/mL or 1 microg/mL) + LPS (0.1 ng/mL) in a dose-dependent manner (Figure 1(c)). The cytokine secretion patterns of PBMCs isolated from the patient were almost the same as those from healthy volunteers (Figure 1(c)). The biopsy specimen, previously diagnosed by pathologists, embedded in a paraffin block, was subjected to immunohistochemical analysis. A 3-microm-thick serial sections of tissue were cut, deparaffinized in xylene, and hydrated in ethanol, and endogenous peroxidase activity was blocked by soaking in absolute methanol containing 0.3% H2O2 for 30 min. Before immunostaining, antigen retrieval was carried out by incubating tissue sections in a microwave in 10 mmol/L Tris-HCl buffer (pH 8.0) containing 1 mmol/L ethylenediaminetetraacetic acid (EDTA). Sections were blocked with 1% normal goat serum in 50 mmol/L Tris-buffered saline (TBS) (pH 7.6) and incubated with primary antibodies specific for cryopyrin (mouse mAb, clone: Nalpy3-b Alexis, San Diego, CA), ASC (mouse mAb, clone: 23-4, MBL, Nagoya, Japan), caspase-1 (rabbit pAb, No. #2225, Cell Signaling, Danvers, MA), and IL-1beta (rabbit pAb, No. ab2105, abcam, Cambridge, MA) diluted 1:200, 1:100, 1:100 and 1:100, respectively, at 4 C overnight. After washing in TBS, slides were incubated with EnVision+ (DakoCytomation) for 60 min and 3,3-diaminobenzidine was used as the chromogen. These sections were counterstained with hematoxylin. In her excided tophus, expression signals of cryopyrin, ASC, caspase-1, and IL-1beta were all detected in the monocytic cells and multinuclear giant cells around the MSU crystal foreign body granuloma (Figure 1(d), arrowheads).

tophaceous gout, inflammasome, interleukin-1β, interleukin-6, tocilizumab

PMC6074940_01

Male

A 47-year-old Chinese man was admitted at night to a local primary hospital for the first time because of persistent severe epigastric abdominal pain without radiating or referred pain. The symptom appeared unexpectedly without fever, jaundice, nausea, or vomiting and spontaneously resolved four hours later. The patient had previously been in good health. No laboratory tests, imaging studies, or therapy was performed the night the patient presented. The following day, abdominal computed tomographic scan was performed, the results of which revealed multiple enlarged lymph nodes in the retroperitoneal area and a suspected tumor mass in the pancreatic head region (Figure 1). Chest radiography revealed changes consistent of bronchitis. No laboratory tests were performed. The symptoms resolved spontaneously and did not recur. The patient was referred to a cancer hospital and presented approximately two weeks later for further evaluation of the suspected pancreatic neoplasm. The patient underwent exploratory laparotomy and retroperitoneal lymph node biopsy in the cancer hospital. The postoperative pathologic tissue diagnosis was reported as granulomatous lesions with no signs of malignancy. Subsequently, the patient was admitted to the outpatient department of our hospital for suspected gastrointestinal sarcoidosis. Laboratory testing revealed that the purified protein derivative (PPD) skin test result was negative, serum angiotensin-converting enzyme (ACE) level was 61.51 U/L (normal range, 23-43 U/L), and the level of immunoglobulin G antibody was normal. The anti-double-stranded DNA antibody, antinuclear antibody, and antineutrophil cytoplasmic antibodies were all negative. CT of the chest showed mediastinal lymphadenopathy. On the preliminary tests, the patient was initially diagnosed with retroperitoneal and mediastinal lymphadenopathy likely secondary to sarcoidosis. Finally, the patient was admitted to the pulmonary department of our hospital for the definitive diagnosis. The physical examination on admission was un-remarkable. Laboratory tests revealed that blood count, liver function, and renal function were all within normal limits. Tumor markers were within the normal range. ACE level was 117.37 U/L, significantly higher than the levels obtained in the outpatient setting. The repeat chest CT showed mediastinal and hilar lymphadenopathy and multiple bilateral pulmonary lesions (Figure 2). The abdominal ultrasonography revealed hypoechoic nodules in the pancreatic head region. The pathologic slices of retroperitoneal lymph node were sent to the pathology department of the hospital as well as to a specialty tuberculosis hospital for consultation. Results showed a granulomatous lesion. Further, acid-fast bacilli test results were negative, and both these results were supportive of the diagnosis of sarcoidosis (Figure 3). Because of these studies, therapy with prednisone (40 mg per day) was started. After five months on corticosteroid therapy, imaging studies showed dramatic improvement and complete regression of all lesions. On the basis of clinical presentation, chest and abdominal CT imaging results, response to steroids, and retroperitoneal lymph node pathology report, systemic sarcoidosis was diagnosed. Corticosteroid therapy was tapered and eventually discontinued over two years. The patient has not experienced any recurrence of sarcoidosis in the subsequent three years of follow-up.

PMC6538945_01

Male

A male neonate weighing 2,020 g was given birth to by a 33-year-old Chinese mother (gravida 2, para 2) via cesarean section. The parents are non-consanguineous. During the first 5 weeks of pregnancy, the mother was treated with progesterone, and dydrogesterone until week 13 of gestation due to the signs of abortion. At week 24 of pregnancy, edema developed at the mother's lower limbs and gradually aggravated to anasarca at the end of the pregnancy. The mother was diagnosed with gestational diabetes at week 25 of gestation and her blood sugar levels fluctuated within a normal range through diet control. By 36 weeks, an ultrasound showed oligohydramnios and a normal heart silhouette, increased cardiothoracic ratio, and a small lung volume, indicating pulmonary hypoplasia (Figure 1). The family history was unremarkable. Labor was induced considering the oligohydramnios and a 3-h premature rupture of the fetal membrane at week 36. The placenta was grayish red and the focal purple red. No abnormalities were found in the umbilical cord. The Apgar scores of this neonate at 1 min and 5 min were 5 and 7, respectively. Ten minutes after birth, the neonate was admitted to the neonatal intensive care unit (NICU) for ventilation support due to tachypnea. A physical examination on admission showed a weak response, weak crying, hoarseness, respiratory distress, positive signs of triple concave and anasarca. The neonate had many special clinical phenotypes (Figure 2). The facial features included dysmorphic hypertelorism, down-slanting eyes, an eye movement disorder, ectropion, hypophasis, thickening of the helix, constriction of the auricular rim, curl of the auricle and auricle cartilage, a flat nasal bridge, small nostrils, and everted lips. Ichthyotic and collodion skin covered the entire body with a shiny, red and tight appearance and was very friable, much like a layer of gelatinous film. The skin on the hands, feet, groin and scrotum was peeling extensively, and red tender skin was exposed. The breath sounds were clear, and no rales were heard during the auscultation of both lungs. A continuous machinery rumbling murmur was heard at the upper left sternal edge. A 3/6 pansystolic murmur was heard all over the precordium but clearest at the left sternal edge. The abdomen was markedly distensible. The liver was 5 and 6 cm under the right costal margin and under processus xiphoideus, respectively. The spleen was 6 cm below the left costal margin. Both organs had an extremely firm, stone-like texture when palpated. The neonate was immobile unless upon stimuli, accompanied by flexion contractures at the elbow and knee joint, hypertonia, akinesia. Myoclonic movements were noted soon after birth. Myoclonic seizures manifested through limb jitters that lasted about 10 s before alleviation. The bilateral testis did not descend to the scrotum. The neonate had small microcaulia. Primitive reflexes were not elicited. At birth, the CBC indicated a platelet count of 19,000/mm3, WBC 11,880/mm3, and hemoglobin at 143 g/L. At 2 d of age, the CBC indicated the platelet count at 8,000/mm3, WBC 13,170/mm3, and hemoglobin at 165 g/L. A liver function test noted hypoproteinemia (TP 53.1 g/L, ALB 26.9 g/L); elevated enzymes (AST 123.4 U/L); and cholestasis (TBILI/ DBILI 43/28 mumol/L, TBA 25 mumol/L, gamma-GT 183U/L, ALP 249 U/L), LDH 326 U/L at birth. The peak values of TBILI 89 U/L, DBILI 69 U/L, TBA 37 mumol/L, gamma-GT 773 U/L, ALP 296 U/L, LDH 1055 U/L. The initial coagulation test showed the following: PT of 25.7 s, APTT of 40.4 s, TT of 26.4 s, INR of 2.08, FIB 0.79 g/L. The neonate underwent a bone marrow puncture at 5 d of age because he had no response to intravenous platelet and gamma globulin treatment. Bone marrow aspiration indicated proliferous granulocytic cells and erythroid cells. The ratio of lymphocytes was high. Three megakaryocytes were found in the whole smear. No Gaucher cells were found. The pathology of the placenta, fetal membrane and umbilical cord showed chronic inflammation with placental villi denatured necrotic calcification focus and umbilical cord arteriovenous congestion and focal hemorrhage. At birth, an echocardiography revealed (1) normal size of the atrium and ventricular chamber, normal thickness of the ventricular wall, normal structure of the valve; (2) normal connection and inner diameter of the aorta and pulmonary artery; (3) LVEF 62%; (4) CDFI: a patent ductus arteriosus with continuous left-to-right shunt signal between the root of the left pulmonary artery and the initial segment of the descending aorta, a beam width of 1.5 mm; ventricular septal defect with small left-to-right shunt signal in the middle segment of the ventricular septum during systole, a beam width of 1.2 mm, Vmax 3.0 m/ s, PGmax 37 mmHg measured by CW; a moderate reflux signal at the atrial side of the tricuspid orifice during systole, Vmax 3.3 m/ s, Pgmax 44 mmHg, moderate tricuspid regurgitation measured by CW, the pulmonary artery systolic pressure of 54 mmHg estimated by the degree of tricuspid regurgitation. An abdominal ultrasound showed palpable hepatosplenomegaly and cholestasis. A genital ultrasound revealed that the bilateral testis had hydrocele. At 2 d of age, lung computed tomography indicated a lack of air in the lungs (Figure 3A), and a brain computed tomography revealed multiple hemorrhagic lesions in the left frontal, temporal and parietal lobes (Figure 3B). At 9 d of age, a craniocerebral MRI disclosed a small hemorrhagic lesion in the left parietal lobe accompanied with a widening of part of the external space. At 14 d of age, the neonate developed frequent tonic seizures and an electroencephalogram showed sharp waves, spike waves, and outburst suppressions. The sleep cycle was not observed. At 16 d of age, no hemorrhagic lesions were found in the craniocerebral MRI. At 19 d of age, an echocardiography demonstrated LVEF 63%, VSD with small left-to-right shunt signal and a pulmonary artery systolic pressure of 47 mmHg. At 35 d of age, an echocardiography demonstrated LVEF 60%, VSD and a pulmonary artery systolic pressure of 38 mmHg. Cytogenetic evaluation revealed 46 XY. No copy number variation associated with clinical symptoms was detected in the whole genome copy number variation analysis. We correlated all the aforementioned manifestations with a possible metabolic disease. At 44 d of age, the leukocyte enzyme assay for beta-glucocerebrosidase revealed an activity of 0.00 nmol/h/mg (control range: 10-25 nmol/h/mg), explicitly supporting the diagnosis of PLGD. Testing of the mother and father revealed serum beta-glucocerebrosidase enzymatic activities of 13.3 and 17.8 nmol/h/mg, respectively. Urinary screening for metabolic disorders by GCMC was negative. The proband's GBA sequencing analysis demonstrated two heterozygous mutations, Gly234Glu (c.701G>A; p.G234E) in exon 7and His413Pro (c.1238A>C; p.H413P) in exon 10 (Figure 4). Following admission to the NICU, the patient was given non-invasive respiratory support. Without sucking and swallowing, he was always kept fed through a gastric tube. With refractory thrombocytopenia, he was treated with 2 days of an intravenous infusion of gamma globulin (1 g/kg/d) and intermittent multiple transfusion of platelets; the platelet count fluctuated between 22,000 and 68,000/mm3. After treatment with intravenous infusion of vitamin K, ethamsylate and cryoprecipitate, anomaly coagulation parameters were improved. Levetiracetam, and phenobarbital were administrated orally to control the severe myoclonus, but the symptoms were poorly controlled. At 44 d of age, with the confirmation of PLGD diagnosis, the treatment was discontinued upon the parent's request. The patient was then discharged and taken home. During the follow-up period, the patient kept gastric tube feeding, had no increase in physique, and gradually developed a pale face, obstinate hiccups, progressive neurological deterioration, hepatosplenomegaly, abdominal varicose veins, systemic edema (especially in the lower limbs and scrotum). He was supplied with humidified oxygen via a face mask, adequate caloric intake was ensured and excessive salt intake was avoided. He was also given dihydrochlorothiazide, spironolactone, and lanatoside C. However, respiratory failure, hepatic failure, and renal failure gradually occurred. The patient died at the age of 73 days.

convulsions, hepatosplenomegaly, ichthyosis, premature neonate, thrombocytopenia

PMC2627819_01

Female

A 32-year-old woman was admitted one year after being diagnosed with lymph node tuberculosis and AIDS. She had received treatment with rifampicin, hydrazine, and pyrazinamide for 6 months, as well as zidovudine and didanosine, which were used irregularly. She presented with a 2-month history of evening fever, progressive dyspnea, cough, hemoptysis, weight loss (4 kg in 2 months), and generalized adenomegaly. At admission, her weight was 53 kg and and her height was 1.70 m. Physical examination showed the patient to be ill-looking, emaciated, pale, acyanotic and afebrile. Her blood pressure was 90/60 mm Hg, her pulse rate was 110 beats per minute, and her respiratory rate was 36 breaths per minute. Cervical, submandibular, and axillary lymphadenopathy were noted. There was crackles in the middle third of the lungs bilaterally. Multiple erythematous macules were observed on the lower limbs. Laboratory tests showed the following: erythrocytes 2,900/mm3, hemoglobin 8.5 g/dL, hematocrit 29.1%, leukocytes 5,570/mm3 (band neutrophils 5%, segmented neutrophils 64%, eosinophils 3%, lymphocytes 10%), platelets 138,000/mm3. On 3 L/min supplemental oxygen performed by nasopharyngeal catheter, the patient's blood pH was 7.40, her arterial oxygen tension (PaO2) was 52.3 mm Hg, arterial carbon dioxide tension (PaCO2) 33.8 mm Hg, and peripheral oxygen saturation (SaO2) 89.3%. Additional laboratory tests revealed blood urea nitrogen at 18 mg/dL, creatinine at 0.5 mg/dL, CD4 at 252 cells/mm3 (18%), and CD8 at 812 cells/mm3 (58%). Ziehl Neelsen's stain for acid-fast bacilli of the sputum was negative. The chest radiograph revealed mild interstitial infiltration predominantly in perihilar regions. High-resolution computed tomography (CT) showed peribronchovascular interstitial thickening, with small parenchymatous nodules and discrete thickening of interlobular septa. There was also a small right pleural effusion (Figures 1, 2 and 3). Skin biopsy of a lesion on the left leg showed KS. Open lung biopsy was performed and showed a bronchial involvement by KS. Staining for fungi and mycobacteria were negative. When results of the biopsy were received, the patient was started on chemotherapy with vincristine 2 mg, doxorubicin 30 mg, and bleomycin 15 mg once daily. The patient responded well to treatment, with improvement in her systemic symptoms and regression of the pulmonary lesions. One year after the end of chemotherapy, the patient is asymptomatic.

PMC6346929_01

Female

A 33-year-old Indian woman had a 10-year history of hyperprolactinaemia treated with cabergoline. She presented with a painless right inguinal lump of 2 months' duration, which was increasing in size but not tender. She felt generally well and reported no fever, night sweats, weight loss or any changes in appetite. Examination was unremarkable apart from a short history of dry eye. The patient denied recent travel or a history of tuberculosis. Ultrasound of the abdomen and pelvis revealed multiple enlarged necrotic-appearing retroperitoneal and right pelvic lymph nodes. A CT of the chest and abdomen confirmed these findings. A biopsy of the right groin mass revealed multiple granulomas composed of epithelioid histiocytes and scattered giant cells with central areas of necrosis (Fig. 1). ZN staining was negative for acid-fast bacilli, Grocott staining was negative for fungi and cytology was also negative. The provisional diagnosis was Kikuchi-Fujimoto disease (KFD). However, in view of the patient's history of dry eye and lymphadenopathy, immunology testing was conducted and was positive for ANA speckled type, anti-RO and anti-LA with a high IgG of 2140 mg/dl and a high ESR of 47. These findings supported a clinical and biochemical diagnosis of primary Sjogren's syndrome. Clinical and laboratory investigations did not suggest any other types of connective tissue disease. The renal profile, liver profile, ferritin, C3 and C4 were all normal. The patient was negative for anti-double strand DNA, ANCA and RNP. Prolactin was high at 1693 mIU/l. HBV and HCV were negative. Our final diagnosis was KFD with primary Sjogren's syndrome.

kikuchi-fujimoto disease, sjögren’s syndrome, necrotizing histiocytic lymphadenitis

PMC7162578_01

Male

A previously healthy 37-year-old male presented with a 2-year history of skin erythema and thickening affecting the limbs and lumbar region, and sparing the skin of the face, hands and feet. He also complained of pain in the lower limbs and joint stiffness in the knees, ankles and wrists, precluding him from working. Furthermore, he reported fatigue and weight loss. These symptoms improved during a previous 3-month cycle of an SCS (prednisolone 60 mg/day), but relapsed after its suspension. Physical examination showed diffuse cutaneous cyanosis and indurated skin, especially in the forearms and legs but sparing the fingers, with a "peau d'orange" appearance involving the proximal areas and a "groove sign" visible on both forearms. Laboratory tests, including for peripheral eosinophils, the erythrocyte sedimentation rate (ESR) and immunological studies (immunoglobulins, antinuclear, antineutrophil cytoplasmic, anticentromere, anti-Scl-70, anti-U1 RNP and anti-RNA polymerase III antibodies), were all within the normal range. Work-up for HIV, hepatotropic viruses and latent tuberculosis was negative. The patient was submitted to thoracic radiography and oesophageal manometry, both of which showed normal results. Solid neoplasms were excluded. He had had a previous full thickness incisional skin biopsy, carried out after the corticosteroid cycle, that showed some characteristics suggesting FE: perivascular inflammatory cell infiltrate involving the fascia and adipose tissue as well as fascia and fibrous septae thickening. Considering the typical clinical presentation and skin biopsy, the diagnosis of FE was made, and the patient was started on an SCS (prednisolone 20 mg/day) and methotrexate (MTX; 12.5 mg/week). He responded favourably but with corticosteroid tapering and then suspension, symptoms relapsed. Hence, the SCS was reintroduced (prednisolone 5 mg/day) and the MTX dose was up-titrated (20 mg/week). However, due to hepatic toxicity and a concomitant insufficient response, MTX was discontinued. The patient was then started on tocilizumab (162 mg/week), with an excellent and sustained clinical response: after 1 year of treatment, the corticosteroid was successfully suspended. At the time of writing, the patient has been under tocilizumab alone for the last 12 months, showing significant and progressive improvement of the skin thickening (especially in the limbs) and absence of skin erythema, cyanosis, limb pain, joint stiffness or fatigue. He recovered his weight loss and is now able to work.

eosinophilic fasciitis, shulman’s disease, tocilizumab

PMC7162578_02

Female

A 61-year-old female, with a history of diabetes mellitus, presented with a 2-year history of skin thickening affecting the lower limbs, inner thighs, lumbar region, abdominal flanks and forearms. She also reported asthenia and arthralgia (tibiotarsal joint). She denied having dysphagia or Raynaud's phenomenon. Physical examination showed indurated skin in the regions previously mentioned, sparing the fingers. These areas were hyperpigmented. She also had a "peau d'orange" appearance involving both legs (Fig. 1) and forearms as well as a "groove sign" visible on both forearms (Fig. 2). Laboratory tests showed peripheral eosinophilia and an elevated ESR. Much like the previous patient, solid neoplasms were excluded, immunological studies were within the normal range and work-up for HIV, hepatotropic viruses and latent tuberculosis was negative. Pulmonary function tests and the thoracic CT scan were all normal. A full thickness skin biopsy showed fibrosis of the dermis, subcutaneous adipose tissue, fascia and muscle, with perivascular lymphocytes and eosinophil infiltration compatible with FE. The diagnosis of FE was made, and the patient was started on an SCS (prednisolone 60 mg/day) and MTX (15 mg/week), resulting in partial improvement of the lesions: lumbar region and forearms. However, due to evidence of corticosteroid adverse effects, such as uncontrolled diabetes and femoral head avascular necrosis, the dose was slowly tapered, while MTX was raised (until it was 20 mg/week). Considering that after 9 months of treatment she only demonstrated a partial response to MTX (20 mg/week), we decided to start the patient on tocilizumab (8 mg/kg). After 2 cycles of tocilizumab she finally started to show leg improvement, regaining mobility and enabling us to suspend MTX. At the time of writing, the patient is under tocilizumab alone and maintains clinical improvement: skin thickening limited to distal lower limbs.

eosinophilic fasciitis, shulman’s disease, tocilizumab

PMC8273899_01

Male

A 7-year-old boy presented with swelling of metacarpals, metatarsals, and phalanges of his hands and feet. He had swelling associated with aching pain since he was one year of age. He was diagnosed with polyarthritis at that time. After one month of treatment, his symptoms were not changed, and he was transferred to VNC Hospital. He was diagnosed with Pediatric Skeletal Dysplasia (at that time, the patient had no signs of pleural and peritoneal effusion). There was no improvement after two months of treatment, and he was treated with traditional medicine. A few days before admission to HPC Hospital, all metacarpals, metatarsals, and phalanges of his hands and feet were swollen and painful. Moreover, he had poor appetite, fatigue, and abdominal distension. He was hospitalized in HPC Hospital. On physical examination, he was thin, and his body weight was 18kg. The pulse rate was 105/min, and the respiratory rate was 30/min. The body temperature was 37.0 C. The infection syndromes were unclear. The patient had anemia manifestations: pale skin and mucosa. Physical examination revealed the visibly enlarged distal interphalangeal (DIP) joint of the left middle finger, the proximal interphalangeal (PIP) joint of the right index finger, and the interphalangeal joint of the left great toe with a firm, fusiform swelling that involved the proximal and middle phalanges, with overlying erythema (See Figure 1). The knuckles of his hand and feet were sore and scaly spots on the skin surface. The patient had atrophy of the forearm muscles, arm muscles, thigh muscles, leg muscles on both sides. The joints were moved within normal limits. Tendon reflex was normal. In addition, the patient had spleno-hepatomegaly, collateral circulation, and ascites. A dull percussion sound was noted in the left lung. History of local trauma, cough, bowel disturbances, and immunosuppression was negative. A provisional diagnosis of polyarthritis was made, and the differential diagnosis was bone cancer. His complete blood count showed moderate anemia (erythrocyte count 3.71x1012/L, hemoglobin of 74g/L), white blood cells count 7.49 x109/L with 52.7% neutrophils, and platelets count 410 x109/L. His erythrocyte sedimentation rate (ESR) was 42 mm/hour, and C -reactive protein (CRP) was 24 mg/L. Liver function tests revealed normal bilirubin and transaminases. Serum electrolytes test showed Na+ 135 mmol/l; K+ 3.4mmol/l; Cl- 103mmol/l; total calcium 2.1 mmol/l; ionized calcium 0.89 mmol/l. The urinalysis test was normal. Abdominal ultrasound showed ascites, hepatomegaly, splenomegaly, and other organs were normal. X-rays of hands and feet showed decreased joint space with periarticular erosions and subluxation, suggesting that the patient might have tuberculous arthritis (See Figure 2). Chest ultrasound revealed left pleural effusion with 3cm-thick fluid along the middle axillary line, the fifth intercostal space, and revealed a little fluid in the pericardium. Chest X-ray showed pleural effusion (See Figure 3). QuantiFERON-TB test was positive. Rivalta test was positive, much higher in protein content (46g/l) On dermatology examination, there were some skin lesions with fibrinous bases and tuberculous gummas. Because of the clinical characteristics lasting for many years and the laboratory investigations, the patient was diagnosed with Spina Ventosa at a later stage. Eventually, he was transferred to NL Hospital. At the NL Hospital, laboratory investigations were as follows: Hands and feet X-rays showed decreased joint space with periarticular erosions and subluxation correlated with the signs of tuberculous arthritis. The chest CT scanner showed pleural effusion. QuantiFERON-TB test was positive (++). The histopathological examination revealed epithelioid granuloma, which indicates tuberculosis. Serum CRP increased to 126 mg/l. Liver and kidney function tests were normal. Abdominal ultrasound showed ascites, hepatomegaly, and splenomegaly. The child was diagnosed with Spina Ventosa and was treated with anti-tuberculosis drugs - RHZE (Rifampicin, Isoniazid, Ethambutol, and Pyrazinamide) for two months. His lesions recovered after six weeks of treatment, Ethambutol was removed, and the rest three drugs continued for four months. After three months of treatment, the patient had fully recovered: no swelling in hands and feet, no pleural effusion, no spleno-hepatomegaly, and no ascites (See Figure 4).

children, osteo-articular tuberculosis, spina ventosa

PMC8517520_01

Female

A female infant was born at 38+ 5/7 weeks gestational age to a 38-year-old mother who had gestational anemia, which was supplemented with oral iron, and gestational diabetes, which was controlled with diet. The mother has a healthy 6-year-old girl but also had a spontaneous abortion and an artificial abortion due to embryo death. The mother's brother had a history of epilepsy and had passed away. The infant's birth weight, head circumference, and length were 2,830 g (10-25th percentile), 33 cm (25-50th percentile), and 48 cm (10-25th percentile), respectively, with a normal Apgar score. However, she had mild blepharoptosis and there was a 3 cm cleft palate from the palate to the uvula. On day of life (DOL) 2, the infant vomited milk twice accompanied by weakness in sucking. A few hours later, she went into convulsions that involved rowing movements of the limbs. Her blood glucose was 0.7 mmol/L and blood gas analysis revealed anion gap metabolic acidosis (24.69 mmol/L). After providing glucose (8 mg/kg/min) and phenobarbital (10 mg/kg) injection treatment, the convulsions did not occur again, but she became somnolent, developed an unexplained abnormal liver function, and an aggravating increase in serum lactate (16.4 mmol/L). The infant was immediately transferred to our tertiary neonatal intensive care unit (NICU) center on DOL 3 for further newborn care. The infant's serum lactate was normal on DOL 4 after giving intravenous fluids and nasogastric feeding. Blood glucose was normal on DOL 6 without intravenous fluids. The problems during hospitalization were poor neonatal sucking, reduced movements, and unexplained elevated liver enzymes (gamma-glutamyltransferase (GGT) 1,373 mmol/L, total bile acids (TBA) 58.2 mumol/L, aspartate aminotransferase (AST) 132 U/L,prothrombin time (PT) 46.1s, albumin 26.57 g/L) with normal stool color and abdominal ultrasound. In addition, magnetic resonance imaging (MRI) showed high signals on T2 and FLAIR, where the lenticular nucleus was swollen on both sides. There were multiple hyperintensity patches on the dorsal side of the brainstem and posterior limb of the internal capsule near the anterior and posterior horns of the right lateral ventricle (Figure 1). Evoked otoacoustic emission test was not passed on both ears. Blood tandem mass spectrometry (MS/MS) showed an increase in tyrosine 227.85 muM (25-225 muM). Urine gas chromatography-mass spectrometry (GC/MS) showed an increase in oxalate 57.78 (0-33), 3-methylglutaconic aciduria 4.35 (0-1), and 3-(4-hydroxyphenyl) lactic acid 1122.49 (0-20). Next-generation sequencing and Sanger sequencing detected two compound heterozygotes of SERAC1 (c.1502-1G>C(likely pathogenic) from the maternal side, c.227-228dupAT(pathogenic) from the paternal side) and a de novo variant of SATB2 (c.1166G>A) (likely pathogenic) (Figure 2). The quality control of WES data analysis and procedure of variant annotation refers to pipeline version 2 of Children's Hospital of Fudan University. We classified the pathogenicity of the identified variants according to the ACMG guideline, the details showed in (Supplementary Table 1).

megdel syndrome, satb2-associated syndrome, follow-up, next-generation sequencing, phenotype

PMC8517520_02

Female

On DOL 17, the infant was discharged from hospital with a nasogastric tube. After symptomatic treatment, the high GGT at admission had dropped to 264 mmol/L and the PT returned to normal (16.2 s). She experienced slow weight gain and increasing TBA, which was unmanageable by drugs after discharge. When she was 3 months old, there was a continuous mild increase in methionine (Met) for 2 months. After providing Met-free formula milk, the level of Met reduced to normal, and her motor development improved. When she was 12 months old, she had a high fever of 39 C. Afterward, her gross and fine motor regressed to the level of 5 months. Now, she is 15 months old with four primary teeth and has completed a cleft palate repair surgery in order to improve her nutritional status. When she was discharged from the hospital in the first time, the GGT were maintained between 430 and 470 mmol/L, the AST were maintained between 62 and 87 U/L and albumin were maintained between 31.4 and 36.9 g/L. In addition, PT (15.1 s) and international normalized ratio (1.31) was slightly elevated at 12 months of age. Only bile acids were continuously increasing. Because she had normal stool color, normal skin color, and normal abdominal ultrasound, we excluded the extrahepatic biliary atresia and choledochal cyst and did not perform liver biopsy. She is susceptible to higher serum lactate after rehabilitation training and hypoglycemia with low ketone under starving conditions (Table 1).

megdel syndrome, satb2-associated syndrome, follow-up, next-generation sequencing, phenotype

PMC10440120_01

Female

A 32-year-old female patient presented with progressive abdominal distension of four months. She had also right upper quadrant abdominal pain, low-grade intermittent fever, and night sweating of the same duration, along with a weight loss of 6 kg over a 4-month period. For these complaints, she visited a nearby hospital, and with the impression of peritoneal tuberculosis, she was started on antituberculosis drugs, but there was no improvement. The patient had no history of oral contraceptive use or recurrent pregnancy loss. The patient tested negative for HIV. The patient had no history of diabetes mellitus, hypertension, alcohol consumption, or cigarette smoking. Upon physical examination, she was well looking, with a blood pressure of 100/75 mmHg, pulse rate of 80 beats per minute, respiratory rate of 18 breaths per minute, and body temperature of 37.1 C. She had pink conjunctivae and non-icteric sclerae. Abdominal examination revealed a grossly distended abdomen that moved with respiration, with positive shifting dullness and fluid thrill. No abdominal tenderness or palpable organomegaly was noted. She had a complete blood count of 4800 cells/microL, hemoglobin of 14.6 g/dL, and platelet count of 227,000 cells/microL. Liver enzyme, serum albumin, and bilirubin levels were within normal ranges. Tests for hepatitis B and C viral markers yielded negative results. Ascitic fluid analysis showed a white blood cell count of 250 cells/microL, protein of 4.1 g/dL, glucose of 106 g/dL, negative gram stain and negative AFB. The serum ascitic albumin level gradient (SAAG) was 1.3. Cytology of the ascitic fluid was significant for lymphocytosis, but no malignant cells were observed. Abdominal ultrasonography revealed a liver size of 16 cm with mild coarse echo texture, an enlarged caudate lobe, nonvisualized hepatic veins, and free fluid collections within the peritoneum. On the abdominal CT scan, the left and middle hepatic veins were not visualized; the right hepatic vein and intrahepatic IVC had luminal narrowing, and there was caudate lobe enlargement (Figures 1 and 2). Upper gastrointestinal endoscopy revealed grade 1 esophageal varices. After the diagnosis of Budd-Chiari syndrome (BCS) was confirmed by abdominal computed tomography (CT), the patient was started on anticoagulation therapy with unfractionated heparin overlapped with warfarin followed by warfarin alone. The patient was also started on diuretics (furosemide with spironolactone) and beta blocker (propranolol 20mg PO BID). During follow-up, she showed marked symptomatic improvement with a decrease in the amount of ascites. However, after 6 months of BCS diagnosis, while on follow-up, she started to develop bilateral knee joint pain with swelling, alopecia, and oral lesions. After these manifestations developed, the patient was further investigated for systemic lupus erythematosus (SLE) and antiphospholipid (APS) and laboratory tests revealed positive antinuclear antibodies (ANA) with titer of 1:320, positive anti-double-stranded DNA (dsDNA) antibodies with level of 40 IU/mL (reference range: <30 IU/mL), and positive antiphospholipid antibodies (anticardiolipin antibodies and beta 2 glycoprotein 1 antibodies). The patient was finally diagnosed with Budd-Chiari syndrome secondary to SLE associated with APS and was initiated on chloroquine phosphate 250mg PO 5 times per week and steroid (prednisolone), while warfarin, diuretics and propranolol were continued. The patient was counseled on the need of advanced therapies like transjugular intrahepatic portosystemic shunting (TIPS) placement, surgical shunting or liver transplantation if any worsening of the symptoms of BCS despite medical therapies.

budd–chiari syndrome, antiphospholipid syndrome, systemic lupus erythematosus

PMC9730710_01

Male

An 86-year-old man was referred to the emergency department with the chief complaint of difficulty in moving due to fever and general malaise. The patient had a history of pulmonary tuberculosis 40 years previously and smoking. He was taking abiraterone acetate for the treatment of prostate cancer and 5 mg prednisolone daily to prevent adrenal insufficiency. His fever had started 11 days before the visit and gradually worsened with a decrease in appetite and fatigue. The day before admission, the patient was found collapsed and immobile on the floor and was admitted to a hospital. On admission, he was febrile, with a body temperature of 37.8 C, blood pressure of 120/60 mmHg, heart rate of 94 beats/min, and respiratory rate of 24 breaths/min. Although his oxygen saturation was 97% in ambient air, he seemed to breathe with difficulty. Chest computed tomography (CT) on admission showed patchy ground-glass opacities in the bilateral lungs (Figure 1A). Laboratory findings showed normal complete blood count profile but elevated levels of C-reactive protein at 9.91 and ferritin at 513.0 (normal, 50-200) ng/ml. Regarding the coagulation system, D-dimer level was mildly elevated at 1.8 (cut-off <1.0) mug/ml, but other data were within normal limits. The patient tested positive for COVID-19 according to polymerase chain reaction for severe acute respiratory syndrome-coronavirus-2 performed using a nasal swab. The patient received remdesivir (200 mg loading dose on day 1, followed by 100 mg daily for 4 days) and a subcutaneous injection of 5000 units of unfractionated heparin twice daily for prophylaxis of deep vein thrombosis. One week after admission, the patient complained of pain in his right thigh when he changed his position. The attending physician carefully repeated the physical examination and detected psoas muscle signs. The patient's haemoglobin level dropped from 13.8 to 4.5 g/dl. The patient's coagulation system status was as follows: prothrombin time-international normalized ratio was 1.47, activated partial thromboplastin time was 47.4 s, and D-dimer level was slightly elevated at 1.4 ng/ml. Contrast-enhanced abdominal and pelvic CT revealed a massive haematoma (6.0 x 9.5 x 10.5 cm) in the right iliopsoas muscle spreading to the retroperitoneal space (Figure 1B, C). He immediately received 4 units of red blood cell transfusions. Although the radiologist considered interventional radiology to stop the bleeding, the attending physicians decided not to perform endovascular treatment considering the deterioration of respiratory condition due to pulmonary oedema caused by the transfusion. Fortunately, the patient's vital signs were stable, and his haemoglobin level had stopped decreasing. One month later, CT showed that the haematoma had reduced in size. He started rehabilitation with a physiotherapist and was transferred to a rehabilitation hospital 2 months after haematoma onset. Throughout his hospitalization, prophylactic heparin was not readministered after haematoma development.

covid‐19, bleeding, haemorrhagic complication, heparin, iliopsoas haematoma

PMC9618646_01

Male

A 48-year-old man was admitted to our hospital's emergency department with a 2-month history of recurrent abdominal pain and a 2-week history of aggravation. He underwent an exploratory laparotomy for acute diffuse peritonitis 50 days ago at the local hospital. Intraoperative findings revealed that numerous 0.2-0.4 cm yellow-white tubercles were interspersed on the surface of congestive small intestine, colon, appendix, greater omentum and mesenterium, especially the distal ileum (Figure 1a), without apparent perforation. Rapid pathology of appendix and omentum showed acute nonspecific inflammation and intestinal tuberculosis was suspected initially. Therefore large amount of saline and metronidazole was used for irrigation and abdominal drainage was placed. The patient discharged from hospital with intermittent slight abdominal pain on the 15th day after operation. Twenty days later, the patient developed severe abdominal pain suddenly with nausea and vomiting accompanied by fever (39 C). He was admitted to the local hospital again and transferred to our intensive care unit (ICU) for deterioration of his condition. Physical examination showed evident abdominal tenderness and rebound tenderness with weakened bowel sounds. Meanwhile, generalized skin eruptions with an atrophic porcelain-white center surrounded by erythematous rim were visible over trunk and extremities, measuring 0.2-1.2 cm (Figure 1b). No chronic diseases, no alcohol use, no family history, no herbal agents, or no suspected drug use were reported. Relevant laboratory tests and radiographic results were as follows: WBC 8.65*109 (3.5-9.5*109), NEUT% 0.938 (0.40-0.75), procalcitonin 171.45 (0-0.05 ng/ml), HBV-DNA 9.15E+08 (<5.0E+02 IU/ml). Tuberculin test, Widder test, anti SS-A, and SS-B antibodies were negative. ANA was 1:100 weakly positive and Anti Ro-52 antibodies was positive too. Computed tomography showed a small amount of free air bubble, edema and thickening of the small bowel wall and massive seroperitoneum (Figure 1c). An exploratory laparotomy was performed on account of primary diagnosis of Crohn's disease with intestinal perforations. In the operation, we found more than 100 whitish-yellow plaques, dozens of intestinal perforations and purulent materials (Figure 1d). We resected 2 meters of the perforated small bowel and sutured the seromuscular layer in the wafery areas followed by enterostomy and abdominal drainage tube placement. The diagnosis of Crohn's disease was doubtful for the eccentric appearance of the intestine conditions, but there was still no definite diagnosis. On the 5th day after operation, intestinal contents drained again, which signified recurrence of perforation. At this point, we eventually started to pay attention to the correlation between the perforation and skin lesions. Biopsy of skin eruption was conducted and the pathology showed atrophy of epidermis, hyperplasia and collagen of dermal fibrous tissue, degeneration of elastic fibers, significantly reduction and partial necrosis of skin appendages, fibrinoid necrosis in small vessels of the deep dermis and thrombosis in local lumen (Figure 1e). Histopathology of the resected intestine showed edema and hyperaemia, thrombus organization of both tiny artery and veins lumen with acute and chronic inflammatory cell infiltration (Figure 1f). Finally, definite diagnosis of Degos disease was concluded. The patient was given aspirin (100 mg/day) and low-dose subcutaneous heparin (5,000 U/dy), but his body condition went from bad to worse because of the severe abdominal inafection. He requested automatic discharge and died 3 days later.

degos disease, case report, intestinal perforations, malignant atrophic papulosis, skin eruption

PMC6662438_01

Male

A 72-year-old male presented with a history of weakness and constipation, for which he underwent colonoscopy, revealing a submucosal mass in the right colon, compressing on the lumen extrinsically. The mucosa overlying the mass was intact and colonoscopy showed an adjacent 12 mm polyp, which turned out to be a tubular adenoma. He had history of removal of previous tubular adenomas on prior colonoscopies. Computed tomography (CT) imaging showed a 7.0 cm lobulated mass arising from mid-ascending colon with exophytic growth and foci of calcifications. CT findings were consistent with a mesenchymal tumor and carcinoma was less likely. No fatty component was reported (Figure 1). Subsequently, the patient underwent laparoscopic right hemicolectomy and tumor was resected. Gross examination of the right hemicolectomy specimen demonstrated a firm and calcified intramural mass in the posterior wall of ascending colon, extending into the mesocolic fat, without involvement of the mucosa. Microscopically, distinct histological patterns were identified, with the majority of the tumor being composed of a central ossified core surrounded by a minor component of a high-grade mesenchymal nonlipogenic tumor and adipose tissue. The central bone forming component showed areas of osteoid matrix with highly atypical cells resembling a high-grade osteosarcoma as well as areas of more mature appearing woven bone trabeculae with intervening mildly atypical spindle cells similar to a low-grade osteosarcoma (LGOS). A thin rim of a high-grade sarcoma composed of atypical spindled and pleomorphic cells was identified in the periphery of the bony mass. In addition, small foci of mature-appearing adipose tissue containing rare atypical hyperchromatic stromal cells were detected adjacent to the high-grade sarcoma and at the retroperitoneal resection margin, raising consideration of a WDL (Figures 2 and 3). The findings suggested that WDL may have arisen in the retroperitoneum and secondarily involved the colon with a DDL component with heterologous osseous differentiation. On immunohistochemical (IHC) studies, SATB2 was diffusely positive in the atypical cells between bony trabeculae and in high-grade sarcomatous areas without evident bone formation. High and low molecular weight keratin (pancytokeratin), CD117, DOG-1, desmin, SMA, and S-100 stains were negative. Fluorescence in situ hybridization (FISH) revealed high-level amplification of MDM2-gene, supporting the diagnosis of retroperitoneal WDL with DDL showing heterologous osteosarcomatous differentiation and forming a mass involving the ascending colon.

PMC5066297_01

Male

A 41-year-old man working as a chauffeur was presented to his GP with subsequent back pain after rotator cuff injury. Physical examination was unremarkable. In terms of medical history there was no exposure to tuberculosis, he had a 20 pack year history of smoking and there was no relevant surgical history. Although his chest X-ray was normal, the back pain insisted. A MRI of the chest was performed revealing a right paravertebral mass (Fig. 1b). In order to better define the lesion and exclude any other organ involvement, a computed tomography (CT) of thorax and abdomen (with contrast) was performed. The CT confirmed a 3 cm right lower lobe paravertebral soft tissue density mass lesion, invading into the adjacent pleural surface (Fig. 1a). Lymphadenopathy of station 2R and station 4R was noted. An extension across the T5 and T6 vertebral levels with frank destruction of the right T6 costovertebral joint and some enlargement of the right neural foramina were also found. Lungs, pleural spaces, mediastinum, thoracic esophagus and abdomen structures were of normal appearance. In order to specify the histopathology of the lesion, a CT guided biopsy was performed but it was not diagnostic. After multidisciplinary meeting and after written consent was obtained from the patient a right 3 ports VATS biopsy of the mediastinal mass was performed. The postoperative course was unremarkable and the patient was discharged in stable condition on the 3rd postoperative day. With regard to the treatment plan, the patient received initially 60mg of enteric-coated corticosteroids (Prednisolone) that have been gradually tapered after 4 weeks due to patient's steroid-related psychosis. These were replaced with rituximab at a 1 g IV dose every 15 days for a total of two doses. The PET/CT scan performed 3 months later showed that the paravertebral lesion was resolved, with only minimal activity. The visualized part of the musculoskeletal system including the spine showed physiological distribution of fluorodeoxyglucose (FDG). There were no FDG avid lymphadenopathy or other organ involvement. Subsequent histological examination of the specimen was performed. The macroscopic description of the lesion was characterized by multiple fragments of firm dark brown and cream colored nodular tissue measuring 15 x 15 x 3 mm aggregate. It was firmly adhered to the lung and was highly vascularized. With reference to the microscopic description, sections of lung parenchyma and adjacent fibrous tissue showed a dense lymphoplasmacytic infiltration predominantly located in the lung parenchyma (Fig. 2a, b, c). The fibrotic areas adjacent to the lung parenchyma showed a similar but less pronounced lymphoplasmacytic inflammatory infiltration. Within the lung parenchyma there were foci suggested but not diagnostic for obliterative phlebitis (Fig. 2d). The alveolar spaces showed occasional pneumocyte metaplasia with no cytological atypia. Immunohistochemistry performed showed (Fig. 3) that the inflammatory infiltration was predominantly composed of CD138 (Fig. 3a) positive plasma cells along with moderate amount of CD3 positive T-lymphocytes and scattered CD20 positive B-lymphocytes (Fig. 3d). Most plasma cells were noted to express IgG (Fig. 3b) and a large proportion of these plasma cells are also noted to co-express IgG4 (Fig. 3c). The IgG4 positive plasma cells, in areas were noted to amount up to more than 150 cells per high power field and amount up to more than 40% of the total plasma cells present. CK7 and TTF-1 highlight the pulmonary parenchymal architecture which was in areas distorted due to marked inflammatory component (Fig. 3f and g). Serum IgG4 levels were also elevated (3,95 g/l) with overall IgG within range of normality. A diagnosis of IgG4-related lung disease was made considering the lymphoplasmacytic inflammatory infiltrate of the lesion, the laboratory findings and the radiological image.

igg4 lung disease, lung surgery, vertebral invasion

CT scan with contrast revealed a 3 cm right lower lobe paravertebral lesion extending across the T5, and ,T6 vertebral levels, and.

PMC3976663_02

Male

A 13-year-old boy diagnosed with WHO diagnostic criteria of probable NS was referred from Atanga HC III in Pader district where he was enrolled and undergoing care at the nodding syndrome treatment center; he came with a history of progressive swelling and pain in the right lumbar region. The swelling was associated with a high grade fever which was constant and only partially relieved by analgesics. These symptoms were not associated with vomiting, constipation, yellow eyes, loss of appetite or weight loss. The patient reported a history of falling from a tree during one of the nodding episodes in October 2012 and hit his abdomen onto a tree branch. On further probe on his childhood history, his mother reported that he was born normally at home by a Traditional Birth Attendant (TBA) in one of the Internally Displaced peoples (IDP) camps in 2000. She reported that there was an uneventful pregnancy which was carried to term and delivery by Spontaneous vaginal delivery (SVD). She reported that during her pregnancy, she had exclusive feeding on the relief food provided by WFP (beans, yellow posho and cooking oil) during the IDP camps and denies history of ingestion of herbs or medications which caused adverse events during and after the pregnancy. She reported that her child had a normal physical, cognitive and social childhood development before the onset of nodding which began in May 27th 2011 immediately after returning home from IDP camps. The child was enrolled in Atanga treatment centre and was being managed with Carbamazepine, multivitamins and Ivermectin. She reported that in spite of these medications the child continued to have seizures and nodding at least twice a day and had since dropped out of school. On general examination, he was dehydrated, febrile and moderately wasted. There was a right lumbar region mass, tender, indurated and non-fluctuant. The spleen and liver were not palpable. There was no renal or supra-pubic tenderness. The rectum was full of faecal material which was of normal colour and consistency. The anal tone was normal and there was no blood on examining fingure. Haematological investigations were conducted and showed neutrophilia, lympocytosis, monocytosis, and eosinophilia. There were immature granulocytes and atypical lymphocytes seen on the peripheral film report. Other laboratory results including liver function tests (ALT, AST) were elevated while serum protein levels were low; renal functions tests (serum creatinine, blood urea and nitrogen level), and serum electrolytes (K+, Na+, Cl-, HC03-) which were within normal ranges (Figure 1). Abdominal Ultrasound showed inflamed internal and external oblique muscles of the anterior abdominal wall. The patient underwent incision and drainage at Gulu Hospital and wound left open for 14days and thereafter secondary wound closure was conducted. He received supplementary food rehabilitation and his seizure medication was changed to Sodium Valproate 200mg once a day under direct observation therapy (DOTS) and close monitoring of the vital signs. The patient continued to have regular follow up in the surgical ward; seizures and nodding stopped completely from the time of intervention in the hospital. With these interventions for over one month the child had no seizures nor nodding and the child returned to normal life. A subsequent review of the haematological and clinical chemistry findings 2 weeks later showed that renal function tests, serum electrolytes were normal except the liver enzymes level were elevated and were still high (table 1).

nodding syndrome, pyomyositis, uganda

PMC10332771_01

Male

The patient was a 24-year-old Hispanic male with unclear past medical history, possibly significant for seizures, who presented with emergency medical services (EMS) after a described five minutes of tonic-clonic seizure activity which was witnessed by family. Medics reported that the patient had told family about a fall at work the day prior. According to the family, the patient may have had seizures in the past but was not on medication. The seizure resolved prior to EMS arrival, and on initial EMS presentation the patient was confused, oriented only to himself, and only intermittently followed commands. On arrival to the ED, the patient was alert and oriented to person, place, time, and answering questions, but was unclear on the events leading up to presentation. He stated that he fell at work and hit his head without loss of consciousness, and that he had been drinking beer the night prior. He denied any history of seizures and endorsed weekly alcohol use, but no history of withdrawal. His only complaint was of pain in his forehead and generalized weakness. Vital signs were significant for a temperature of 100.3 F, heart rate of 113, respiratory rate of 20, blood pressure of 135/96, and oxygen saturation of 100% on 4 liters nasal cannula. On exam, he was a tired-appearing male in no acute distress, with well-healing abrasions to the chin and forehead. Pupils were equal and reactive with bilateral conjunctival injection on eye exam. Neurological exam was notable for intact strength and sensation with no focal neurological deficits. He was alert and oriented and followed commands. A laceration was noted on the side of the tongue. Lab work was obtained, and the patient was sent for CT of the head and cervical spine. Upon return from CT, the patient had a witnessed seizure lasting one minute which terminated with administration of lorazepam. After the seizure, the patient was extremely agitated, bucking in the stretcher and pulling at his intravenous (IV) access, followed by a period of somnolence with gurgling respirations. He was intubated for airway protection and sedated with propofol. On review of his CT scan following intubation, several small, peripherally calcified lesions were noted by the EM clinicians per radiology; these findings were most consistent with cystic infection of the brain, likely neurocysticercosis. In our patient, two lesions were most notable on CT in the frontal and occipital lobes. The lesion in the left frontal lobe (blue circle) was an approximately 1.5 centimeter (cm) rounded area with rim enhancement and surrounding hypodensity, consistent with vasogenic edema. A similar sized low-density area in the left occipital lobe (red circle) was noted, with increased peripheral density at the 3 o'clock position representing calcification. There were no areas of apparent hemorrhage or midline shift. The final radiology report concluded there were multiple cystic lesions, one with surrounding vasogenic edema in the left frontal lobe. The patient was admitted to the intensive care unit under the care of neurology and infectious disease and treated with 10 milligrams (mg) IV dexamethasone and 4 grams (g) levetiracetam. He was extubated the following day. Twenty-four-hour video electroencephalogram (EEG) demonstrated no additional seizure activity. After he was extubated, the patient provided additional history that he had emigrated from Central America 5 years ago, and that he also had been hospitalized at a different facility for seizures 7 months ago. Records reviewed by the inpatient team revealed a previous diagnosis of neurocysticercosis for which the patient was treated with albendazole, but that he never picked up his outpatient prescription upon discharge. Polymerase chain reaction (PCR) testing was obtained (in lieu of enzyme linked blotting due to its availability), screening for tuberculosis (TB), strongyloides and human immunodeficiency virus (HIV) were negative, and an MRI redemonstrated three cystic lesions with ring enhancement. Infectious disease concluded the patient was likely in the degenerative phase of his disease and recommended treatment with albendazole and praziquantel. The patient continued to improve throughout his hospitalization and was discharged in good condition on levetiracetam to be taken for two years and a ten day steroid taper.

PMC4944370_01

Male

A 17-year-old boy developed right shoulder pain and swelling, which was diagnosed as tuberculosis based on magnetic resonance imaging (MRI), He was then started on anti-tuberculosis treatment (ATT) with no improvement over a 3 month period. He developed right abdominal pain, anorexia, low-grade fever, and weight loss. His past history was one of Bacillus Calmette-Guerin (BCG) vaccine granuloma in the left axilla at the age of nine months, and histopathologically confirmed tuberculosis at the age of 13 years. At that age, he had completed 9 months of ATT with an excellent response. When he came to us for non response to ATT, he had a right shoulder lump, a body mass index (BMI) of 15 kg/m2, and hepatosplenomegaly. There was ascites and persistent low-grade fever. Liver biochemistry was normal except for low albumin (2.1 gm / dL). The serum ascites albumin gradient (SAAG) was 1.8. Review of an MRI of the shoulder showed altered marrow signal of the terminal clavicle and acromian process, with cortical disruption and large soft tissue collection [Figure 1]. Computed tomography (CT) of the abdomen revealed multiple hypodense, necrotic, rim-enhancing abdominal lymph nodes, the largest being 3 cm. His human immunodeficiency virus (HIV) serology test was negative. Upper gastrointestinal (UGI) endoscopy showed gastric varices with portal hypertensive gastropathy (PHG). Fine needle aspiration (FNA) from the right shoulder lump showed the presence of lymphocytes and plasma cells, epithelioid cell granuloma, and many scattered macrophages. The macrophages contained multiple intracellular yeast forms, which were suggestive of Histoplasma capsulatum, and were seen as round-to-ovoid (1-4 mum) structures with a thin, clear zone around them [Figure 2]. Culture for Mycobacteria was negative. His fundoscopy was normal. The nitro blue tetrazolium test was normal and immunoglobulin electrophoresis showed low immunoglobulin A and G, with elevated immunoglobulin E and M. Flow cytometry analysis indicated a low CD3 positive count [Table 1]. Evaluation for other causes of liver disease, such as, chronic viral hepatitis (hepatitis B and hepatitis C), autoimmune liver disease (antinuclear antibody negative, anti-smooth muscle antibody, anti-liver-kidney microsomal antibody), Wilsons disease (S. ceruloplasmin, 24-hour urinary copper), celiac disease (Immunoglobulin A anti-tissue transglutaminase antibody), Budd-Chiari syndrome (color Doppler), and alpha 1 antitrypsin levels, were all negative. A liver biopsy revealed portal fibrosis with a presence of moderate portal tract inflammation : predominantly mononuclear cells. A diagnosis of probable histoplasmosis with common variable immunodeficiency (CVID), with portal hypertension was made, and the patient was initially treated with intravenous amphotericin B for 28 days, followed by oral maintenance therapy with itraconazole, with liver function test monitoring during follow-up. At 12 months of follow-up, he is asymptomatic and all bone and abdominal lesions have disappeared. However, a repeat upper endoscopy still shows varices and portal hypertensive gastropathy. Disseminated histoplasmosis is usually seen in immunocompromised patients. CVID predisposes to opportunistic and recurrent infections and is associated with histoplasmosis. Histoplasmosis is an under-recognized disease in India, very rarely diagnosed in our hospital, and rarely reported from western India. Our patient had portal hypertension and portal hepatitis. Portal hepatitis due to disseminated histoplasmosis has been reported, but we are not aware of any report of portal hypertension due to histoplasmosis. Our patient had also received ATT comprising of isoniazid, which is known to cause fibrosis. Our patient had a lump in the acromion process and clavicle. In a disseminated infection, due to histoplasmosis, it is usually found in the bone marrow or may be associated with hemophagocytosis. Histoplasmosis and tuberculosis have similar clinical manifestations and predisposing factors, and have been reported to be coexistent. Diagnosis of histoplasmosis cannot be made on imaging only and patients may be wrongly treated with ATT, as had occurred in our patient, and also reported from a previous study from India. In our patient, we were unable to perform a culture or molecular diagnosis of the fungus which is a limitation. Thus, Histoplasmosis should be considered in the differential diagnosis of patients with prolonged fever, hepatosplenomegaly, and granulomatous disease on histopathology. When tissue biopsy specimens show granuloma(s), fungal stains should be routinely performed for diagnosis.

PMC10423994_03

Female

When the patient was 72 years old, she was examined for cough and dyspnea. Due to a slightly elevated D-dimer (a fibrin degradation product) level, a chest computed tomography (CT) scan with angiography was performed to exclude pulmonary embolism (PE). A non-specific nodule (7 mm in diameter, possibly a lymph node) was found in the lower lobe of her right lung. At the age of 73 years, the patient was admitted to the Helsinki University Hospital (HUH; Jorvi Hospital, Espoo, Finland) emergency department (ER) after experiencing a couple of weeks of dyspnea, coughing, abdominal discomfort, and difficulties eating normally. Chest x-rays showed pleural fluid on the right side, suggesting pleuritis, empyema, or malignancy. The CT scan revealed pleural fluid resembling empyema, thickening of the mediastinal pleura, and some nodules on the right side of the interlobular pleura (Figure 2A). These results suggested malignancy or tuberculosis (TB), but neither malignant cells, TB, nor other bacteria were found in the pleural fluid samples of the patient. An abdominal CT scan detected a mass (initially suspected to be a pseudotumor; size: 4.7 cm x 6.3 cm x 7.5 cm; Figure 2B) associated with her left THA. A thoracoscopy for pleural biopsies was scheduled. Following a prolonged course of antibiotic treatment, her condition and infection markers improved, and the planned thoracoscopy was canceled based on an oncology consultation.

angiosarcoma, endoprosthesis, pseudotumor, thrombocytopenia, total hip arthroplasty

PMC10423994_04

Female

When the patient was 74 years old, she visited her GP due to swelling of the left lower limb, fatigue, and bruising (Table 1, Timeline Day 0). Her blood cell count showed remarkable anemia [hemoglobin (Hb): 8.8 g/dl] and thrombocytopenia [platelet (PLT) count: 25 x 109/L]. After a consultation with the HUH ER and hematologists, more laboratory tests, a whole-body CT scan, and a bone marrow biopsy were scheduled. The hypothesis of the hematologists included myelodysplastic syndrome (MDS). A week after she visited her GP (before her CT scan and bone marrow biopsy), the patient was admitted to the HUH ER due to pain, worsening edema, and a bruise on her left lower limb. A clinical examination revealed a palpable mass in her abdomen and pain when flexing her left hip. The patient was afebrile and did not have a history of weight loss. She presented with worsening anemia (Hb: 8.0 g/dl), thrombocytopenia (PLT: 17 x 109/L), and elevated infection markers [white blood cells (WBC): 15.0 x 109/L; C-reactive protein (CRP): 39 mg/L]. Her blood electrolytes, sugar level, liver and kidney function, clotting time, vitamin B12, and folic acid tests were normal, but the ferritin level was elevated. Blood and urine samples were collected for bacterial cultures. A thromboembolic event was suspected, and the patient was started on tinzaparin. A body CT (including pulmonary angiography) scan showed small areas of ground-glass opacity, predominantly on the right side of the patient (Figure 2C). PE was not evident but could not be definitely excluded. Her abdominal CT scan showed growth of the suspected pseudotumor (to 6 cm x 7.5 cm x 9 cm, Figure 2D) and fractures of the pubic bone and trochanter major. The spleen appeared normal in size. A day later, a lower-limb ultrasound (US) was performed, which ruled out the presence of DVT. Due to a further decrease in the patient's Hb and PLT levels and the need for RBC and PLT transfusions, treatment with tinzaparin was discontinued. The results of her blood and urine bacterial cultures and Helicobacter tests were negative. MDS, malignancy, or bleeding (e.g., hematoma of the psoas region) was suspected. A bone marrow biopsy was performed, and its preliminary results showed negative for MDS, leukemia, lymphoma, and other malignancies. An abdominal CT scan with angiography was performed again, and no signs of bleeding were found. The radiology report indicated that her suspected pseudotumor was large, but there was no significant change in size compared with the scan taken 3 days earlier. The arthroplasty surgeon from the HUH Arthroplasty Center (HUS Peijas Hospital, Vantaa, Finland) was contacted for consultation. Metal artifact-reducing sequence magnetic resonance imaging (MARS-MRI) was recommended but was not immediately available. A full blood count indicated reticulocytosis (150-310; normal range: 30-108 x 109/L), low RBC fragments (0.8%-1.1%), and elevated WBC with neutrophilia but normal-to-borderline-low lymphocytes. The patient's hemolysis markers (e.g., haptoglobin and bilirubin) and clotting times were normal. Her plasma protein fractions were normal except for borderline-low albumin levels. Lactate dehydrogenase (450-560 U/L; normal range: 155-255 U/L) and D-dimer (30-38 mg/L; normal range: <0.5 mg/ml) were elevated. A Coombs C3d test was positive. An iron panel showed mild iron deficiency and elevated erythropoietin (EPO) levels. Iron was administered intravenously to correct her iron deficiency. Thyroid hormone tests were normal. Paroxysmal nocturnal hemoglobinuria tests were negative. Based on her laboratory results, autoimmune hemolytic anemia (AIHA), cold AIHA, idiopathic thrombocytopenic purpura (ITP), AIHA combined with ITP, and chronic disseminated intravascular coagulation (DIC) were considered possible. A cold hemagglutinin test was negative. Given her possible ITP, the patient received 40 mg of dexamethasone daily for 4 days and IV immunoglobulin (IVIG; 1 mg/kg per day) twice, without a significant response. Because of her poor response to PLT transfusions, hematologists suggested a peripheral mechanism contributing to thrombocytopenia (e.g., bleeding, vasculitis, or another inflammatory reaction). Further tests were performed, which resulted negative for hepatitis, parvovirus, Epstein-Barr virus, and human immunodeficiency virus. Among the blood coagulation factors, factors VIII and IX, as well as the active von Willebrandt factor (vWF) and vWF antigen, were slightly above the normal ranges. However, factor FVXIII was slightly below the normal range. These findings suggest a reactive response to possible bleeding. The results of the final bone marrow biopsy of the patient showed normal cell lines, normal granulopoiesis and erythropoiesis, and no signs of MDS, leukemia, lymphoma, or other malignancies. A gene test for BCR-ABL:which can diagnose certain hematologic malignancies:was negative. Her interleukin 2 receptor levels were not as high as expected in hemophagocytic lymphohistiocytosis. Her antiphospholipid antibodies were negative. MARS-MRI of her left THA and suspected pseudotumor showed significant growth of the mass in multiple locations, namely, the iliopsoas region (7.1 cm x 6.6 cm x 8.9 cm, Figure 2E), posteromedial to the acetabulum (4.7 cm x 4.8 cm x 8.8 cm, Figure 2F), and near the fractured trochanter major (4.1 cm x 2.1 cm x 6.4 cm, Figure 2G). The blood metal ion levels of the patient were not increased [cobalt (Co) level was below 0.9 microg/L, and Cr level was below 0.6 microg/L]. An arthroplasty surgeon was contacted for consultation. Since her diagnosis remained unclear and the rapid growth of the suspected pseudotumor in association with MoP THA was very unusual, US-guided 1 cm trocar biopsies with histopathological diagnosis, bacterial samples, and a new pelvic CT scan were requested before a possible surgery. In the following 5 weeks after the patient's hospital admission, her condition slowly deteriorated. She suffered from hemoptysis, bleeding from oral mucous membranes and gingiva, and melena. Her oxygen saturation (Sat) values decreased to 88%-92%, and her consciousness became impaired. She had tachycardia [pulse (p.): 100] and minor changes in her electrocardiogram (ECG; T-wave inversion in lead III). A catheter was inserted to treat her urinary retention. Her head CT scan showed white matter degeneration that was normal for her age. A chest CT scan showed a wide, diffuse alveolar hemorrhage, and the related radiology report recommended tests for vasculitis. A pelvic CT scan (Figure 2H) showed wide osteolysis and several fractures around the acetabular components, and the related radiology report suggested osteomyelitis or a THA-associated infection. Tests for vasculitis [e.g., anti-neutrophil cytoplasmic antibody (ANCA) and myeloperoxidase] were negative. Because of her poor response to PLT transfusions, the patient was tested for anti-human leukocyte antigen (HLA) class I antibodies. She developed a strong immune response. HLA-typed platelets were needed, which significantly delayed the trocar biopsies. WBC (23 x 109/L) and CRP (145 mg/L) levels were elevated. Although no infection was evident, treatment with cefuroxime was initiated. US-guided 1 cm trocar biopsies were performed twice. They showed dense connective tissue, some macrophages pigmented with foreign material (likely metal), and necrotic debris, suggesting an inflammatory reaction but neither infection nor malignancy (Supplementary Figure S1). After the trocar biopsies, treatment with cefuroxime was replaced with piperacillin-tazobactam. Later on, daptomycin was added to her treatment regimen. Hematologists were confident about the peripheral mechanism for anemia and thrombocytopenia (i.e., pseudotumor-associated bleeding, vasculitis, or another inflammatory reaction). Excision surgery of the suspected pseudotumor was advised and performed to preserve the patient's life. First, the proximal part of an old anterior scar was incised, and the pelvic part of the suspected pseudotumor was visualized through an iliac window following the medial surface of the ilium. The suspected pseudotumor, along with its capsule, was detached from its margins, requiring it to be opened for safe removal. The femoral nerve and pelvic vessels remained intact. Then, another incision was made to an old posterior scar at the trochanter major. As had been suspected, based on preoperative imaging, the visualized trochanter major was previously fractured. After the capsule was opened and the joint was dislocated, the femoral head part of the endoprosthesis was removed. The femur was lifted anteriorly, and the posterior part of the suspected pseudotumor was detached and removed. Through an anterosuperior opening at the acetabular cup, anteromedial to the ilium, all the remaining suspected parts of the pseudotumor were detached and removed. The acetabular part of the endoprosthesis was found to have partly loosened and was removed, along with the cement and mesh between the bone and cement, without significant bone loss. Surgical drapes were soaked in saline with epinephrin and used for hemostasis of the acetabular region. Then, the remaining femoral part of the endoprosthesis was visualized and removed without fractures. The patient was left with a Girdlestone situation. After additional hemostasis of the acetabular region with TachoSil Fibrin Sealant patches, hydrogen peroxide lavage was administered, a surgical drain was placed, and the wounds were closed in layers. After collecting bacterial, TB, and fungus samples, all excised tissues were sent for a pathological examination. Macroscopically, the tumor resembled a typical granulation-tissue pseudotumor with no signs of bleeding. The surgical blood loss of the patient was estimated at 1.9 L. While under general anesthesia, she needed a high-dose infusion of norepinephrine for severe hypotension. Pulmonary bleeding was evident during her intubation. The patient was extubated successfully and transferred back to the intensive care unit. Bleeding from the surgical drain (0.8 L) continued during her first postoperative day but gradually subsided thereafter. The surgical drain was removed on the third postoperative day. Despite the excision of the patient's THA and pseudotumor, as well as RBC and PLT transfusions, her anemia and thrombocytopenia persisted. Immediately after her surgery, her blood lactate levels increased to 9 mmol/L (normal levels: 0.5-2.2 mmol/L) but then normalized within 2 days. Her WBC increased to 45.5 x 109/L and her CRP to 306 mg/L. Despite respiratory support with a high-flow nasal cannula, the patient had objective dyspnea and severe hypoxia due to an alveolar hemorrhage [arterial oxygen tension (PaO2): 7.3-8.5 kPa; fraction of inspired oxygen (FiO2): 0.4-0.7]. She did not tolerate a non-invasive ventilation mask. She became somnolent at first and then agitated. For sedation, a dexmedetomidine infusion was administered. She experienced a paroxysm of atrial fibrillation. A norepinephrine infusion was administered for hypotension, while furosemide was administered for oliguria. The patient developed moderate kidney insufficiency. Treatment with piperacillin-tazobactam was replaced with meropenem, while daptomycin was continued. She was also administered IVIG and anti-D immunoglobulin. The histopathological diagnosis of the surgical pseudotumor revealed highly malignant AS. Because of the very poor prognosis of the condition, intensive care was withheld. After the patient was transferred to palliative care, she died within 24 h of severe hypoxia due to alveolar hemorrhage (68 days after her GP had detected her anemia and thrombocytopenia). The histopathological diagnosis of her autopsy specimen showed an AS with CD31-positive cells in the pseudotumor (Figures 3A,B), lungs (Figures 3C,D), and bone marrow (Figures 3E,F).

angiosarcoma, endoprosthesis, pseudotumor, thrombocytopenia, total hip arthroplasty

(A) A chest CT scan when the patient was 71 years old showed pleural fluid, suggesting empyema. On the right side, the pleura is thickened at the mediastinum and the interlobular septa, suggesting malignancy (arrows).

PMC10423994_04

Female

When the patient was 74 years old, she visited her GP due to swelling of the left lower limb, fatigue, and bruising (Table 1, Timeline Day 0). Her blood cell count showed remarkable anemia [hemoglobin (Hb): 8.8 g/dl] and thrombocytopenia [platelet (PLT) count: 25 x 109/L]. After a consultation with the HUH ER and hematologists, more laboratory tests, a whole-body CT scan, and a bone marrow biopsy were scheduled. The hypothesis of the hematologists included myelodysplastic syndrome (MDS). A week after she visited her GP (before her CT scan and bone marrow biopsy), the patient was admitted to the HUH ER due to pain, worsening edema, and a bruise on her left lower limb. A clinical examination revealed a palpable mass in her abdomen and pain when flexing her left hip. The patient was afebrile and did not have a history of weight loss. She presented with worsening anemia (Hb: 8.0 g/dl), thrombocytopenia (PLT: 17 x 109/L), and elevated infection markers [white blood cells (WBC): 15.0 x 109/L; C-reactive protein (CRP): 39 mg/L]. Her blood electrolytes, sugar level, liver and kidney function, clotting time, vitamin B12, and folic acid tests were normal, but the ferritin level was elevated. Blood and urine samples were collected for bacterial cultures. A thromboembolic event was suspected, and the patient was started on tinzaparin. A body CT (including pulmonary angiography) scan showed small areas of ground-glass opacity, predominantly on the right side of the patient (Figure 2C). PE was not evident but could not be definitely excluded. Her abdominal CT scan showed growth of the suspected pseudotumor (to 6 cm x 7.5 cm x 9 cm, Figure 2D) and fractures of the pubic bone and trochanter major. The spleen appeared normal in size. A day later, a lower-limb ultrasound (US) was performed, which ruled out the presence of DVT. Due to a further decrease in the patient's Hb and PLT levels and the need for RBC and PLT transfusions, treatment with tinzaparin was discontinued. The results of her blood and urine bacterial cultures and Helicobacter tests were negative. MDS, malignancy, or bleeding (e.g., hematoma of the psoas region) was suspected. A bone marrow biopsy was performed, and its preliminary results showed negative for MDS, leukemia, lymphoma, and other malignancies. An abdominal CT scan with angiography was performed again, and no signs of bleeding were found. The radiology report indicated that her suspected pseudotumor was large, but there was no significant change in size compared with the scan taken 3 days earlier. The arthroplasty surgeon from the HUH Arthroplasty Center (HUS Peijas Hospital, Vantaa, Finland) was contacted for consultation. Metal artifact-reducing sequence magnetic resonance imaging (MARS-MRI) was recommended but was not immediately available. A full blood count indicated reticulocytosis (150-310; normal range: 30-108 x 109/L), low RBC fragments (0.8%-1.1%), and elevated WBC with neutrophilia but normal-to-borderline-low lymphocytes. The patient's hemolysis markers (e.g., haptoglobin and bilirubin) and clotting times were normal. Her plasma protein fractions were normal except for borderline-low albumin levels. Lactate dehydrogenase (450-560 U/L; normal range: 155-255 U/L) and D-dimer (30-38 mg/L; normal range: <0.5 mg/ml) were elevated. A Coombs C3d test was positive. An iron panel showed mild iron deficiency and elevated erythropoietin (EPO) levels. Iron was administered intravenously to correct her iron deficiency. Thyroid hormone tests were normal. Paroxysmal nocturnal hemoglobinuria tests were negative. Based on her laboratory results, autoimmune hemolytic anemia (AIHA), cold AIHA, idiopathic thrombocytopenic purpura (ITP), AIHA combined with ITP, and chronic disseminated intravascular coagulation (DIC) were considered possible. A cold hemagglutinin test was negative. Given her possible ITP, the patient received 40 mg of dexamethasone daily for 4 days and IV immunoglobulin (IVIG; 1 mg/kg per day) twice, without a significant response. Because of her poor response to PLT transfusions, hematologists suggested a peripheral mechanism contributing to thrombocytopenia (e.g., bleeding, vasculitis, or another inflammatory reaction). Further tests were performed, which resulted negative for hepatitis, parvovirus, Epstein-Barr virus, and human immunodeficiency virus. Among the blood coagulation factors, factors VIII and IX, as well as the active von Willebrandt factor (vWF) and vWF antigen, were slightly above the normal ranges. However, factor FVXIII was slightly below the normal range. These findings suggest a reactive response to possible bleeding. The results of the final bone marrow biopsy of the patient showed normal cell lines, normal granulopoiesis and erythropoiesis, and no signs of MDS, leukemia, lymphoma, or other malignancies. A gene test for BCR-ABL:which can diagnose certain hematologic malignancies:was negative. Her interleukin 2 receptor levels were not as high as expected in hemophagocytic lymphohistiocytosis. Her antiphospholipid antibodies were negative. MARS-MRI of her left THA and suspected pseudotumor showed significant growth of the mass in multiple locations, namely, the iliopsoas region (7.1 cm x 6.6 cm x 8.9 cm, Figure 2E), posteromedial to the acetabulum (4.7 cm x 4.8 cm x 8.8 cm, Figure 2F), and near the fractured trochanter major (4.1 cm x 2.1 cm x 6.4 cm, Figure 2G). The blood metal ion levels of the patient were not increased [cobalt (Co) level was below 0.9 microg/L, and Cr level was below 0.6 microg/L]. An arthroplasty surgeon was contacted for consultation. Since her diagnosis remained unclear and the rapid growth of the suspected pseudotumor in association with MoP THA was very unusual, US-guided 1 cm trocar biopsies with histopathological diagnosis, bacterial samples, and a new pelvic CT scan were requested before a possible surgery. In the following 5 weeks after the patient's hospital admission, her condition slowly deteriorated. She suffered from hemoptysis, bleeding from oral mucous membranes and gingiva, and melena. Her oxygen saturation (Sat) values decreased to 88%-92%, and her consciousness became impaired. She had tachycardia [pulse (p.): 100] and minor changes in her electrocardiogram (ECG; T-wave inversion in lead III). A catheter was inserted to treat her urinary retention. Her head CT scan showed white matter degeneration that was normal for her age. A chest CT scan showed a wide, diffuse alveolar hemorrhage, and the related radiology report recommended tests for vasculitis. A pelvic CT scan (Figure 2H) showed wide osteolysis and several fractures around the acetabular components, and the related radiology report suggested osteomyelitis or a THA-associated infection. Tests for vasculitis [e.g., anti-neutrophil cytoplasmic antibody (ANCA) and myeloperoxidase] were negative. Because of her poor response to PLT transfusions, the patient was tested for anti-human leukocyte antigen (HLA) class I antibodies. She developed a strong immune response. HLA-typed platelets were needed, which significantly delayed the trocar biopsies. WBC (23 x 109/L) and CRP (145 mg/L) levels were elevated. Although no infection was evident, treatment with cefuroxime was initiated. US-guided 1 cm trocar biopsies were performed twice. They showed dense connective tissue, some macrophages pigmented with foreign material (likely metal), and necrotic debris, suggesting an inflammatory reaction but neither infection nor malignancy (Supplementary Figure S1). After the trocar biopsies, treatment with cefuroxime was replaced with piperacillin-tazobactam. Later on, daptomycin was added to her treatment regimen. Hematologists were confident about the peripheral mechanism for anemia and thrombocytopenia (i.e., pseudotumor-associated bleeding, vasculitis, or another inflammatory reaction). Excision surgery of the suspected pseudotumor was advised and performed to preserve the patient's life. First, the proximal part of an old anterior scar was incised, and the pelvic part of the suspected pseudotumor was visualized through an iliac window following the medial surface of the ilium. The suspected pseudotumor, along with its capsule, was detached from its margins, requiring it to be opened for safe removal. The femoral nerve and pelvic vessels remained intact. Then, another incision was made to an old posterior scar at the trochanter major. As had been suspected, based on preoperative imaging, the visualized trochanter major was previously fractured. After the capsule was opened and the joint was dislocated, the femoral head part of the endoprosthesis was removed. The femur was lifted anteriorly, and the posterior part of the suspected pseudotumor was detached and removed. Through an anterosuperior opening at the acetabular cup, anteromedial to the ilium, all the remaining suspected parts of the pseudotumor were detached and removed. The acetabular part of the endoprosthesis was found to have partly loosened and was removed, along with the cement and mesh between the bone and cement, without significant bone loss. Surgical drapes were soaked in saline with epinephrin and used for hemostasis of the acetabular region. Then, the remaining femoral part of the endoprosthesis was visualized and removed without fractures. The patient was left with a Girdlestone situation. After additional hemostasis of the acetabular region with TachoSil Fibrin Sealant patches, hydrogen peroxide lavage was administered, a surgical drain was placed, and the wounds were closed in layers. After collecting bacterial, TB, and fungus samples, all excised tissues were sent for a pathological examination. Macroscopically, the tumor resembled a typical granulation-tissue pseudotumor with no signs of bleeding. The surgical blood loss of the patient was estimated at 1.9 L. While under general anesthesia, she needed a high-dose infusion of norepinephrine for severe hypotension. Pulmonary bleeding was evident during her intubation. The patient was extubated successfully and transferred back to the intensive care unit. Bleeding from the surgical drain (0.8 L) continued during her first postoperative day but gradually subsided thereafter. The surgical drain was removed on the third postoperative day. Despite the excision of the patient's THA and pseudotumor, as well as RBC and PLT transfusions, her anemia and thrombocytopenia persisted. Immediately after her surgery, her blood lactate levels increased to 9 mmol/L (normal levels: 0.5-2.2 mmol/L) but then normalized within 2 days. Her WBC increased to 45.5 x 109/L and her CRP to 306 mg/L. Despite respiratory support with a high-flow nasal cannula, the patient had objective dyspnea and severe hypoxia due to an alveolar hemorrhage [arterial oxygen tension (PaO2): 7.3-8.5 kPa; fraction of inspired oxygen (FiO2): 0.4-0.7]. She did not tolerate a non-invasive ventilation mask. She became somnolent at first and then agitated. For sedation, a dexmedetomidine infusion was administered. She experienced a paroxysm of atrial fibrillation. A norepinephrine infusion was administered for hypotension, while furosemide was administered for oliguria. The patient developed moderate kidney insufficiency. Treatment with piperacillin-tazobactam was replaced with meropenem, while daptomycin was continued. She was also administered IVIG and anti-D immunoglobulin. The histopathological diagnosis of the surgical pseudotumor revealed highly malignant AS. Because of the very poor prognosis of the condition, intensive care was withheld. After the patient was transferred to palliative care, she died within 24 h of severe hypoxia due to alveolar hemorrhage (68 days after her GP had detected her anemia and thrombocytopenia). The histopathological diagnosis of her autopsy specimen showed an AS with CD31-positive cells in the pseudotumor (Figures 3A,B), lungs (Figures 3C,D), and bone marrow (Figures 3E,F).

angiosarcoma, endoprosthesis, pseudotumor, thrombocytopenia, total hip arthroplasty

When the patient was 74 years old, upon hospital admission, a body CT scan showed ground-glass opacity areas in the lungs (arrow), and.

PMC5021849_01

Female

A 25 years old married female, mother of two children came in the outpatient clinic with complaints of persistent cough for the last 10 years and breathlessness for six years with off and on fever during this period. According to the patient she was well 10 years ago when she started getting bouts of dry cough especially at night so much so that she used to wake up from sleep. Also she started having episodes of fever along with cough which sometimes resolved spontaneously (after variable periods of time) and at other times she took treatment from a doctor for which she had to travel far as she resided in a far flung area of Baluchistan desert in Pakistan with almost no medical facilities. After few years of intractable cough, she as well started noticing breathlessness which was initially on exertion and later on at rest also with exacerbations at the time of fever. She never had hemoptysis but had history of passing gritty particles in sputum. There was no history of orthopnea, paroxysmal nocturnal dyspnoea, body swelling, urinary or gastrointestinal complaint and she was never hospitalized. For ten years, she consulted many general practitioners and consultants and considering her chest Xrays has tuberculosis like radiological appearance, she was prescribed anituberculous therapy thrice, each upto 8-9 months duration. In addition, she has had multiple courses of antibiotics and both oral and inhaled corticosteroids. There was no improvement from any of these drugs. She presented to us with severe exertional dyspnoea for the last 2 weeks. On examination, she was afebrile, tachypnoeac with respiratory rate of 32 breaths per minute with normal blood pressure and pulse. Her Chest examination revealed scattered crepitations all over the chest but otherwise no other abnormality. Rest of her systemic examination was normal. Her blood oxygen saturation while breathing room air was 82% while arterial blood gas analysis showed low pressures of Oxygen. Her laboratory tests showed hemoglobin level of 11.5 gm/dl, TLC of 9500/cmm with 60% neutrophils and 25% lymphocytes and elevated ESR of 30 mm in 1st hour. Liver function tests, serum electrolytes, renal function tests, serum parathyroid hormone and vitamin D were all within normal range. Pulmonary function tests showed moderately restrictive lung disease which was not reversed with bronchodilators Sputum smear for AFB was negative three times and culture showed no growth. Her Chest Xray (Fig. 1A, B and C) showed bilateral diffuse fine nodules predominantly in the middle and lower Zones (Sand Storm Appearance). Her CT Scan Chest images (Fig. 2A, B and C) demonstrated widespread tiny micro calcifications throughout the lungs with septal thickening and ground-glass opacification. Later on, Bronchoscopic alveolar lavage was performed which revealed rehtypical microliths and cytologic smears showed extracellular and intracellular concentrically round microliths confirming the diagnosis of pulmonary alveolar microlithiasis. She was symptomatically treated by Intravenous Moxifloxacin to cover possible infections and oxygen therapy via nasal cannula at 3 lit/min and later on discharged with advice of long term oxygen therapy at home. Because of her travel logistic difficulties, she is on 4 monthly (May 2015, September 2015, January 2016 and May 2016) follow up and regular till now.

calcospherites, micronodular, pulmonary alveolar microlithiasis

PMC5972286_01

Male

A 62-year-old man was referred to our university hospital for treatment of advanced adenocarcinoma of the lung after disease progression on two lines of EGFR TKI and one line of chemotherapy in September 2015 (Figure 1). Four months prior, in April 2015, he was diagnosed with an adenocarcinoma of the left lung with multiple bone metastases in sternum, ribs, and vertebrae. A biopsy from a metastasis in the left femur showed a mutation in the EGFR gene: c.2573T>G; p.(L858R). He was initially treated with gefitinib. After 2 months, the patient showed progression of bone metastases; the same EGFR mutation was found in a biopsy of a rib metastasis, without additional mutations in other mutational hotspots (e.g., BRAF, KRAS, HER2, KIT, ALK, NRAS, PDGFRA, PIK3CA, and MET). Therefore, at that time, carboplatin and pemetrexed were provided and because of pain, local irradiation of a sternal metastasis was applied. After two cycles of chemotherapy, the patient showed disease progression and was referred to our hospital. Because of lack of new treatment options, this patient was discussed in the Groningen MTB consisting of pulmonary oncologists, pathologists, clinical molecular biologists in pathology, general oncologists, and a structural biologist (). The MTB advised to determine the HER2-copy number status as a possible resistant mechanism for EGFR TKI. Fluorescent in situ hybridization (FISH) on a biopsy of a subcutaneous thoracic metastasis revealed HER2 amplification and treatment with afatinib (dual EGFR and HER2 inhibitor) 30 mg QD was started in October 2015. Evaluation by 18-fluorodeoxyglucose positron emission tomography and computer tomography (18-FDG-PET-CT) showed after 6 weeks a significant partial response with disappearance of the FDG activity of the bone metastases and after 4 months in the left upper lobe a single FDG-positive lesion was left. This lesion was irradiated by means of stereotactic ablative radiotherapy (1x 20 Gy), and afatinib was continued. Treatment with afatinib was well tolerated with minor skin rash; patient showed clinical improvement: he had less pain and more energy. Nine months after start of afatinib, progressive disease was again noticed. Growth of the primary tumor in the left upper lobe, a new ipsilateral pulmonary lesion and multiple new bone metastases including the skull, with ingrowth into the brain, causing paralysis of the right facial nerve (Figure 1). Sequence analysis of a new right-sided rib lesion showed the known L858R EGFR mutation and an additional T790M mutation. Because of the novel T790M, afatinib was discontinued and replaced by osimertinib 80 mg QD. Eight weeks after start of osimertinib a PET-CT showed a response of most lesions except for a growing lesion in the pelvic region and the skull with ingrowth in the brain. Clinically there was, however, temporary improvement of the patient's ability to move his right eyelid and right corner of the mouth, which had been paralyzed due to ingrowth of a skull metastasis into the brain and right facial nerve. A biopsy was performed of a growing FDG-positive lesion in the left pelvic bone that showed adenocarcinoma with the known L858R EGFR mutation, but the previously found T790M mutation was not present in this location (no biopsy of the skull metastasis available). The MTB advised to perform immunohistochemistry on Her2Neu (positive in agreement with HER2 amplification) and to determine MET amplification (negative by FISH). Based on these findings, it was decided to discontinue osimertinib because of the loss of the T790M mutation and to start a combination of paclitaxel 90 mg/m2 on days 1, 8, and 15, and trastuzumab 4 mg/kg on days 1 and 15, in cycles of 4 weeks, because trastuzumab is an HER2 antibody. Radiotherapy 1x 8 Gy was given on the pelvic lesion because of localized pain. 18-FDG-PET-scan after four cycles, paclitaxel and trastuzumab showed again a partial tumor response. No major side effects were observed although symptoms of the paralysis of the right facial nerve did not improve further; it remained stable during the course of therapy. The patient underwent plastic surgery on his right eyelid, which improved the closure of his right eye. Two months after the fourth and last cycle, the patient presented with a subcutaneous metastasis on his forehead. Afatinib 30 mg QD was started, because this treatment worked before, pending results of a new biopsy. The biopsy, however, yielded insufficient material for mutation analysis, and re-biopsy was scheduled. In the meantime, 18-FDG-PET-scan showed multiple FDG-positive bone lesions (partly new lesions), some close to the myelum, and the patient was admitted to the hospital for radiotherapy on cervical and thoracic vertebrae. Afatinib was discontinued. Biopsy of a new lesion in the thoracic wall showed an EGFR-L858R, T790M mutation, and HER2 amplification. There were no other hotspot mutations in EGFR, BRAF, KRAS, ERBB2 (HER2), ALK, PIK3CA, or MET detected. The case was again reviewed by MTB. It was decided to treat the patient with afatinib 30 mg QD as well as osimertinib 80 mg QD at alternating days, to address the T790M mutation as well as the HER2 amplification resistance mechanism. Since the start of this latest treatment regimen, the subcutaneous skull metastasis disappeared, and the patient experienced less pain, regained his energy, and was able to walk outdoors again. The most recent 18-FDG-PET-CT-scan, 4 months after the start of this latest treatment regimen, showed again a partial response of the bone metastases again. Two months later (December 2017) progression of disease was observed, and the performance status deteriorated. Patient insisted to take a new biopsy from a new thoracic wall metastasis. Mutations analysis showed the known EGFR L858R and T790M mutations together with a new mutation in HER2: L755S. However, his condition got worse in short time, and he died in January 2018. An overview of the clinical findings, the mutational status at different time points and the given treatment regimens is provided in Table 1. The incidence of EGFR mutations in advanced stage adenocarcinoma of the lung in Caucasian patients is 10-15 and 40-60% in Asian patients. In the north of the Netherlands, the incidence is 9%. L858R mutation in exon 21 of the EGFR kinase domain is the main hotspot mutation in the EGFR gene and accounts for 35-45% of EGFR mutations. L858R mutation increases the kinase activity of EGFR, leading to hyperactivation of downstream signaling pathways improving cell survival and proliferation. An EGFR TKI is the preferred first-line treatment in patients with activating EGFR mutation in non-small-cell lung carcinoma (NSCLC). Gefitinib and erlotinib are first-generation TKI and registered as first-line treatment in patients with metastatic NSCLC with a tumor harboring an activating EGFR mutation within the European Union and according to the Dutch guideline for treatment of NSCLC. These small molecules bind competitively and reversibly to the adenosine triphosphate (ATP) binding site of the tyrosine kinase domain of EGFR. This prevents the autophosphorylation of the TK, blocks the activation of the EGFR signal transduction, inhibits tumor cell proliferation, and induces cell cycle arrest and apoptosis. The majority of patients will progress after 9-12 months of treatment due to various mechanisms of intrinsic or acquired resistance to first-generation EGFR TKIs. The most common mechanism of acquired TKI resistance is the acquisition of a single recurrent missense mutation within exon 20, the T790M mutation. This mutation leads to the substitution of threonine by methionine at position 790, which encodes part of the kinase domain of the receptor and results in increased affinity for ATP. The T790M mutation can be detected in about 60% of tissue biopsy samples taken after acquired resistance. As residue threonine at position 790 (T790) is located at the entrance in the back of the ATP binding cleft, substitution of residue threonine at position 790 with a bulky methionine (resulting in T790M) may cause steric interference with binding of TKIs. Irreversible inhibitors overcome this resistance simply through covalent binding. Osimertinib is registered for the treatment of NSCLC with an EGFR T790M mutation. It is a selective third-generation TKI which targets the ATP binding site of EGFR via irreversible covalent bond formation. In contrast to many other TKI, osimertinib penetrates the blood-brain barrier. Osimertinib improves overall survival and progression-free survival in T790M-positive NSCLC patients with and without brain metastases. Acquired resistance to osimertinib may be caused by primary coexistence of tumor cell populations with and without T790M mutation due to EGFR C797S mutation. Tumor progression can be explained by growth of the T790M negative population, while the tumor cells expressing T790M mutation are effectively suppressed by osimertinib. Overexpression of HER2 induces cell transformation and tumorigenic growth and is clinically associated with resistance to erlotinib. HER2 amplification is detected in a subset of EGFR TKI resistant lung tumors. HER2 amplification and T790M mutation are thought to be mutually exclusive. However, in our patient HER2 amplification as well as T790M mutation appeared in the same biopsy of a new lesion in the thorax wall. Afatinib is an ATP-competitive aniline-quinazoline derivate which covalently binds to EGFR, HER2, and HER4 and irreversibly inhibits HER-family phosphorylation and signal transduction. As second generation TKI it is highly potent, irreversible dual EGFR/HER2 tyrosine kinase inhibitor, including the oncogenic EGFR-L858R mutation. Afatinib is registered for advanced NSCLC with EGFR mutations. Clinical benefit of afatinib seems less in patients with de novo T790M mutations. Although afatinib is equally potent against wild-type EGFR and EGFR harboring the T790M mutation, in patients the dose is lower due to toxicity constraints. Trastuzumab, a humanized monoclonal antibody against HER2, has been reported to be effective in HER2-positive NSCLC in vitro and in case reports.

egfr, her2, molecular tumor board, tki, brain metastasis, non-small-cell lung carcinoma

PMC8113761_01

Male

Five-year-old boy with no relevant family background but with personal history of epilepsy, severe psychomotor retardation, microcephaly, micrognathia, hypertelorism, low-set ears, epicanthal folds, and macroglossia ( Figure 1A ). Admitted in the context of prolonged fever and generalized lymphadenopathies (cervical, abdominal, and mediastinal). He had no other complaints. An extensive investigation was performed and an elevated EBV viral load (50,000 copies/ml) despite a negative EBV serology was found. Prior to receiving any immunosuppressive treatment, immunologic evaluation was performed and revealed normal serum levels of IgG, IgA and IgM, normal responses to diphteria and tetanus and a severe T and NK-cell lymphopenia, as well as B-cell lymphopenia, particularly low post-germinal class-switched memory B cells ( Table 1 ). An excisional biopsy of a lymphadenopathy was suggestive of non-malignant polymorphic EBV (EBER+) T-cell lymphoproliferative disease. This lymphoproliferation was accompanied by infiltration of the digestive tract and he developed severe upper and lower digestive bleeding with two episodes of hemorrhagic shock, needing multiple blood transfusions. A gastric ulcer biopsy confirmed a polymorphic T infiltrate (EBER+) ( Figure 1B ) and rearrangements of T cell receptors and flow cytometry excluded monoclonality. Based on the presence of EBV-LPD in a patient with personal history of microcephaly and psychomotor retardation a presumptive diagnosis of primary immunodeficiency with inability to control EBV was made. He was treated with rituximab for B lymphocyte depletion with resolution of fever and of the gastrointestinal bleeding, which were accompanied by marked decrease in the EBV viral load (viral load 50,000> 1015 copies/mL ( Figure 1D ). Hematopoietic stem cell transplantation (HSCT) was not proposed due to the personal history of severe psychomotor retardation. Based on the pathologic findings of EBV+ T-cell LPD, and despite the absence of documented T-cell infection in the peripheral blood, cyclophosphamide was added to rituximab when the patient eventually presented a disease relapse, with fever, increasing viral load and generalized lymphadenopathies. This led to a dramatic clinical improvement and a decrease in viral load to 20 copies/ml ( Figure 1D ). Unfortunately, in the following months, the patient had several infectious episodes (namely central line related sepsis), leading to intermittent discontinuation of the immunosuppressive treatment and subsequent relapse of the disease with massive lymphoproliferation ( Figure 1C ) and increasing viral loads, eventually leading to his death. A next-generation sequencing panel of EBV-susceptibility related genes ( Table S1 ) led to the identification of a novel c.301G>A (p.(Ala101Thr)) homozygous ZBTB24 (NM_014797.2) mutation. This residue is highly conserved and there is a physicochemical difference between alanine and threonine ( Table S2 ). This is a very rare variant and no homozygotes have been reported (total allele frequency of around 0.017%, 48 heterozygous; 0 homozygous). Most bioinformatics analysis predicted that the patient's mutation Ala101Thr was damaging (e.g., SIFT = deleterious; MutationTaster = disease causing), with a CADD score of 17,49. This led to the diagnosis of immunodeficiency, centromeric region instability and facial anomalies syndrome (ICF) type 2. Both parents were found to harbor a heterozygotic mutation which allowed family counseling. Unfortunately, the patient died before karyotyping could be performed. We performed post-mortem Southern blot analysis for SAT2/Alpha-Satellite repeat methylation but did not find the characteristic ICF-associated repeat DNA hypomethylation. This is probably explained by the unusual nature of the mutation: a homozygous missense variant in the BTB domain.

ebv, icf-2, primary immune deficiencies, case report, lymphoproliferation

PMC5435899_01

Male

A 59-year-old man was admitted because of anorexia and massive ascites. He had received peritoneal dialysis for chronic renal failure for 4 years, undergone cadaveric kidney transplantation 18 years earlier, and had been withdrawn from peritoneal dialysis. He had received immunosuppressive agents, such as tacrolimus, azathioprine, and prednisolone. The transplanted kidney was functioning well. For about 10 years after kidney transplantation, the general condition, including renal function, was stable, but the renal function gradually worsened over a period of 3 years before admission. On admission, the serum creatinine level was high, at 8.2 mg/dL. There were massive ascites, and a mass of 10 cm in diameter was observed in the abdominal wall. The abdomen was distended. He vomited repeatedly and was unable to eat. He was diagnosed with paralytic ileus, intubated with a nasogastric tube, and allowed to eat nothing by mouth. A central venous catheter was inserted, and a high-calorie infusion was administered for systemic management of the condition. The ascitic fluid was found to be transudative, its culture was negative for bacteria, and its cytology was negative for malignant cells. Blood tumor markers were measured: CEA was slightly elevated to 12.6 ng/mL (normal, <=5.0 ng/mL), and CA19-9 was 34.2 U/mL (normal, <=37.0 U/mL). Abdominal CT showed massive ascites and a cystic mass in the abdominal wall behind the navel (Figure 1). The cystic mass had a slightly inhomogeneous density and did not communicate with the peritoneal cavity. Contrast-enhanced abdominal CT, performed to determine the underlying cause of the ileus, revealed multiple small-bowel strictures probably due to adhesions and compression. Due to the development of uremic symptoms, an internal shunt was constructed, and hemodialysis was started on the 21st hospital day. Hemodialysis induced a decrease in the ascitic fluid volume but did not diminish the size of the abdominal wall mass (Figure 2). On the 52nd hospital day, hemodialysis was stable, and the patient recovered to the extent that he could eat; therefore, he was discharged. He was scheduled for elective resection of the abdominal wall cystic mass. After hospital discharge, he received maintenance dialysis three times weekly, and his course on hemodialysis was uneventful. Three months after discharge, he visited the emergency room because of chest pain. He was in cardiopulmonary arrest on arrival, and resuscitation maneuvers were performed. His heartbeat was temporarily restored; however, 3 days later, he developed cardiopulmonary arrest again and was confirmed dead. An autopsy was performed.

PMC4706396_01

Female

In June 2014, a 36-year-old female was admitted to the Central University Hospital of Asturias, after 72 h of diffuse abdominal pain and fever. She reported a dry cough, night sweats, diarrhea, asthenia, hyporexia, and an 8-kg weight loss accompanied by swelling and pain in both wrists, knees, and elbows that limited her mobility during the day for the past 3 months. She had no known toxic habits. The patient was diagnosed with Crohn's disease in May 2014. Since the diagnosis, she had been on proton pump inhibitors and a prednisone treatment without clinical improvement. She had no past surgical or medical history of interest. The physical examination was normal, except for the pulmonary auscultation. Crackles were found in the right upper lobe. A chest X-ray showed bilateral interstitial and alveolar infiltrates that were distributed predominantly in the right lung parenchyma with cavitations in the right upper lobe (Fig. 1A). It is important to mention that a chest X-ray was not performed in May when the patient was diagnosed with Crohn's disease, therefore we were not able to ascertain if the chest infiltrates were present before starting treatment with corticosteroids. Computed tomography of her chest showed bilateral pseudonodular infiltrates that were located predominantly in the right lung (Fig. 1B). Her laboratory tests (complete blood count, biochemical, and basic coagulation) were within normal ranges, except for her C-reactive protein (CRP) levels, which were 14 mg/L. Bronchoscopy showed a 90% stenosis of the segmental bronchi of the right upper lobe (Fig. 2A). The bacilloscopy, PCR, and culture from the bronchoaspirate (BAS) identified M. tuberculosis. The isolate was sensitive to all tuberculostatic drugs. The patient was treated with oral rifampicin, isoniazid, ethambutol, pyrazinamide, and corticosteroids, all of which were well tolerated. Gastroenterologists re-evaluated the patient during admission and noted important granulomatous inflammation with granulomas localized in the submucosa and adipose serous tissue. Mycobacterium tuberculosis grew from a biopsy culture, and the Crohn's disease diagnosis was modified. An intestinal tuberculosis diagnosis was finally confirmed. One week after the patient was discharged, she was admitted again with a diagnosis of peritonitis because of jejunal perforation secondary to intestinal tuberculosis. A jejunal resection and anastomosis were performed without complications. The patient was discharged, and her biopsies again confirmed M. tuberculosis growth. The patient was referred to the Rheumatology department because of migratory arthralgia in her elbows, wrists, and knee joints, particularly in the left knee joint, without definitive associated synovitis. The patient reported clinical improvement immediately after the tuberculosis treatment, which had been initiated 2 weeks previously. A clinical examination revealed monoarthritis of the left knee joint. A full blood count, liver function tests, and plasma urate levels, in addition to the erythrocyte sedimentation rate and C-reactive protein levels, were normal. The patient was negative for rheumatoid factor against cyclic citrullinated peptide antibodies (ACPA), antinuclear antibodies (ANA), antineutrophil cytoplasmic antibodies (ANCA), and antistreptolysin O antibodies (ASO). Her serum levels of angiotensin-converting enzyme and calcium were normal. The microscopy of synovial fluid aspirated from the left knee joint revealed 0.1 x 109 leukocytes/L (normal range <0.2 x 109/L) with a predominance of lymphocytes and no crystals. The synovial biopsy revealed a mild chronic inflammatory cell infiltrate, but no histological feature characteristics of tuberculosis were present. The results from the synovial fluid, tissue cultures, and acid-fast bacilli (AFB) smears for the presence of M. tuberculosis were all negative. The patient was then diagnosed with Poncet's disease. She continued treatment with rifampicin, isoniazid, pyrazinamide, and ethambutol. Within a month of initiating this therapy, the joint pains had completely resolved. A control chest X-ray that was performed in December 2014 showed a loss of volume in the right lung. The previously observed infiltrate and cavitation in the right upper lobe had significantly improved (Fig. 2B). The patient was well at the 4-month and 6-month follow-up visits.

bacilloscopy, poncet's disease, intestinal tuberculosis, joint, pulmonary

(B) The CT showed a loss of volume in the right lung and bilateral pseudonodular infiltrates predominantly localized in the right lung.

PMC6837775_01

Male

A 55-year-old man presented to the Accident and Emergency Department with a 2-month history of dyspnoea (acutely worsening over 2 days preceding admission), cough productive of purulent sputum, fever and weight loss. He was known to be HIV-positive (genotype-2, diagnosed 1991) but had been non-compliant with antiretroviral medication (Truvada, Darunavir and Ritonavir) for 2 years. Additional background included a history of depression, subdural haematoma, recurrent bacterial chest infections and drug abuse (daily heroin smoker). On examination, he was unkempt, cachectic and dehydrated. He was septic but maintaining normal oxygen saturations on room air. Cardiovascular and neurological examinations were unremarkable. He was tachypnoeic and crepitations were auscultated at the right lung base. His abdomen was non-tender with palpable hepatosplenomegaly. Right-sided anterior cervical and right-sided inguinal lymphadenopathy was palpated. Blood tests revealed microcytic iron-deficient anaemia, lymphopaenia with white cell count 2.6 x 109/L, C-reactive protein 198 mg/L, normal electrolytes and renal function, raised alkaline phosphatase level (1664 iU/L), hypoalbuminaemia (22 g/L) and deranged clotting. Lactate dehydrogenase was raised at 515 iU/L. Serology demonstrated serum Epstein-Barr Virus (EBV) DNA PCR of 26 900 and positive Hepatitis B core-antigen (e-Antigen negative). HIV-2 viral load was 720 and CD4 count was 28 cells/muL (3%). A chest radiograph demonstrated right basal opacification. Computerised tomography of the chest abdomen and pelvis (CT-CAP) revealed patchy air space opacification at the left oblique fissure, left lower and right lower lobes, paraseptal and central lobular emphysema and bibasal atelectasis (Figures 1 and 2). Hepatosplenomegaly was confirmed and free fluid was evident throughout the abdomen and pelvis (Figure 3). Multiple enlarged lymph nodes (up to 1.8 cm diameter) were visualised throughout the thorax, abdomen and pelvis (Figures 4 and 5). Sputum cultures identified Pseudomonas aeruginosa; acid alcohol fast bacilli (AAFB) smears were negative. Tests for respiratory viruses, atypical organisms and Pneumocystis jirovecii were negative. Urine and blood cultures were negative, with no growth on mycobacterial blood cultures up to that point. Optimised antiretroviral therapy was restarted alongside intravenous piperacillin and tazobactam. On multi-disciplinary team meeting, the clinical case was deemed to be in keeping with a diagnosis of respiratory tuberculosis. Alternative differentials included atypical lower respiratory tract infection (including MAC infection) or lymphoma. The patient subsequently underwent supraclavicular lymph node biopsy, which revealed classical HL. A positron emission tomography CT (PET-CT) scan diagnosed 'Stage 3B' but suggested that some lymphadenopathy may have been secondary to concurrent HIV-related lymphadenopathy or infection. A staging CT head excluded cerebral metastases. He was consequently initiated on a regimen of Adriamycin, Bleomycin, Vinblastine and Dacarbazine (ABVD) chemotherapy. Notably, one sputum culture subsequently grew Mycobacterium intracellulare; following this, another sputum culture grew Mycobacterium mucogenicum. Neither organism was grown on subsequent sputum samples. Neither of two mycobacterial blood cultures nor a lymph node mycobacterial culture showed any growth on final reporting. At least two sputum cultures positive for the same organism or one positive culture from a 'sterile' site (such as blood, lymph nodes or bone marrow) are required to diagnose atypical mycobacterial infection. The positive sputum cultures were therefore not considered significant.

Axial computerised tomography of the chest demonstrating tree in bud appearances within the lung.

PMC6837775_01

Male

A 55-year-old man presented to the Accident and Emergency Department with a 2-month history of dyspnoea (acutely worsening over 2 days preceding admission), cough productive of purulent sputum, fever and weight loss. He was known to be HIV-positive (genotype-2, diagnosed 1991) but had been non-compliant with antiretroviral medication (Truvada, Darunavir and Ritonavir) for 2 years. Additional background included a history of depression, subdural haematoma, recurrent bacterial chest infections and drug abuse (daily heroin smoker). On examination, he was unkempt, cachectic and dehydrated. He was septic but maintaining normal oxygen saturations on room air. Cardiovascular and neurological examinations were unremarkable. He was tachypnoeic and crepitations were auscultated at the right lung base. His abdomen was non-tender with palpable hepatosplenomegaly. Right-sided anterior cervical and right-sided inguinal lymphadenopathy was palpated. Blood tests revealed microcytic iron-deficient anaemia, lymphopaenia with white cell count 2.6 x 109/L, C-reactive protein 198 mg/L, normal electrolytes and renal function, raised alkaline phosphatase level (1664 iU/L), hypoalbuminaemia (22 g/L) and deranged clotting. Lactate dehydrogenase was raised at 515 iU/L. Serology demonstrated serum Epstein-Barr Virus (EBV) DNA PCR of 26 900 and positive Hepatitis B core-antigen (e-Antigen negative). HIV-2 viral load was 720 and CD4 count was 28 cells/muL (3%). A chest radiograph demonstrated right basal opacification. Computerised tomography of the chest abdomen and pelvis (CT-CAP) revealed patchy air space opacification at the left oblique fissure, left lower and right lower lobes, paraseptal and central lobular emphysema and bibasal atelectasis (Figures 1 and 2). Hepatosplenomegaly was confirmed and free fluid was evident throughout the abdomen and pelvis (Figure 3). Multiple enlarged lymph nodes (up to 1.8 cm diameter) were visualised throughout the thorax, abdomen and pelvis (Figures 4 and 5). Sputum cultures identified Pseudomonas aeruginosa; acid alcohol fast bacilli (AAFB) smears were negative. Tests for respiratory viruses, atypical organisms and Pneumocystis jirovecii were negative. Urine and blood cultures were negative, with no growth on mycobacterial blood cultures up to that point. Optimised antiretroviral therapy was restarted alongside intravenous piperacillin and tazobactam. On multi-disciplinary team meeting, the clinical case was deemed to be in keeping with a diagnosis of respiratory tuberculosis. Alternative differentials included atypical lower respiratory tract infection (including MAC infection) or lymphoma. The patient subsequently underwent supraclavicular lymph node biopsy, which revealed classical HL. A positron emission tomography CT (PET-CT) scan diagnosed 'Stage 3B' but suggested that some lymphadenopathy may have been secondary to concurrent HIV-related lymphadenopathy or infection. A staging CT head excluded cerebral metastases. He was consequently initiated on a regimen of Adriamycin, Bleomycin, Vinblastine and Dacarbazine (ABVD) chemotherapy. Notably, one sputum culture subsequently grew Mycobacterium intracellulare; following this, another sputum culture grew Mycobacterium mucogenicum. Neither organism was grown on subsequent sputum samples. Neither of two mycobacterial blood cultures nor a lymph node mycobacterial culture showed any growth on final reporting. At least two sputum cultures positive for the same organism or one positive culture from a 'sterile' site (such as blood, lymph nodes or bone marrow) are required to diagnose atypical mycobacterial infection. The positive sputum cultures were therefore not considered significant.

Axial computerised tomography of the chest demonstrating extensive mediastinal lymph nodes, the blue arrow points to the pre-vascular nodes, the white arrow points to the right hilar node and the red arrow points to the pre-carinal and subcarinal nodes.

PMC9881483_01

Female

A 72-year-old Hispanic female was brought into the emergency department (ED) by her family member for 3 days of worsening confusion, urinary incontinence, and difficulty ambulating after an unwitnessed fall. The patient had initially become altered at home 3 weeks prior to arrival in the ED; however, she was still able to carry out her activities of daily living (ADLs). Over the course of 3 days, the patient had a sudden decline of neurological status, inability to perform ADLs, urinary incontinence, and echolalia, which prompted the family to bring the patient to the ED. The patient was previously diagnosed with breast cancer approximately 4 years prior to presentation, during a screening mammogram. After confirmation of breast cancer, the patient underwent a bilateral mastectomy and axillary lymph node dissection. She was found to have metastatic spread to her lymph nodes. An axillary sentinel lymph node biopsy revealed three out of four axillary lymph nodes positive for metastatic disease with a pathological stage of T2N2M0. Pathology revealed estrogen-positive, progesterone-positive, HER-2 negative invasive lobular carcinoma (Fig. 1) of the left breast and ductal carcinoma in situ of the right breast. She was treated with a regimen of 12 cycles of chemotherapy with paclitaxel, external beam-radiation to her left axilla, and daily anastrozole 1 mg orally for 3 years. In the ED, a computed tomography (CT) of the head revealed mild hydrocephalus with transependymal CSF resorption without intracranial hemorrhage, mass, infarction, or skull fracture. Magnetic resonance imaging (MRI) of the brain revealed enlargement of the lateral and third ventricles and preserved size of cerebral aqueduct and fourth ventricle, T2 hyperintensity consistent with transependymal spread of CSF, confirming obstructive hydrocephalus. An electroencephalogram (EEG) was negative for seizure-like activity. Initial lumbar puncture (LP) revealed CSF with an elevated white blood cell (WBC) count with lymphocytic pleocytosis, normal opening pressure, elevated glucose, and very elevated protein as shown in Table 2. She became febrile to 101 F and encephalopathic, and was started on empiric antibiotics, antivirals, and antifungals. CT imaging was negative for metastatic disease, but revealed bilateral pleural effusions, moderate right basilar consolidations, and intraluminal filling defects in the right pulmonary arteries suggestive of right pulmonary embolism. During her hospital course, she had a rapid deterioration in her neurological status. Eventually she was upgraded to the intensive care unit (ICU) for poor mentation and acute hypercapnic respiratory failure requiring intubation and mechanical ventilation. After ICU upgrade, a CT scan with intravenous contrast revealed a pulmonary embolism (PE). She was ultimately started on a heparin drip to prevent worsening of the PE. On initial presentation, given her immunocompromised state, there was concern for tuberculosis. A quantiferon gold test was positive for tuberculosis; however, acid fast bacilli smears were negative on three separate occasions. CSF studies did not reveal any infectious etiology. Given her breast cancer history, LC remained high on our differential list. However, considerations were made for acute encephalitis secondary to an infectious etiology due to CSF findings of elevated glucose, protein, and WBCs. The patient was started on acyclovir due to suspicion of viral encephalitis. The patient was also on vancomycin and ceftriaxone for a suspected hospital acquired pneumonia. CSF studies were found to be negative for herpes simplex virus (HSV), varicella zoster virus (VZV), and coccidioidomycosis (antibodies were < 1:2). Repeat CT of head showed interval improvement of the mild hydrocephalus, and MRI (Fig. 2) of the cervical and thoracic spine did not demonstrate any metastatic lesions. A CA 27-29 level was checked, which was found to be negative. Throughout the patient's hospital course, there was noted improvement in mentation, which was noticeable especially after 26 mL of CSF was obtained after a lumbar drain was placed. This was seen as the patient had spontaneous opening of her eyes and started to follow minimal commands while in the ICU. Even though she was intubated, she was able to communicate with the medical staff and with her family members by answering to yes or no questions with her eyes. During her ICU stay, there were multiple spontaneous breathing trials attempted with the hopes of possible extubation; however, the patient unfortunately failed on these attempts. CSF studies from lumbar drain revealed small groups of large vacuolated epithelial cells having circular nuclei with distinct nucleoli consistent with metastatic mammary adenocarcinoma (Fig. 3). The oncology department was heavily involved in the patient's hospital course as the decision was made to stop the anastrozole therapy given the progression of disease. The diagnosis of LC was made. After extensive discussions with the family members, the patient's family decided to pursue comfort care given the extent of disease complicated by a PE. The patient was weaned off sedation then transitioned to dexmedetomidine, and then was successfully extubated. Per the family request, the patient was discharged home with family and was followed by hospice care. All therapies were discontinued, and she was successfully extubated with discharge to home hospice. There was no follow-up regarding length of survival after discharge from the hospital.

breast cancer, leptomeningeal carcinomatosis, metastasis

PMC9845550_01

Female

A 48-year-old female patient without any past medical history was referred to our hospital for frequent PVCs. The patient had no history of smoking or excessive alcohol or caffeine intake. Physical examination showed no signs of heart failure. Blood tests showed a slightly elevated brain natriuretic peptide level of 57.1 pg/mL, but no other abnormalities were found. The PVC was monomorphic, and the morphology was right bundle branch block and right inferior axis. Based on the previous report, ALPM was suspected as the origin (Figure 1A). Holter electrocardiogram showed 29,332 beats of monomorphic PVC per day. This is equivalent to 27.0% of the total heartbeats. It occurred more frequently from night to morning, and >3 lasting beats were not confirmed. Echocardiography revealed a 60.4% ejection fraction, no enlargement of chamber size or valvular disease, and relatively thick ALPM chordae tendineae attached to the AML (Figure 1B). Given the lack of structural heart disease, this PVC was diagnosed as idiopathic. Because of the failure in suppressing the PVCs and the worsening of symptoms by oral beta blocker, we performed a catheter ablation. Frequent PVCs were observed throughout the case. The CARTO 3 system (Biosense Webster, Inc, Irvine, CA) was used for 3D mapping, and the right internal jugular vein, right femoral veins, and right femoral artery were punctured under local anesthesia. A decapolar catheter (EPstar; Japan Lifeline Co, Ltd, Tokyo, Japan) was inserted into the coronary sinus, and another decapolar catheter (Scooper; FUKUDA DENSHI Co, Ltd, Tokyo, Japan) was placed into the right ventricle to record both His and right ventricle electrogram. An intracardiac ultrasound catheter (SOUNDSTAR; Biosense Webster, Inc) was used to create an anatomical shell of the LV, the aortic valve, and the papillary muscles at the beginning of the procedure. A trabeculated structure was noted from the ALPM to the AML (Figure 2A). Then, a mapping catheter (PentaRay; Biosense Webster, Inc) was inserted into the LV for the activation mapping of the PVC. Contrary to what we anticipated, the earliest activation was at the AMLAMFC (Figure 2B), where a discrete prepotential preceded the QRS onset of the PVC by 84 ms (Figure 2C). This site coincided with the trabeculated structure noted by the intracardiac ultrasound (Figure 2A). The discrete potential noted during PVC could be observed after the offset of the QRS during sinus rhythm, which suggested the retrograde conduction via the trabeculated structure (Figure 2C). No prepotential was noted around the ALPM, and the 3D mapping showed later activation (Supplemental Video 1). Pace mapping score obtained by the PaSoTM module (Biosense Webster, Inc) was the best at the base of the ALPM; however, the score was low at the AMLAMFC (Figure 2D). Radiofrequency (RF) ablation was first applied using a 3.5 mm irrigation catheter (THERMOCOOL SMARTTOUCHTM SF; Biosense Webster, Inc) at the ALPM where the best pace mapping score was obtained (Figure 2E). However, this failed to suppress the PVCs. Considering the instability of the ablation catheter and the possible intramural origin, RF ablation was performed at the tip of the ALPM. However, this also failed to suppress the PVCs. Given the evidence of the discrete prepotential at the AMLAMFC and the result of pace mapping, we postulated that the origin of this PVC was at the AMLAMFC and the exit was at the ALPM. RF application at the AMLAMFC successfully eliminated the PVC after accelerated PVCs with the same morphology (Figure 2E). No PVC was observed after RF ablation even with isoproterenol infusion.

aortomitral fibrous continuity, catheter ablation, chordae tendineae, papillary muscle, preferential conduction, premature ventricular contraction, purkinje-related arrhythmia

PMC5709382_01

Female

Dr. Robert Seder, from the NIAID Vaccine Research Center, shared results from trials of the PfSPZ vaccine, manufactured by Sanaria Inc. PfSPZ vaccine induces a breadth of responses that includes CD4, CD8, and gamma delta T cells, as well as antibody responses. PfSPZ vaccine also induces antigenic breadth. PfSPZ vaccine efficacy in malaria-naive adults depends on direct venous inoculation to induce tissue resident T cells in the liver, and the dose determines the degree and durability of homologous and heterologous protection. Trials of PfSPZ vaccine in Mali confirm efficacy against naturally transmitted parasites, and studies in other African sites are underway to evaluate its use as a tool for malaria eradication. In Kenya, PfSPZ vaccine is currently being tested in 5-12-month-old infants for safety and efficacy against malaria infection. Other ongoing investigations of PfSPZ vaccine seek to optimize the dose/regimen, incorporate additional vaccine strains, and compare efficacies versus chemoprophylaxis vaccination and genetically attenuated parasite (GAP) vaccines. Dr. Stefan Kappe, the Director of Translational Science at the Center for Infectious Disease Research in Seattle, reported on the development of GAP vaccines. Deletion of the pre-erythrocytic stage-expressed genes SAP1, P52, and P36 arrests parasite growth in hepatocytes at the early liver stage. Vaccination with triple gene knockout P. yoelii parasites conferred sterilizing immunity to mice. Furthermore, sera from human subjects immunized with the P. falciparum triple gene knockout GAP vaccine, when passively transferred into humanized-liver mice, protected against infectious P. falciparum sporozoite challenge, indicating that antibodies contribute to GAP vaccine immunity. This P. falciparum early liver stage-arresting, triple gene knockout GAP vaccine has been shown to be safe in human subjects when delivered by mosquito bite. In partnership with Sanaria, GMP manufacturing of cryovialed P. falciparum GAP vaccine is planned, and will support trials using direct venous inoculation in the USA and Africa. While this first generation GAP vaccine moves through clinical development, it is thought that the optimal GAP vaccine might allow parasite development through late liver stage schizogony with subsequent developmental arrest before formation of infectious exo-erythroctyic merozoites. This type of late liver stage-arresting GAP vaccine candidate has been shown to induce superior protection against sporozoite challenge as well as stage-transcending protection against a rodent malaria blood-stage challenge in mice, both mediated by antibodies and T cells. A P. falciparum late liver stage-arresting GAP vaccine has yet to be generated and is a central focus of GAP vaccine research. Dr. Robert Sauerwein from Radboud University, Netherlands reported progress with chemoprophylaxis vaccination, or CVac. In previous studies, CVac using sporozoites delivered by mosquitoes induced both polyfunctional T cells and antibodies, and conferred long-lasting protection against controlled human malaria infection (CHMI) with homologous parasites. Recently, CVac using cryovialed sporozoites also induced sterilizing immunity in malaria-naive adults against homologous CHMI, even at accelerated vaccine schedules completed within a month. Future studies will explore CVac strategies that may confer long-lasting heterologous protection by incorporating different P. falciparum strains, which will be evaluated for their ability to confer protective efficacy in the field. Dr. Ripley Ballou, the head of the GlaxoSmithKline (GSK) Global Vaccine Center arm, described the arc of development for the subunit malaria vaccine RTS,S that completed phase III trials in recent years. The RTS,S vaccine is composed of the repeat region of the circumsporozoite protein fused to the Hepatitis B virus surface antigen, and is adjuvanted with the proprietary AS01 adjuvant. Dr. Ballou summarized key studies demonstrating vaccine safety and efficacy in adults, children, and young infants in sub-Saharan Africa. In the phase III multicenter efficacy trial that enrolled 15,459 children in 11 centers across seven African countries, RTS,S/AS01 vaccination is estimated to have prevented 829 clinical malaria episodes per 1000 children over 18 months of study follow-up. Future studies will evaluate RTS,S integration into the EPI (expanded program of immunization) schedule. Private-public partnerships will be required to finance large scale phase IV vaccine trials to ensure long term success of future vaccines against malaria. For the pilot implementation studies in Ghana, Kenya, and Malawi, 750,000 children will be randomized to vaccinated and unvaccinated clusters, with four doses of RTS,S/AS01 administered in the vaccine testing group. To open the session, Dr. Carole Long from the NIAID reviewed the obstacles to blood stage vaccine development, including antigenic polymorphism of both merozoite as well as infected erythrocyte surface proteins, redundancy in the merozoite invasion pathways including both sialic acid-dependent and sialic acid-independent pathways, and difficulties expressing conformationally correct proteins. Studies thus far suggest that high antibody concentrations are needed to control merozoite invasion in vivo, and existing assays have failed to predict protection in humans. Trials of merozoite proteins have been disappointing, but ongoing efforts seek to improve the immunogenicity and functional activity of the antigens. New antigens as well as new antigen combinations might give additive or synergistic activity, and hence are a research priority for several groups. Dr. Michael Good from Griffith University (Australia), shared recent findings from studies of chemically attenuated whole blood stage parasite vaccines. The chemical attenuation procedure developed by his laboratory entails incubation of blood stage parasites with a DNA-binding drug (Centanamycin or Tafuramycin-A), after which parasites are washed and resuspended for inoculation into mice. It is thought that these compounds affect parasite replication by irreversibly alkylating parasite DNA in polyA rich regions (reviewed in ref. ). Immunization of mice with chemically attenuated blood-stage parasites, either as a single dose of P. chabaudi or three doses of P. yoelii, has induced homologous and heterologous immunity in a CD4 + T cell-dependent fashion. These vaccines activated peripheral blood CD8+ T cells but did not confer cross-stage protection, and blood-stage protection remained intact after CD8+ T cell depletion. Similar findings in Aotus nancymae monkeys prompted a pilot study in humans to assess safety and immunogenicity of P. falciparum blood-stage parasites chemically attenuated in vitro (reviewed in Stanisic and Good manuscript in preparation). Lysed infected erythrocytes do not induce protective immunity and the requirement for intact infected erythrocytes as an immunogen poses some challenges, such as the risk of induction of anti-erythrocyte antibodies and ethical issues regarding red blood cell products for some individuals. Novel approaches are under investigation in order to develop semi-synthetic blood-stage vaccines as alternative immunogens that can move forward into human studies. Dr. Simon Draper, from Oxford University (UK), described progress using the antigen P. falciparum RH5 to block merozoite invasion of erythrocytes and prevent blood-stage malaria infection. PfRH5 has been identified as the first highly conserved target from the merozoite to be susceptible to vaccine-induced broadly neutralizing antibody. In Aotus monkeys, PfRH5-based vaccines induced antibodies and conferred protection against a virulent heterologous P. falciparum challenge. Protection was associated with anti-PfRH5 antibody concentration and with in vitro parasite-neutralizing activity. More than 60% in vitro growth inhibition activity (GIA) was observed with the purified IgG, and the minimal serum concentration of anti-PfRH5 IgG required to protect an animal was defined as 200 microg/mL. A first generation PfRH5-based vaccine is being tested in clinical trials in Oxford and Tanzania; and studies to improve the vaccine include identification of critical epitopes in PfRH5, incorporation of PfRH5 immunogens into virus like particles, and manufacture of a clinical protein vaccine product in a Drosophila S2 cell line. Dr. Prakash Srinivasan from John Hopkins University (Baltimore, USA), described progress developing AMA1-RON2L complex as another vaccine that targets merozoite invasion. AMA1-only vaccines have failed to protect against homologous CHMI, despite field studies suggesting that AMA1 vaccines conferred activity against homologous parasites. AMA1 forms a complex with RON2 protein at the junction between merozoite and erythrocyte surfaces to initiate invasion, and recent studies have shown that antibody raised against the AMA1-RON2 peptide complex but not AMA1 alone protects against virulent P. yoelii infection in mice. In Aotus monkeys, AMA1-RON2 was superior to AMA1 alone as a vaccine to control blood stage growth of virulent P. falciparum. Compared to AMA1 alone, AMA1-RON2 increases serum GIA measured in vitro without increasing anti-AMA1 titers. The complex may enhance the immunogenicity of some conserved AMA1 epitopes. Preclinical studies are evaluating potential human-use adjuvants in rats as well as multi-allele AMA1-RON2 vaccines in order to induce significantly higher strain-transcending blocking activity. In his opening remarks, Dr. Socrates Herrera from the Institute of Immunology in Cali, Colombia highlighted the increasing number of TBV studies, including discovery of novel antigens. He discussed the logistical, regulatory, and ethical challenges for establishing clinical trial sites in endemic areas, as well as the challenges to measure efficacy and evaluate immune responses against TBVs. Dr. Patrick E. Duffy, chief of the NIAID Laboratory of Malaria Immunology and Vaccinology reminded the attendees of the seminal works of Carter and of Gwadz who showed that human immunity can act against sexual stage parasites in the mosquito, and presented results from clinical trials of two TBV vaccine candidates, Pfs25 (post-fertilization antigen) and Pfs230 (pre-fertilization antigen). To overcome intrinsically poor immunogenicity of the antigens, NIAID scientists conjugated both Pfs25 and Pfs230 to the immunogenic carrier protein ExoProtein (EPA) and administered them with adjuvants. Clinical trials of Pfs25-EPA formulated with Alhydrogel established that the antigen was safe and immunogenic in humans, and can induce functional antibodies that block parasite transmission to mosquitoes in laboratory assays. Furthermore, serum activity correlated with antibody titers. However, four doses were required to induce serum functional activity in most vaccinees, and functional activity was short-lived as anti-Pfs25 antibody levels waned rapidly after each dose. Notably, Pfs25 IgG titers dropped more rapidly than the titers against the carrier protein EPA. Ongoing trials are comparing and combining Pfs25 and Pfs230 vaccine antigens and assessing vaccine activity via standard membrane feeding assays (SMFAs) as well as by feeding mosquitoes directly on vaccinees (i.e., Direct Skin Feeding or DSF Assay). Pfs230 vaccine activity is known to be complement-dependent, and therefore fresh complement is required in the SMFA. In an ongoing trial, both Pfs25 and Pfs230 conjugate vaccines are being administered with AS01 adjuvant from GSK based on preclinical studies that this formulation might significantly increase antibody titer and therefore serum functional activity after vaccination. Dr. Carolina Barillas-Mury, Chief of the Mosquito Immunity and Vector Competence Section from the Laboratory of Malaria and Vector Research at NIAID, reviewed new data that supports Pfs47 as a vaccine candidate. In studies from her group, Pfs47 appears to function as a "lock and key" to define compatibility between P. falciparum parasites and mosquitoes collected from different continents. Pfs47 proteins with compatible sequences allow the parasite to evade the Anopheles gambiae immune system, whereas parasites with incompatible sequences achieve only low infection rates. Pfs47 could have an important role in parasite transmission, and therefore might also be used as a target for intervention, as antibodies to a specific domain induce strong transmission-blocking activity as measured by SMFA. Ongoing studies from her group are investigating naturally acquired anti-Pfs47 antibodies in Malians, and the possibility that the Pvs47 orthologue could be modulating immune evasion in a P. vivax model. Dr. Said Jongo, Head of Bagamoyo Clinical Trials Facility of the Ifakara Health Institute (IHI), Tanzania, highlighted Phase I to III activities at the IHI Clinical Trial facility, which opened in Bagamoyo in 2012 and has established itself as an important site for studies including malaria vaccine trials. IHI involvement in malaria research includes the assessment of safety and efficacy of novel antimalarial drugs and malaria vaccine candidates, the use of these modalities for malaria control and elimination, and the efficient translation of research results into policy improvement and community well-being. His team conducted the first CHMI in the modern era in Africa using PfSPZ injection, and conducted the first trial in Africa to assess the efficacy of PfSPZ-based malaria vaccine candidates using PfSPZ CHMI. This first experience with CHMI in Africa establishes its feasibility and can be a powerful platform for understanding malaria immunity and testing vaccines in the field. One of the key limitations for the success of malaria vaccines is the difficulty in maintaining durable protection after immunization, which in part has been ascribed to poorly immunogenic antigens as well as to the effect of malaria itself in suppressing host responses. Efforts to increase the degree and durability of vaccine protection have included novel adjuvants and platforms as well as altered vaccine schedules, dosages and methods of delivery. However, long-lived protection has not been achieved. The session entitled "Basic Aspects of Vaccinology" brought together researchers interested in the factors that impair the host response to malaria as well as malaria vaccine efficacy. Dr. Susan Pierce, from the NIAID Laboratory of Immunogenentics, emphasized that the immune response to malaria is complex. Despite repeated infections, sterilizing immunity is not achieved, while clinical immunity only develops after repeated infections and later in life. Many residents of malaria-endemic areas are asymptomatically infected. Dr. Eleanor Riley, from the London School of Hygiene & Tropical Medicine, discussed the importance of understanding the immune responses induced by vaccines to aid future vaccine design and refinement. For example, combining data from phase 2 or phase 3 clinical trials with knowledge of the mechanism of action of vaccine-induced antibodies allows calculation of minimum effective antibody concentrations (MEC). Assessing the durability of these antibodies:specifically, the time period that concentrations remain above the MEC:could speed up the evaluation of new vaccine formulations. Worryingly, the MEC for anti-circumsporozite antibodies induced by RTS,S is very high (in the order of 1 mg/ml) and is maintained for only a few months after vaccination, and MECs for other invasion-blocking antibodies (e.g., anti-PfRH5 and anti-PfAMA-1) are of a similar order of magnitude. These data highlight the need to understand how to induce long-lived, high titer antibody responses that are needed to confer protection. Dr. Peter Crompton, head of the Malaria Infection Biology and Immunity section at NIAID Laboratory of Immunogenetics, discussed factors beyond parasite antigenic variation and allelic diversity that may limit vaccine efficacy in endemic areas. Specifically, Plasmodium infections may subvert vaccine-induced immunity. In studies from Mali, malaria exposure is associated with atypical memory B cells that have decreased effector functions, Th1-polarized T follicular helper cells that exhibit impaired B cell help, and moncoytes that have a blunted inflammatory response. His studies support additional research to understand the impact of Plasmodium exposure on the quality of vaccine-induced responses, and to explore targeted interventions that could mitigate malaria-driven immunomodulation during vaccination. Dr. John Harty from University of Iowa presented mechanisms underlying ineffective control of blood-stage Plasmodium infection. Using animal models, his team studied the importance of CD4 T cell responses in inducing protection against Plasmodium. P. yoelii blood-stage infection in mice induces exhaustion of the CD4 T cell response. Consistent with this, in humans, P. falciparum infection induces higher expression of the inhibitory receptor PD-1 associated with T cell dysfunction. Previous studies have not established a consensus on the role of T regulatory cells (Treg) in the host response to Plasmodium infection, possibly due to variations in the parasite species, the animal model, and the model of infection. However, Tregs (Foxp3+ CD4+ T cell) expand in humans during malaria infection, and Tregs can potentially prevent parasite clearance by inducing a transient hiatus in the parasite-specific CD4 T cell responses. In mice, the effector CD4 T cell response to P. yoelii infection is biphasic and the hiatus coincided with Tregs that upregulated CTLA4. Blockade of CTLA-4 during the T cell hiatus leads to memory responses that confer species-transcending immunity to rechallenge. Notably, CTLA4 blockade before or after the CD4 T cell hiatus does not improve the CD4 T cell response or control of parasitemia. In summary, Tregs impede acute and long-term immunity against blood-stage malaria through CTLA4 expression, and this Treg activity manifests in a limited time window during the infection. Dr. Dyann Wirth from the Harvard School of Public Health (Boston, USA) spoke on genotype-specific vaccine efficacy, initially noting that many P. falciparum antigens have extremely high diversity, incuding the major sporozoite surface antigen CSP (circumsporozoite protein) targeted by the RTS,S vaccine. Using Illumina sequencing data of parasite DNA from the RTS,S trials, the Harvard group tested whether the vaccine allele (3D7)-specific "sieve-effect" would result in fewer vaccine-match infections in vaccinated participants. The analysis indicated a greater cumulative efficacy against vaccine-match parasites, and also that 3D7 haplotype frequencies varied by study site throughout Africa. The results emphasize that parasite variation can limit the efficacy of malaria vaccines, and highlight the potential for parasite variants that evade vaccines to spread.

PMC5977048_02

Male

A 65-year-old farmer residing in Gougui (Kobeni/Hodh El Gharbi region), Mauritania, consulted on December 2, 2016, at the Aioun Regional Hospital for maculopapular, nodular lesions associated with chest pain and chronic productive cough. On admission to hospital, the skin signs had evolved over the past ten years, at first consisting of lichenoid lesions and multiple hypopigmented papules. A few months before consultation, a productive cough associated with progressive deterioration of the general condition occurred. There was no history of tuberculosis. Various analgesics, antibiotics, and topical treatment, including traditional medicines, had not improved his condition. The physical examination revealed the presence of diffuse hypopigmented lichenoid lesions varying from 2 to 5 cm in diameter at the base of the nose with sensory loss. Visual examination was normal. Auscultation revealed rales over the right bronchus. Sputum examination and Ziehl-Neelsen skin smears were negative. Skin biopsy was not performed due to inadequate medical facilities. HIV serology was negative. Laboratory examinations showed anemia (9 g/dl hemoglobin), normal blood sugar, and normal renal and hepatic functions. The chest X-ray showed reticulonodular infiltrates at the right lung apex and bilateral hilar lymphadenopathy (Figure 4). The diagnosis of lepromatous leprosy with concomitant disseminated tuberculosis was made. Antileprosy and antituberculosis treatment (rifampicin 600 mg/day, dapsone 100 mg/day, and clofazimine 100 mg/day) was initiated and was generally well tolerated, leading to a favorable response.

PMC6252358_01

Male

A previously healthy 47-years-old male developed abruptly malaise, high fever (40 C) and chills only 3 days after walking and sleeping in the countryside of the island of Bornholm (Denmark) during summer season. He also reported profuse night sweats, a small left infraclavicular non-painful cutaneous lesion. The patient did not report outdoor activities in the month before and did not recall any tick bite. Three days later the fever vanished and he was first observed in a hospital in Berlin. He was prescribed with amoxicillin/clavulanate 875mg/125mg twice-a-day for 7 days. On the 15th day of disease, he was observed in Portugal because of ongoing malaise. During the observation he did not complain of respiratory symptoms nor headache. He presented a non-pruritic macular erythematous rash of the trunk, a non-painful left infraclavicular cutaneous lesion covered with a black crust suggestive of a skin eschar and multiple small painless, non-adherent cervical, and axillar lymphadenopathies (Figures 1, 2). Routine laboratory tests evidenced minor unspecific inflammatory abnormalities: white blood count (WBC; leucocytes 12.060 x 106/L, polymorphonuclear predominancy), platelet count 307000 x 106/L, C-reactive protein 28.4 mg/L. Liver functions tests, blood urea nitrogen, creatinine and electrolyte levels, were within normal range. Human immunodeficiency virus infection tested negative. Soft tissue ultrasound revealed several lymphadenopathies of the left axillary region, most within dimensions of 1.0-1.5cm (of the largest axis) and two larger (1.8 and 2.3cm) with tendency to suppuration. Considering an exanthematic fever and an inoculation-like lesion, a Rickettsial infection or Lyme borreliosis were suspected. Blood samples were collected and the patient initiated empirically doxycycline 100 mg bid (twice a day). Later on both detections for antibodies to Rickettsia sp. and Borrelia burgdorferi s.l were negative. Careful revision of zoonosis with prominent lymphadenopathies in Denmark was carried out and an infection with Francisella tularensis was suspected. Serum specimen was shown to be positive for F. tularensis specific antibodies, which was demonstrated by an agglutination test with a titer of 160, followed by enzyme-linked immunosorbent assay (ELISA) classic Francisella tularensis (Virion/Serion GmbH Institute, Wurzburg, Germany) IgM (titer: 114.53 U/ml (cut-off 15 U/ml), and IgG (titer: > 300 U/ml (cut off 15 U/ml). As the patient showed no improvement after 4 days with doxicycline he started intramuscular streptomycin 1 g every 12 h in an outpatient basis for 10 days without complications. The inoculation-like lesion resolved, but the lymphadenopathies remained mostly unchanged. Despite this, the patient left Portugal for working reasons. Three weeks later the left cervical lymphadenopathy increased in size and the axillary evolved into a suppurative lymphadenitis. He was called back and an excision of the left cervical lymph node was performed. The excisional biopsy of the lymph node was cultured on chocolate agar media (bioMerieux) at 37 C in a 5% CO2- enriched atmosphere of. After 3 days, some suspicious colonies of Francisella grow. This observation was confirmed by a real-time multitarget TaqMan PCR, using tul4 and ISFtu2 assays and fopA gene with positives further tested using real-time TaqMan PCR assays which differentiate between F. tularensis subsp. tularensis (type A) and F. tularensis subsp. holarctica (type B). For additional characterization, a phylogenetically informative region of lpnA (231 bp) was amplified by conventional PCR as previous described. Amplicons obtained by lpnA PCR were purified and sequenced with the ABI BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Inc., Foster City, CA, USA). The lpnA sequences for F. tularensis subsp. holarctica (PoHuF2) was assigned with the GenBank accession number: MH068785. On the other hand, histopathology showed cell necrosis and no evidence of tumor cells nor Mycobacterium tuberculosis bacilli was found. An ulceroglandular form of tularemia was unequivocally diagnosed. In the absence of response to the first line antibiotic therapy with aminoglycosides, he was treated with ciprofloxacin 500 mg twice-a-day for 60 days and performed percutaneous drainage of the bigger axillar lymph nodes with clinical improvement.

francisella tularensis subsp holarctica, portugal, case report, patient, tularemia, ulceroglandular

PMC7235945_01

Female

A 42-year-old female patient with a body mass index of 36 kg/m2 presented to our clinic with obesity and symptomatic GERD. She had been using proton pump inhibitor (PPI) regularly for 1 year. Patient's preoperative GERD-HQRL (Heartburn score 0-30) was 25. The patient, also, had insulin resistance, grade 2 hepatosteatosis and dyslipidemia as comorbidities due to obesity. Preoperative endoscopy showed hiatal hernia but no esophagitis. One week after discontinuation of PPI, the patient underwent ambulatory pH study and GERD was confirmed. The patient was scheduled to have laparoscopic hiatal hernia repair plus combined partial posterior fundoplication and sleeve gastrectomy (Fig. 1). She was given thorough information about the operation and informed consent was obtained. The 12 mm optic trocar (Endopeth Xcel ) was entered into the abdomen under direct vision from the left supcostal area and insufflated with 12 mmHg CO2. SG was performed with 5 trocars. Lesser suck was opened and greator curvature was disected using harmonic scalpel. The stomach was completely released. Hiatus dissection was performed. Hiatal hernia was repaired with 2.0 etibond suture. Then, gastric fundus was passed behind the esophagus and posterior fundoplication was performed (Fig. 2). SG was completed using Endo GIA 60 mm Tri-stapler (4 purple and 1 brown cartridge) starting from 2 cm distance to the pylorus using 36 French bougie. After the SG was completed (Fig. 3), the stapler line was inverted at the top with 3.0 V-Loc and the next 3-4 cm sutures were passed through the esophagus and the left side of the fundoplication was created (Fig. 4). Then the entire stapler line was oversewed. At the last stage, gastric sleeve was fixed to the omentum at 2 points below the incisura to prevent twist. The operation took 110 min (see Video, Supplemental Digital Content, which demonstrates combined posterior fundoplication with SG). The patient recovered well and discharged home on the 3rd postoperative day. She stopped using PPI in the early postoperative period and her reflux symptoms disappeared completely. The patient lost 20 kg in the 3rd month (%40 excess weight loss) and underwent controlled ambulatory pH moniterization and no reflux was detected.

bariatric surgery, gastroesophageal reflux disease, modified technique, sleeve gastrectomy

PMC7842613_01

Male

The participant was a 6-year, 3-month-old boy, with an ASD, pervasive developmental disorder, moderate-to-severe speech disorder, and language delay; his communication level equaled a 10-to 18-month age range of normative development. He was recruited at the clinic where he had received traditional speech therapy for six months without improvement. Per the university IRB-approved protocol, the boy's mother and grandmother were recruited as communication partners to deliver the AAC intervention in addition to his SLP. The baseline phase consisted of introducing the boy to the AAC system on a touchscreen laptop, which was placed on a desk in the intervention environment (home), but without further instruction. Communication partners also self-talked and used the AAC system at set intervals to encourage the boy's usage of it. Baseline lengths of three, five, or seven sessions were randomly assigned among communication partners. During intervention, communication partners implemented strict instruction and modeling protocols to teach AAC usage to the boy. Each correct touch of an icon and attempt to speak the corresponding word was reinforced with the boy's favorite cookie, music, and verbal praise. Each intervention session was divided into 20 minute segments, starting with the grandmother as partner, followed by the mother, and then SLP. During grandmother-and mother-led sessions, the SLP guided the others' intervention when needed. The outcome variable was a count of the number of times the participant correctly touched the AAC display and spoke to imitate the computerized speech output (Hill,). Vocabulary evaluation allowed the participant to produce meaningful utterances that were more similar to his natural speech and language development than the pre-recorded computer digitized output (Hill et al,). Sessions were video recorded; interrater reliability Pearson r = 82. Data analyses utilized only MMTA because there were too few observations for USEM. Data were missing for one of the grandmother's sessions and three SLP sessions. Error covariance structures differed slightly among partners with autoregressive(1) fitting best for grandmother and SLP, but variance components structure for mother. Figure 1 presents observed time series data as solid lines, best fitting MMTA models as dotted lines, and the MMTA formulas to compute Y'. The Pearson correlation was r = .90 between predicted and observed outcomes. In individual and aggregate analyses, communication growth was statistically greater for AAC than Baseline (p<.05). Random slopes, but not random intercepts, statistically improved fit to the data (p<.05), indicating that shape of trajectories differed among communication partners. Specifically, faster growth occurred with mother-led AAC intervention. Visual inspection suggested that improvement in communication during the grandmother and mother sessions begins at initiation of SLP intervention. Thereafter, curvilinear improvement in communication occurred with all three partners. Results are consistent with both hypotheses, with two minor exceptions. First, although the AAC intervention was associated with improved communication with each partner, growth appeared to begin only after the SLP intervention was initiated. Second, the fastest growth occurred with the mother-delivered AAC intervention. Thus, AAC technology functioned according to design, family members proved able to deliver AAC treatment, and evidence supported expanding the testing of this AAC language-based system. Although not reported here, these findings have been replicated in a larger, school-based sample (Chen, Hill, Ridenour, Sun, Su, Chen,). MMTA models replicated the observed data well and provided proof-of-concept information regarding mechanisms of intervention effects. Replicating previous comparisons between statistical techniques, MMTA proved to be viable with few study participants and observations (Ridenour et al.,). For example, these data were much too sparse for USEM or time series analysis. Documenting treatment efficacy and effectiveness in the field of AAC is challenging. One central barrier is showing that gains in speech and language skills are due to the treatment rather than maturation. Another substantial barrier is the heterogeneity of the population needing AAC interventions, thus making accumulation of small sample or N-of-1 studies useful to advancing the evidentiary base to guide clinical practice. Compared to traditional visual inspection methods, MMTA models provide rigorous evidence to answer a question often posed by third-party payers, "are the results due to treatment or merely the child's maturation?" Data clearly show that AAC clinical services are warranted, especially in light of the lack of clinical progress over the six months preceding the study. Clinical services to train family members add significant value to payment for AAC treatment, since time spent on training family members helped to achieve the targeted communication outcomes without requiring the SLP to conduct all the sessions needed for progress (saving costs and increasing dosage). Finally, the child had unique co-morbidities related to his speech-language disorder that demonstrated the challenge of using RCTs for investigating AAC treatment. Using a wheelchair for extended periods can lead to pressure sores, muscle spasms, altered blood pressure and flow, joint problems, muscle contractures, and painful discomfort. The team at the Human Engineering Research Laboratories has developed a series of devices to assist people with physical disabilities (Cooper et al.,; Cooper et al.,; Ding, Cooper, Pasquina, & Fici-Pasquina,). The Power Seat (PS) was designed to relieve discomfort due to sitting in a wheelchair in one position for extended periods by allowing users to adjust wheel-chair positioning (Dicianno, Mahajan, Guirand, Cooper,; Ding et al.,; Lacoste, Weiss-Lambrou, Allard, & Dansereau,). Positions range from traditional 90 degree angles to nearly supine using adjustments to the footrest, seat bottom, and seatback. However, during a pilot study, PS users largely failed to comply with prescribed PS usage but rather relied on infrequent and small angle adjustments to their seating position; they also continued to complain of pain and discomfort (Ding, et al.,; Lacoste, et al.,). Two contributors to poor adherence were hypothesized: (1) confusion regarding PS usage and (2) neglecting to use the PS due to forgetting, failing to self-monitor discomfort levels, or low 'buy in.' To improve adherence, an extended education/assistance program was devised to improve understanding of PS functioning (termed Instruction). A second intervention, termed Virtual Coach, consisted of computer-delivered reminders to mindfully monitor physical discomfort level at the proscribed intervals and alter PS angles for relief (Ding et al.,; Liu et al.,). Compared to Baseline, both the Instruction and Virtual Coach interventions were hypothesized to be associated with (a) greater compliance with proscribed PS usage, (b) reduced discomfort, and (c) increased frequency of PS usage and duration of large angle (>15 ) positions (the theorized mechanisms of discomfort relief). Consistent with the IRB-approved protocol, participants were recruited from the Pittsburgh region at an assistive technology clinic and a Veterans Administration wheelchair seating clinic by their clinicians. Interested clients were introduced to a study investigator to provide additional information, answer questions, and administer informed consent. Inclusion criteria were: 18 years of age or older; use of a medically-necessary, electronic powered wheelchair; the client's sitting surface could be examined daily for redness or pressure ulcers either by the client or another individual; no active pelvic, gluteal or thigh wounds nor a pressure ulcer in these regions within the past 30 days; and no more than 5 days of hospitalization in the previous month. The resultant sample (N=16) was 43.8% female; had a mean age of 51.5 years (SD=12.4 years); was 25% African-American and 75% Caucasian; weighed a mean 196 lbs (SD=43 lbs); was a mean 5'7" tall (SD=3"); 62.5% and 56.3% used a computer or smart phone, respectively; and had been using a wheelchair for a mean 22 years (SD=15 years). PS usage (adjustment frequency, large changes in PS angles) was recorded by the PS computer. At the end of each study day, discomfort levels were measured using the Tool for Assessing Wheelchair disComfort (TAWC) (Crane, Holm, Hobson, Cooper, Reed, & Stadelmeier,). The TAWC queries General Discomfort using 13 broad summary statements regarding how a client feels while sitting in his/her wheelchair (e.g., I feel poorly positioned, I feel uncomfortable, I feel good) on a 7-point Likert scale. It also queries Discomfort Intensity at that moment using a 10-point Likert scale for 7 specific body parts and additional body parts that could be added by the respondent. The TAWC has adequate test-retest reliability, internal consistency, and concurrent validity (Crane et al.,). A multiple baseline design was used (14-or 18-day baseline phases). At the start of baseline phases, an introduction and demonstration of PS use was provided to participants. At onset of intervention, participants were randomized to receive either Instruction (n=10) or Instruction plus Virtual Coach (n=6). Intervention phases lasted 50 days. Autoregressive lag(1) was the best fitting error covariance structure for all participants. Three competing models were tested (Figure 2). The Autocorrelation Only Model implied that discomfort and PS usage could shift in mean level among study phases and that no variable affected any of the others from day-to-day. The Generic Model, based on Zheng et al., implied that in addition to autocorrelation, the level of each variable was associated with changes to every other variable on the next day. The Cooper & Liu Next-day Model, based on hypothesized effects of the Instruction and Virtual Coach interventions, implied that levels of PS usage changed day-to-day in response to discomfort levels. After identifying the best fitting model, its parameter values were tested for moderation by study phase (Baseline vs. Instruction vs. Virtual Coach). As mentioned earlier in Unified Structural Equations Modeling, these competing models had to be compared while accounting for clustering of data within study phases and individuals. The subset of data from each individual's two phases were analyzed as if they were collected from a separate sample. In other words, two USEM models were estimated per individual (one for his/her baseline data and a second for the intervention phase data) and the full sample was analyzed as if model estimates were aggregated from 32 subsamples. To compare fit among the Autocorrelation, Zheng, and Cooper & Liu competing models, corresponding parameters from the 32 subsamples of data were fixed to be equal. Then, once the best fitting of these three models was determined, moderation of that model by study phase was tested by freeing the corresponding parameters to be specific to each study phase (Baseline parameters versus Instruction parameters versus Virtual Coach parameters). Study data consist of 1,067 observations. During Baseline, only 2.8% of observations were missing; 7.0% were missing during intervention phases. Visual inspection of compliance rates for the study duration (Figure 3) suggests equivalent rates of compliance during Baseline phases of the Instruction and Virtual Coach subgroups whereas Instruction phase compliance rates appear to be less than the Virtual Coach phase. However, the large within-person variability obscures visually pinpointing mean levels, trends, size of differences among phases, whether such differences are statistically significant, and any effect that autocorrelation has on data. The best fitting MMTA model for predicting compliance was 24.54 + 0.001(per study day)2 + 1.65(hours of wheelchair occupancy) + 36.18 (if got Virtual Coach) - 0.77 (if got Instruction) - 0.02 (per Instruction phase day). Thus, compliance rates differed considerably between Instruction and Virtual Coach. Also tested, but failed to reach p>.05, were (a) change in compliance over time during Virtual Coach and (b) whether subgroups differed during Baseline. The model's predicted compliance rates correlated with observed compliance rates r = 0.598 (p<.001). These results suggest that after controlling for time (e.g., due to practice) and how long an individual sat in a wheelchair per day, Virtual Coach more than doubled compliance rates (60.72% vs 24.54%) on average compared to baseline whereas compliance lessened slightly per day of Instruction. Table 2 presents MMTA efficacy estimates. Compared to Baseline, Virtual Coach was associated with increased frequency of PS use (2.1 vs 3.3) and greater large-angle PS use. In contrast, during the Instruction only phase, PS usage was less than Baseline. In terms of efficacy, general discomfort was statistically equivalent among phases whereas discomfort intensity was statistically less during Virtual Coach - by more than an entire SD (Cohen's d = -1.10). Estimates were consistent with MMTA compliance results. Table 3 presents fit statistics comparing the competing USEM models. Results consistently suggested the Next-day model best fits the data for both PS adjustment frequency and large-angle PS usage. Freeing parameters to differ among phases further improved fit to the data only for PS frequency. Table 4 presents the path coefficients per study phase. Day 1 covariance between frequency of PS use with discomfort intensity was null during Baseline (.09), about the same during Instruction (.11), but greater during Virtual Coach (.51). Other associations between discomfort and PS use frequency were also moderated among study phases after controlling for the first day associations. Similar to the Virtual Coach's greater coupling between PS use frequency and discomfort intensity for Day 1, this coupling was even greater from Day 1 to Day 2 during Virtual Coach (.90) compared to the other study phases (-.60 and -.24). Also consistent with Cooper and Liu's hypotheses, the strong association between general discomfort on Day 1 with PS usage the next day (.74) was weakened and reversed during Virtual Coach (-.36), but not during Instruction (.58). Compared to Baseline, Virtual Coach was associated 2004; Smith,). with (a) improved compliance, (b) large reduction in discomfort intensity, and (c) greater coupling of PS use with discomfort intensity. During Instruction, PS use was more correlated with general discomfort, but not changes in PS usage (PS usage was less than Baseline) or discomfort intensity. Thus, PS appears to relieve wheelchair discomfort intensity using Virtual Coach at least in part because of improved adherence. This study did not include a Virtual Coach intervention without Instruction. Based on the poor results associated with Instruction, it is reasonable to credit Virtual Coach with the outcomes. Yet, without Instruction, Virtual Coach efficacy may not have been as large (e.g., Instruction may prevent confusion or reinforce Virtual Coach). Many barriers preclude using RCTs to research treatment for wheelchair users. The population is small and heterogeneous. Also, transportation complications and health conditions impede their research participation. Funding for RCTs is lacking. Moreover, clinicians in rehabilitation and assistive technology are trained to care and value individual's needs and outcomes (as opposed to population averages). Compared to RCTs, ICTs are more compatible with clinical milieu, interfere less with patient "flow," and offer evidence with more direct clinical interpretation and application (Graham, Karmarkar, & Ottenbacher,). Results from MMTA and USEM provide more sophisticated information about interactions among study variables, their sequencing, and greater rigor than traditional data analysis methods for ICTs (Gabler et al.,; Smith,). Sensor and mobile computing technologies have become more reliable, user-friendly, and widely applied for repeated measurements of real world phenomena. Coupling ICTs with sensor and mobile computing technology to collect data and MMTA and/or USEM represent a qualitative advance in researching rehabilitation and assistive technology (Furberg et al., 2017).

clinical trials, n-of-1, idiographic, nomothetic, personalized medicine, pragmatic trials, statistical analysis, structural equations modeling, trajectories, treatment mechanisms

PMC4531674_01

Female

A 50-year-old woman was admitted due to high fever and progressive dyspnea for 20 days. For ten years, she suffered from arthritis which was treated irregularly, without specific evaluation, at a private clinic. Eleven days before, she visited another hospital because of fever, cough, sputum and dyspnea with mild pleuritic chest pain. She was managed under the impression of tuberculous pleurisy, but she did not improve with anti-tuberculous medication. A chest radiography showed right pleural effusion with bilateral pulmonary infiltrations (Figure 1A). Cytology of pleural fluid revealed mesothelial cells, histiocytes and neutrophils. Serum creatinine level was 2.2 mg/dL. She was brought to this hospital for further evaluation and management. On admission, she complained of fever, cough and dyspnea. Her body weight was 33 kg and her vital signs were as follows: temperature 38.6 C; heart rate 120/min; and respiratory rate 28/min. At that time, she also had keratoconjunctivitis sicca and xerostomia. On physical examination, she had bibasilar crackling rales. Pale conjunctiva, hepatomegaly by two fingers width below the costal margin and pretibial pitting edema were also discovered. But, clubbing of finger and cyanosis were absent. A chest radiograph showed pneumonic infiltrations in both lower lung fields with pleural effusion (Figure 1B). Laboratory studies revealed hemoglobin of 8.5 g/dL, hematocrit of 24%, white blood cell count of 3900/mm3 (13% of band form, 85% of segment form), platelet count of 148,000/mm3 and ESR of 72 mm/hr. Serum creatinine was 2.5 mg/dL, protein was 7.2 g/dL and albumin was 2.5 g/dL. Urinalysis showed proteinuria (+2) and hematuria (+4). Antinuclear antibody was positive (1/640, speckled pattern), but anti-DNA antibody was negative. Tests for anti-Ro, anti-La and anti-RNP antibodies were positive. The level of C3 and C4 were decreased to 25 mg/dL (normal 45-100 mg/dL) and 9 mg/dL (normal 10-40 mg/dL), respectively. C-reactive protein was 7.2 mg/dL (normal <0.5) and rheumatoid factor was 52 IU/mL (normal <20). Direct Coombs' test was positive, but indirect Coombs' test was negative. Peripheral blood smear demonstrated normochromic normocytic anemia with mild leukopenia and thrombocytopenia. Blood culture grew nothing. Ziehl-Neelson stains for acid-fast bacilli of her sputum were negative and cultures for M. tuberculosis were negative 3 consecutive times. On 24-hour urine collection, protein was 3.0 g/dL and creatinine clearance was decreased to 20 mL/min. Determination of urinary Bence-Jones protein revealed no abnormality. Immunoelectrophoresis of serum proteins revealed polyclonal increase at gamma-region, especially IgG lane. A pleural fluid study disclosed that straw-colored fluid contained 127 leukocytes/muL (neutrophil 26%, lymphocyte 74%), protein 1.7 g/dL, lactic dehydrogenase 972 mg/dL and glucose 37 mg/dL and had a high likelihood of being an exudate. AFB smear and culture of pleural fluid did not show any organism. Test for IgM antibody to Epstein-Barr (E-B) virus was positive in the serum. Antineutrophil cytoplasmic antibodies (ANCA), Human Immunodeficient Virus (HIV) and Cytomegalovirus (CMV) assays were all negative. Pulmonary function test showed normal ventilatory pattern with reduced diffusion capacity: forced vital capacity (FVC) 1.90 L (84% of predictive value), forced expiratory volume in one second (FEV1) 1.63 L (94% of predictive value), FEV1/FVC 113%, total lung capacities (TLC) 2.78 L (88% of predictive value) and diffusing capacity of the lung DLCO) 6.5 mL/min/mmHg (54% of predictive value). Echocardiography revealed left ventricular dysfunction with moderate amount of pericardial effusion. Sialography of salivary gland showed multiple-sized ectatic changes in acina without dilatation and filling defect in the main duct (Figure 2). On biopsy finding of the lower lip, hyperkeratosis and spongiosis were seen, and lymphocytes infiltrated the dermis with exocytosis to the epidermis which was compatible with Sjogren's syndrome (Figure 3). High-resolution computed tomography of the chest demonstrated bilateral consolidations in both lower lung zones, associated with bilateral pleural effusion and moderate amount of pericardial effusion (Figure 4). An open lung biopsy was performed at the right lower lobe of the lung. There was dense lymphoplasmacytic infiltration in the interstitium of the lung parenchyme (Figure 5A) and the pleura forming reactive lymphoid follicles with germinal centers (Figure 5B). Multifocal areas of vasculitis (Figure 5C) and interstitial fibrosis were shown without any fibroblastic plug or honeycombing cystic change. The immunohistochemical stains failed to reveal monoclonality of these lymphocytic infiltrations as below; LCA (CD45RB) (+), CD3 (+) and L26 (CD20) (+). In situ hybridization of paraffin block tissue with anti-Ebstein-Barr virus antibody (NCL-EBV-K, Novocastra Lab, UK) was positive. The patient was treated with prednisolone of 1 mg/kg/day for one month. But, she had no improvement on radiologic finding and showed generalized edema as an adverse effect of steroids. With prednisolone tapering, she was also added oral cyclophosphamide 50 mg/day. Following this therapy, her condition significantly improved in subjective symptoms, physical signs and objective pulmonary function and radiologic findings (Figure 1C). The inflammatory laboratory markers were still slightly increased, but pulmonary function test and chest radiograph were nearly normalized.

CT scan of the chest shows bilateral consolidation in both lower lung zones. Bilateral pleural effusion and pericardial effusion are present.

PMC5359449_01

Female

A 58-year-old female with a history of lupus and plaque psoriasis presented to the emergency department with new onset hallucinations and suicidal ideation, as well as one witnessed attempt to throw herself into traffic. The patient was brought to the hospital after what her husband said were three days of the patient talking to people who were not there, crying frequently, not sleeping, openly expressing a desire to die, and one attempt to run from their home to a nearby highway in order to jump in front of a car. The patient's husband had chased after and restrained her, after which he brought her to the hospital. The husband relayed that the patient had never before in the course of their 35-year marriage behaved in this manner, and he further insisted that the patient was previously generally "happy and smiling." In-house hospital records showed a long history of lupus and psoriasis management as well as a recent admission two weeks prior for mastoiditis; she had received IV clindamycin and ceftriaxone and then been discharged on oral clindamycin. There was no record of any mental health history. The medical records showed that, during the recent hospital admission, the patient was discovered to have a depressed thyroid stimulating hormone (TSH) level; she was diagnosed with hyperthyroidism and treated with methimazole (MMU) and propranolol for presumed Grave's disease. At the time of discharge, she was continued on a half dose of methimazole. Propranolol was discontinued before discharge based on clinical response to treatment, with endocrinology clinic follow-up scheduled for three weeks from the time of discharge. The patient's husband further relayed that the patient had been searching their home for a knife for the past two days while telling him that she "needed to die," compelling him to remove all kitchen knives from their home. On interview, the patient was asked why she was looking for a knife and she responded "because I want to die." The patient and her husband both denied any recent head trauma. They both further denied any alcohol use or illicit drug use. The patient denied any abdominal pain, diarrhea, dysuria, vomiting, or shortness of breath. She endorsed restlessness, palpitations, and a sensation of "feeling too hot." On exam, blood pressure was 145/88, temperature was 37.5, respirations were 17, oxygen saturation was 99 percent on room air, and heart rate was 129 beats per minute. On the cardiac monitor, she was in gross atrial fibrillation, which had previously not been documented in her medical record. During the exam, the patient was noted to have rapid, pressured speech. Voice volume was normal, and her mood was depressed. She became tearful during the interview, and she intermittently appeared to be responding to internal stimuli. Of note, she seemed to be quite open about all her symptoms and was an excellent historian. She freely admitted to suicidal ideation (SI) and audiovisual hallucinations (AVH). She admitted to attempting to run into traffic in order to kill herself. She described hearing what she described as supernatural voices speaking to her; she said that she could see "spirits and lions" that were likewise speaking to her. She did not believe that the voices were telling her to kill herself but rather said that she wanted to die "because I am so sad." She was oriented to her name only. She did not know the year and believed she was currently in a prison. She asked the doctor for a knife several times. She also said that she felt as though she wanted to start running "because I can't keep my legs from moving." She had pulled all the blankets off the bed, had removed much of her hospital gown, and asked if she could have some ice water "because it is so hot in here," despite the fact that the emergency department was air-conditioned. The remainder of the exam was notable for an irregularly irregular heartbeat, clear lungs, tongue fasciculations, tremulousness, diffuse hyperreflexia, and a large, nontender thyroid gland. The patient was placed on a medical detainment and assigned a one-to-one sitter to monitor her. Psychiatry was consulted. An electrocardiogram was ordered, which showed sinus tachycardia with resolution of the previously noted atrial fibrillation. Urine toxicology was negative. Labs showed a slightly low potassium level, in keeping with a hyperadrenergic state. TSH was undetectable. It was well past midnight, so the decision was made to treat empirically for thyroid storm. Propranolol 80 milligrams PO and methimazole (MMU) 20 milligrams PO were ordered. The patient took the medication without any resistance. She was given a large cup of ice water, as well as an IV bolus of a liter of normal saline. Endocrinology was consulted, and the head of endocrinology began driving to the hospital from his home to see the patient. Dexamethasone 10 milligrams IV was then given. Meanwhile, the psychiatry service interviewed the patient. They agreed with the plan to treat for hyperthyroidism and placed the patient on a 72-hour psychiatric hold for danger to self and grave disability. Two hours after treatment was initiated, the patient's heart rate had slowed to 89 beats per minute. The cardiac monitor showed normal sinus rhythm. Tongue fasciculations had stopped, though hyperreflexia remained. The patient said that she felt "so much better" and was at this point denying SI and AVH. She showed insight into her condition, saying "I was feeling very upset and scared. I was seeing lions, and they were talking to me. I was so scared. I could hear voices that I knew weren't there, but I felt so sad about how I felt that I wanted to die." She wanted to know what medicine she had been given that had made her feel better, and she asked if she could have a prescription for it. Endocrinology consult arrived and assessed the patient, likewise finding hyperreflexia and an enlarged thyroid gland. Endocrinology made a diagnosis of thyroid storm in the setting of Grave's disease. Both consult services recommended a brain MRI to rule out an intracranial process. This showed no evidence of bleeding or stroke, nor any evidence of lupus cerebritis (which had been included on the differential due to the patient's lupus history). The patient was admitted to medicine and was followed by psychiatry. The day after admission, she again began endorsing SI and AVH. Free T4 and T3 levels at this time were 2.10 ng/dL and 2.09 ng/dL, respectively. Psychiatry recommended olanzapine (Zyprexa) 5 milligrams daily, which was initiated to good effect. Propranolol, MMU, and steroids were continued and adjusted based on endocrine consult recommendations. Thyroid stimulating immunoglobulin (TSI), ordered as a send-out lab during the patient's previous admission for mastoiditis, returned positive, and the diagnosis of Grave's disease was made. As the patient's thyroid labs normalized, her psychiatric symptoms resolved. Olanzapine was discontinued at the recommendation of psychiatry. Endocrinology recommended radioactive iodine ablation of her thyroid gland, which was scheduled and then aborted when she was found to have sudden onset pancytopenia, a well-documented side effect of methimazole. Methimazole was discontinued, and her cell lines began to recover. After thorough reassessment, psychiatry lifted the hold, and the patient was discharged from the hospital on a steroid taper and propranolol.

PMC9980716_01

Female

So far, USUV infection has a very low incidence in humans in Africa and Europe, where the virus is circulating in the Culex mosquito vectors. To date, only few human cases have been identified. In Africa, the first detection of USUV infection occurred in 1981 in the Central African Republic. The patient had a fever and body rash. The second case was identified in a patient from Burkina Faso in 2004 who had fever and jaundice. In humans, USUV infection is usually characterized by fever, headache, tremors in the hand and hyperreflexia. In Europe, the first human report of USUV infection was made in Italy in 2009. The patient had a preexisting B cell lymphoma tumor and had a fever and neurologic symptoms. Also, in 2009, a woman in Italy was diagnosed with a sickness related to USUV infection following a liver organ transplant because of thrombotic thrombocytopenic purpura that developed during an acute episode of USUV infection. The first two human cases of USUV associated neuroinvasive infection were confirmed in immunocompromised patients in Italy in 2009. The case report by Cavrini et al. confirmed USUV by heminested RT-PCR assay targeting the NS5 gene of flaviviruses. Also, a retrospective analysis of human samples (serum and CSF) collected between 2008 and 2011 with or without neurological impairments in Modena, Italy documented a seroprevalence of about 6.6%. Similarly, USUV was detected in birds and mosquitoes, and partial sequencing of the virus genome revealed high nucleotide sequence similarity within hosts and strains from Central Europe. In 2014 and 2016-2018, much higher prevalence of the virus (18.1 and 46.3%, respectively) was detected in forest workers and healthy blood donors by 29, suggesting a rise and threat to human health. In 2013 another three cases of USUV neuro-invasive infection (Europe lineage 2) was reported in Croatia during a WNV outbreak. Like the Italian report, two of the cases were immunocompromised with arterial hypertension, hyperlipidemia, and diabetes mellitus, thus indicating comorbidities may have a role in the pathogenicity of USUV. Patients presented meningitis and meningoencephalitis with clinical signs such as headache, fever, nuchal rigidity, hand tremor, hyperreflexia, and memory loss and speech fluency difficulty. Another study in Croatia in 2018 further detected three cases, one of the patients was immunocompromised with chronic lymphocytic leukemia and fatal meningoencephalitis. USUV has also been reported in animals such as bats in 2013, wild and captive birds in 2011, Owls and humans in Germany. A survey of wild birds in 2011 detected USUV in 38.6% in dead birds using real-time RT-PCR. These data showed that the virus spread and caused epizootics among wild and captive birds in south-west Germany in 2011. The incidence of the virus has then increased and over 1300 cases were detected since 2013. Furthermore, in January 2012, a total of 4,200 serum samples from healthy blood donors from south-west Germany were analyzed for USUV-specific antibodies. Although all serum samples from the patients tested negative, one person was confirmed with IgG- and IgM antibodies and USUV infection, after eliminating the possibility of serological cross-reactivity to other flaviviruses. Likewise, during the 2016 epizootics, a surveillance of WNV and USUV from 13, 032 blood donors confirmed the presence of USUV Europe 3 lineage in a blood donor, which later revealed an acute USUV infection by immunofluorescence, PCR and genome sequencing assays. USUV from the donor plasma showed 99% homology sequence with those found in the birds during the epidemic in 2016. Hungary is another European country that has documented the presence of USUV in animals and humans. The country reported the first incidence during the country's dead bird surveillance program in a black bird (Turdus merula) in August 2005 and further six birds in 2006 by reverse transcription-PCR, immunohistochemistry, in situ hybridization, viral isolation and whole genome sequencing. A total of 332 dead birds belonging to various species were tested for USUV infection between 2003 and 2006. The Hungary USUV strain shared 99.9% identity with the circulating Austrian strain indicating that the USUV strain responsible for the epidemic in blackbird in spread from Austria to Hungary. Moreover, results of passive surveillance of USUV in Austria and Hungary (between 2010 and 2016) revealed 12 birds tested positive for USUV infection in 2016 in Hungary. Similar pathological conditions as previously described by Bakonyi et al. were reported. The pathological examinations showed moderately autolytic condition, emaciation, moderate to severe splenomegaly, mild hepatomegaly and general congestion of internal organs (Table 1). The nucleotide sequences of USUVs detected cluster together with sequences identified in a human plasma sample and in blackbirds between 2009 and 2010 in Italy. The first human case of USUV was reported by Nagy et al. during a surveillance programme for WNV in 2018. Patients with clinical suspicion of acute WNV infection were tested in parallel for WNV, tick-borne encephalitis virus and Usutu virus (USUV) by serological methods. The Europe lineage 2 USUV infection was confirmed in 2018 in a patient with aseptic meningitis by serology and molecular assays. Furthermore, in 2019, a year after the largest WNV epidemic in Europe, a comprehensive sero survey for WNV and USUV was conducted among blood in Hungary to assess the exposure of the Hungarian population. A total of five blood donors were USUV seropositive out of 3,005 donors tested (0.17%). This shows an increase in human donors with possible clinical manifestation expected in Hungary. The first emergence of USUV European lineage 2 was reported in Austria in 2001 where it received wide public attention due to the epidemics and high mortality among Eurasian blackbirds (Turdus merula) and great gray owls (Strix nebulosa) in the Vienna. A 3-year nationwide surveillance of the USUV in dead wild birds demonstrated 92 birds (in 2003), 11 (in 2004) birds, and 4 (in 2005) birds positive to the infection. However, USUV associated avian deaths reduced during the course of the years due to the establishment of herd immunity in wild birds in Austria. Between 2010 and 2015, a few wild birds tested were all tested negative to the USUV infection. In 2017, USUV nucleic acid was detected in six of out of 12,047 blood donations from eastern Austria between July and August 2017. These detections were from healthy individuals. However, the first case of human USUV was recently reported by Graninger et al.. The patient, an 81-year-old man was presented to a hospital in Vienna, Austria in early September 2021. The patient was febrile and displayed confusion and difficulty in responding to questions. The patient later showed the intermittent clonic jerks of his right upper extremity. Subsequently, Serum and CSF samples were tested for USUV, and the CSF came out positive via USUV-specific RT-PCR. A partial sequence of the virus genome was 100% identical to sequences from humans, birds, and mosquitoes in the Czech Republic, Hungary, and Austria and confirmed as the Europe 2 lineage. Similarly, in France and the Netherlands, the first outbreak of USUV were obtained in 2015 and 2016, respectively, which involved number of case reports of disease-associated and unusual mortality in blackbirds. In the subsequent year (2016) in France, the first human case was presented and associated with atypical neurologic signs. In the Netherlands, from April -September 2018, plasma from blood donors in three Dutch provinces with significant USUV activity and blackbird population were collected and analyzed for USUV infection using molecular assays. Six of the 12,040 Dutch blood donations were positive. Currently, in Africa, particularly Nigeria, there are limited studies investigating the seroprevalence of USUV infection in humans. More work needs to be done to assess the risk of the virus transmission between migratory birds and competent mosquito vectors, and eventually to humans. Some studies have identified USUV in other mammals such as dogs, horses, rodents, and bats. These findings oppose the current enzootic cycle of USUV among birds, mosquitoes. In Senegal, USUV was isolated and sequenced from samples obtained from rodents and shrews, which is the first evidence of USUV in rodents. Also, in Germany, USUV has been isolated from dead bats (Pipistrellus) mainly in the brain tissues. It is important to investigate further the contribution of bats to the transmission cycle of USUV. Apart from rodents, shrews, and bats, USUV infection has been detected in horses, dogs, wild boars, and wild ruminants. Antibodies specific for USUV has been identified in some horses raised in Poland, Croatia, Italy, Serbia, and Spain.. In addition, in 2012, USUV exposure was identified in military dogs and horses in Morocco. This was confirmed by virus neutralization tests. In 2014, a study also detected the presence of antibodies specific to USUV in horses in the southwestern region of Tunisia. In Spain, USUV-specific antibodies were also detected in wild ruminants. The co-infection of USUV with WNV indicates that more work needs to be done to identify which animals are truly acting as USUV reservoir hosts and which ones act as spill-over and dead-end hosts. This can help in preventing the transboundary circulation of this virus. Migratory birds are important sentinels for the introduction of some flaviviruses like WNV into multiple regions largely because the outbreak of these viruses within temperate regions normally happens in the summer or beginning of fall, which incidentally also heralds a massive number of migratory birds and vectors like mosquitoes. Specifically, this WNV outbreak occurred among humans living in or near wetlands where high concentrations of birds come into contact with large numbers of ornithophilic mosquitoes; the principal vectors from which the virus has been isolated are mainly ornithophilic mosquitoes (Culex univittatus in the Middle East and C. pipiens in Europe); antibodies to the virus have been found in the blood of many migratory bird species in Eurasia; migratory birds have been linked with transporting related viruses in the Western Hemisphere; WNV has been isolated from some species of actively migrating birds e.g., the Barred Warbler [Sylvia risoria] in Cyprus and the Turtle Dove [Streptopelia turtur] in Slovakia; viremia sufficiently long-term to infect vector mosquitoes has been documented in several bird species, and migration places substantial physiologic stress on birds. For example, stress has been shown to promote immunosuppression and enhanced replication of WNV in rodents. Further support for the possibility that migratory birds play a major role in virus transport comes from study of related viruses. For instance, both Eastern (EEE) and Western equine encephalomyelitis alphaviruses, ecologic relatives of WNV, have been isolated from actively migrating birds in the United States. Evidence also indicates that the 1962 epidemic of EEE in Jamaica resulted from transport of the virus by birds from the continental United States. Unlike the 1999 New York City epidemic, during which large numbers of dead and dying birds, especially crows, were observed concurrently with clinical reports of human infection with the virus, the Old-World epidemics of WNV had few concurrent reports of deaths of infected birds. This difference could indicate lack of both exposure and adaptation to the virus among New World avian populations compared with Old World species. Old World data indicate that susceptibility to fatal infection with the virus varies markedly for adult and young birds, with high death rates in juveniles and high incidence of circulating antibodies in adult birds. Susceptibility to infection also varies considerably among species. Hooded Crows (Corvus corone) had both a high death rate in young birds in laboratory experiments and high levels of circulating antibodies in adults, while Rock Doves (Columba livia) appeared to be much less susceptible to both infection and death from the virus. Nigeria is a West African country located within the East-Africa-Asia, the Atlantic-America, and the Black Sea/Mediterranean migratory bird flyways, some of which overlap. The dry and dusty harmattan wind flows through the Sahara in a north-easterly direction with high daytime temperatures/low humidity and cool nighttime temperatures during winter in Europe (equivalent to harmattan cold in Nigeria). Innate circadian clock genes frequently control the migration of these birds throughout the winter to climatically favorable regions in the tropics. These genes may also control photoperiodic responses and the timing of life cycle events like mating and eating. These directly impact how ecosystems adapt to warmer environments and places. In Nigeria, birds that migrate through West Africa's sub-region and stay there are influenced by the Nigeria biotype phenology. Seasonal solid patterns are seen throughout the sizeable biological zone that runs from Siberia's Pacific coast to Western Europe's Atlantic shoreline (Figure 4). As a result, many bird species nest in this area and migrate south to spend the winter in Africa and South or Southeast Asia. These birds, originating in Europe, travel over or around the Mediterranean as they migrate to Africa. Nearly 2 billion songbirds, waders, birds of prey, and waterfowl each year migrate from Europe to sub-Saharan Africa, with Nigeria inclusive. Many of these birds during the harmattan in Nigeria undergo a north-south transatlantic migration because of the country's abundance of wetlands, rivers, natural lakes, floodplains, and dug-out dams. The interaction between humans, animals, the environment, and significant health-related issues, especially the emergence and re-emergence of infectious pathogens, is not new and has been gaining global attention through active integrated, multisectoral, and multidisciplinary efforts. Likewise, the emergence and potential risk of USUV to human health are gaining scientific community recognition and entomological surveillance due to the possible impact of globalization and climate change on the genetic evolution of the virus propagation, amplification, persistence, and transmission among Culex mosquitoes; the adaptability in new hosts including humans, geographical locations and ecological niches; and capacity to be endemic in mosquito-bird life cycle and to co-circulate with WNV. As shown in Table 1, USUV is in countries that have reported the zoonotic possibility of the virus. Humans may get infected with USUV through Culex mosquito bites, and the zoonotic potential of USUV has been reported in a growing number of human cases worldwide. The zoonotic impact of USUV presents another picture in humans in Europe. Over 80 cases of sub-clinical cases of USUV infection have been reported during the surveillance of WNV, of which moderate flu-like signs were reported:rash, generalized headache, and weakness. The associated risk of USUV to humans was first described in Africa, where two human cases were documented in Central Africa and Burkina Faso in the 1980's and 2000's, respectively. For these two symptomatic infections, mild clinical signs involving fever, skin rashes, and jaundice, but no neurological symptoms were documented. Subsequently, newer cases have yet to be reported across Africa, which may be associated with little or no targeted surveillance programs to investigate, detect and monitor the virus and transmission dynamics among vectors, wild birds, humans, and the environment. Considering the distribution of the Culex mosquito vector in Nigeria and the sub-optimal hygiene practices in most municipal slaughterhouses across the country, there is a possibility for the transmission of USUV from the mosquitoes and migratory birds to humans and vice versa. Although there is no substantial information from the literature if infected humans with viremia can infect the mosquito vectors in Nigeria, this could be a good project for investigation in the future. In the one health context, limited information still exists on USUV epidemiology and factors for emergence, ecology, phylogeny, and pathogenicity to human and animal health despite the intense circulation of the virus among mosquitoes and wild birds in Nigeria and many African countries. The entomological surveillance system is a vital component of vector control since it gives valuable information on mosquito vector species, their spatio-temporal distribution, density, bionomics, and, more critically, the susceptibility and resistance of those vectors to typical insecticides used. The major entomological surveillance projects in Nigeria are carried out in six designated sentinel sites across five ecological zones. However, this is primarily focused on Malaria since it is the predominant mosquito-borne disease in the country. Currently, no standard surveillance system is enacted to prevent an outbreak of most Flaviruses, including WNV and USUV. Taking a cue from the previous outbreak and occurrences of Highly Pathogenic Avian Influenza (HPAI) in Nigeria, its association with migratory birds, and the devastating socio-economic impact on the poultry industry in Nigeria, there must be an improvement in policy formation and development of surveillance programs in Nigeria and Africa. Also, routine serological evaluation of humans living near regions where migratory birds are known to be in Nigeria would help understand the effect of the virus on humans. Significantly, proper documentation and efficient disease reporting as valuable tools in the epidemiological assessment of mosquito-borne viruses should be emphasized. It could also be helpful to incorporate screening for Flaviviruses during blood transfusions. Currently, there are no specific licensed vaccines and drugs for managing USUV in humans and animals. The prevention of USUV infection in humans and animals can be achieved through controlling mosquito vectors involved in the circulation of the virus. In addition, an interesting critical control point for the prevention of USUV would be the mosquito-human interface. However, there is a very low incidence of USUV infection in the human population; thus, there is little urgency to develop potent vaccines and therapeutic solutions. Many challenges are associated with developing vaccines needed to elicit protective immunity against some Flaviviral infections. There are limited models available for use in vaccine production. Adult mice serve as good models for the development of vaccines because they serve as a good platform to access immune response to immunization and complications linked to vaccination, but only suckling mice are susceptible to USUV infection, and this is a major constraint. To further identify more models for USUV vaccine development, a research study evaluated the effect of USUV infection in Gallus gallus domesticus embryonated chicken eggs. Following infection, the USUV isolate could replicate well within the chorioallantoic membrane and the allantoic fluid. Also, there was dose-dependent death of the chicken embryos after infection. This study sheds more light on the pathogenesis of USUV infection and contributes to vaccine development. The envelope (E), and the membrane (M) proteins are good antigenic targets for flaviviral vaccines. In the quest to develop a vaccine for USUV, a single administration of recombinant plasmid encoding the envelope (E), and the pre-membrane (M) protein was performed intramuscularly in mice. This immunization elicited a good immune response and protection against USUV challenge. West Nile and Usutu virus share antigenic similarity. A study checked if attenuated West Nile vaccine can induce neutralizing antibodies against USUV infection using ifnar-/- mouse model. Mice vaccinated with the attenuated West Nile virus vaccine were challenged with African and European strains of USUV. The vaccinated mice exhibited lower viremia compared to unvaccinated group. This study shows that attenuated West Nile virus vaccine is protective against USUV. Some studies have revealed the ability of acetyl-CoA carboxylase inhibitors to block the replication of USUV in cell culture. Also, the use of drugs that prevent autophagy shows some potency against the replication of USUV in vitro.. Favipiravir, a broad-spectrum viral RNA polymerase inhibitor, was shown to reduce USUV load in a mice model. IFN-/ and IFN-receptor knockdown AG129 mice susceptible to USUV infection were used to evaluate the effect of Favipiravir on viremia caused by Usutu virus. AG129 mice were inoculated with the virus and treated with Favipiravir. The viral RNA was significantly reduced compared to the control animals. In addition, there was a reduction in the viral RNA level in body tissues.. Currently, more studies channeled toward vector control, discovery of vaccines, and antivirals specific for USUV infection are needed in Africa, especially Nigeria.

culex mosquitoes, usutu virus, flavivirus, migratory birds, public health

PMC4929387_01

Male

A 52-year-old man was admitted to our hospital due to ascites found during a medical checkup performed in a private clinic. At the time of admission, his health status was normal: blood pressure 139/86 mm Hg, pulse rate 73 beats/min, respiratory rate 20/min, and temperature 36.5 C. He had no apparent trace of the disease and was conscious. The breathing sound and the heart sound during the chest examination were normal. There was a little abdominal distension, but there seemed to be no increase in the abdominal circumference and no tenderness. In the course of the previous few months, he presented no change in weight or peripheral edema of the limbs. The peripheral blood examination showed normal findings, i.e. leukocytes 7,820/mm3, hemoglobins 14.8 g/dl, and platelets 220,000/mm3. The biochemical test results were as follows: C-reactive protein (CRP) 0.08 mg/dl, BUN 13.2 mg/dl, creatinine 0.87 mg/dl, AST 30 IU/l, ALT 38 IU/l, total bilirubin 0.56 mg/dl, and albumin 4.3 g/dl. The tumor marker test showed normal findings, i.e. alpha-fetoprotein 1.8 ng/ml, carcinoembryonic antigen (CEA) 2.0 ng/ml, and carbohydrate antigen 19-9 (CA 19-9) 11.5 U/ml. Abdominal computed tomography (CT) scans presented ascites of a moderate amount. The irregularly thickened peritoneum across the abdomen and the reticular membrane in the upper left abdomen formed a mass (fig. 1). Positron emission tomography of the whole body showed no increase in the 18F-fluorodeoxyglucose uptake. The paracentesis conducted after the hospitalization resulted in an erythrocyte count of 171/mm3, leukocyte level of 288/mm3 (lymphocytes 74%), albumin level of 2.0 g/dl, protein level of 2.7 g/dl, and adenosine deaminase level of 9.5 IU/l, and there was no MTB PCR and AFB stain. As the abdominal CT findings strongly suggested peritoneal cancer, diagnostic laparoscopy was conducted. The laparoscopic examination showed several cystic masses in the paracolic gutter forming a large mass (fig. 2a). There was much yellowish ascites, and multiple nodules of a size of 2-3 mm were widely spread in the abdominal cavity (fig. 2b). There was adhesion between the large reticular membrane and the pelvic wall. Biopsy was performed providing tissue of the size of 2 x 1.5 mm from the reticular membrane. The biopsy result showed several cysts of various sizes, which were surrounded by flat cubic epithelial cells (fig. 3a). Immunohistochemical staining was performed. As the biopsy did not stain for CD31 but strongly stained for calretinin and D2-40, the patient was diagnosed with BCM (fig. 3b). The patient was informed about the possible progression to malignancy and was recommended to have radical excision performed, but he preferred to wait since the symptoms were not yet apparent. We carried out an abdominal CT examination 2 months later. As there was no change in the lesion and there still was ascites, we recommended surgical treatment. However, he kept refusing it, and thus, we decided to continue monitoring the development.

ascites, benign cystic mesothelioma, peritoneal carcinomatosis

PMC8326808_01

Male

Patient No 02,048,211, male, 21 years old, 176 cm/67 kg, he went to the outpatient clinics due to intermittent fever for more than 2 months on Jan 30th 2020. The patient had fever on Dec 1st, 2019, without chills or other symptoms, Tmax of 38.2 C. He went to the local hospital and received some Chinese traditional medicine to relieve symptoms, from then on patient had intermittent low-grade fever. On January 30, 2020, patient suffered from gingival bleeding, he carried out some laboratory tests in the local hospital. CBC: WBC 28.63 x 109/L, Hb 94 g/L, PLT 7 x 109/L. Coagulation analysis: PT 15.5 s, Fib 120 mg/dL, d-dimer 2614 ng/ml. Chest CT showed infection in the upper and middle lobe of the right lung; localized atelectasis in the lingual segment of the left upper lobe and possible infection; and localized atelectasis in the lower lobe of the left lung (Fig. 1). The patient was controlled as a suspected case in the isolation ward according to fever, multiple pulmonary patchy shadows and a history of direct contact with relatives in Wuhan, although COVID-19 PCR of throat swab was negative three times. On Feb 1st 2020, the patient had dry tap bone marrow aspiration, and peripheral blood (PB) smear showed typical APL. The patient was treated with ATRA, Hu, allopurinol and sodium bicarbonate for leukemia and with imipenem for anti-infection and with adequate supportive transfusion of red blood cells, platelets, fibrinogen and prothrombin complex. On Feb 2nd 2020, patient complained about headache and dizziness. No abnormality was found on brain CT scan. CBC: WBC 25.95 x 109/L, Hb 62 g/L, PLT 8 x 109/L, and leukostasis was suspected and oral Vp-16 100 mg Qd (Brand name: Lastet; Manufacturer: kabuskiki kaisha Japan Co., Ltd) was taken to reduce tumor burden and dexamethasone 5 mg QD preventing DS. On Feb 10th 2020 coagulopathy was corrected completely. On Feb 12th 2020 PML-RARA (Bcr1 isoform) in peripheral blood was 80.0%, so APL (high-risk) was diagnosed. RIF 60 mg/kg/d were administrated. During the course of induction, patient suffered from intermittent fever, pulmonary infection and acute orchiepididymitis, so imipenem, vancomycin, oseltamivir and voriconazole were administrated for anti- infection. We monitored the complete blood count trend (Fig. 3-1). Hepatic function: ALT 21-72 U/L, AST 23-49 U/L, TBIL 12.1-14.7umol/L. On February 25th, 2020, the chest CT examination showed that both lung lesions returned to normal. On Mar 3rd, 2020, CBC: WBC 2.28 x 109/L, Hb 75 g/L, PLT 88 x 109/L, and peripheral blood smear showed no APL cells. On Mar 3rd, 2020, bone marrow aspiration showed no promyelocytes, PML-RARA quantification in bone marrow 8%. Lumbar puncture and intrathecal injection were performed to prevent central nervous system leukemia, routine biochemical test of cerebrospinal fluids showed no abnormality. The patient achieved hematological remission, and all other complications were cured. Case 1 patient was treated with VP16 750 mg and Hu 11 g in total, 35 days of ATRA (25 mg/m2/d) and 28 days of RIF (60 mg/kg/d), then morphological evaluation of bone marrow showed complete remission. The patient only suffered from grade 1 hepatic dysfunction, no renal dysfunction and no QTc prolongation. The coagulopathy was corrected completely on the 8th day after ATRA. CBC returned to normal on 45 days since the initial treatment. 34 g fibrinogen, 10 U red blood cells and 17 U platelets were infused in total.

acute promyelocytic leukemia, cytoreductive therapy, early deaths, high-risk

PMC5482537_01

Male

Juan (pseudonym) is a Caucasian male of Hispanic ethnicity who was eight years 11 months at the time of intake. Juan was adopted at age 17 months and no information is available about his development prior to that age. From adoption through the time of the evaluation he resided with his adoptive parents who were middle class and resided in a southeastern part of the U.S. His medical history was unremarkable. Juan's parents reported that they first became concerned about his behavior when he was about two years old due to high rates of noncompliant and disruptive behavior at home and in daycare. They also reported that he had been consistently disruptive in school starting from kindergarten. Juan had a history of treatment with psychoactive medications, including Focalin XR, Intuniv, Adderall, and Vyvanse, but these were discontinued prior to his enrollment in the treatment described here. He had previously received psychosocial treatment for behavioral and emotional control problems, which his parents described as moderately effective. Juan resided with his adoptive mother and adoptive father and had no siblings. Juan had recently completed third grade at his local public elementary school. Juan was referred for treatment by his mother due to her concerns about his disruptive behavior at home and school. Primary concerns from his mother included defiance, tantrums, verbal abuse, aggression, poor impulse control, inattention, excessive silliness, and low-frustration tolerance. Juan's mother and teacher reported that he did not seem to care about his performance (e.g., school work), did not seem concerned about feelings of others, did not keep promises that he made, and lacked remorse following misbehavior. His teachers also described him as lacking warmth and kindness. At school, Juan also struggled with inattention, hyperactivity, and poor peer relationships. Given these presenting concerns, Juan's mother sought to enroll him in a summer treatment program (STP) conducted at a university based mental health clinic. Juan's parents provided written consent for participation in this treatment study and Juan provided verbal assent. All procedures followed American Psychological Association standards for ethical collection and use of patient information, including disguising relevant information to hide the identity of the participating child. Diagnoses were determined using criteria specified in the fourth edition of the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV). Following recommended guidelines for evidence-based assessment of disruptive behavior, diagnoses were based on both symptom and impairment criteria as evaluated using multiple sources of information. Specifically, oppositional defiant disorder (ODD), conduct disorder (CD), and attention-deficit/hyperactivity disorder (ADHD) symptoms were evaluated using parent and teacher ratings on the Disruptive Behavior Disorders Rating Scale (DBDRS) and using parent responses to the computerized version of the Diagnostic Interview Schedule for Children for DSM-IV. Impairment was evaluated using parent and teacher ratings on the Impairment Rating Scale (IRS). These data (see Table 1) were independently reviewed by two Ph.D. level clinicians who each assigned Juan diagnoses of ADHD and ODD. The diagnostic evaluation also included an assessment of internalizing disorders. Anxiety, as measured by the Revised Children's Manifest Anxiety Scale 2nd edition, was in the normative range with a total anxiety T-score of 44. Depression, as measured by the Children's Depression Inventory 2nd edition, was also in the normative range with a total depression T-score of 44. CU traits were evaluated using two measures: the Antisocial Process Screening Device (APSD) and the Inventory of Callous-Unemotional Traits (ICU). As shown on Table 1, Juan's scores on these measures indicated very high levels of CU traits. His scores on the APSD place him in the top 1% (mother) to 5% (teacher) compared to other boys his same age. Likewise his scores on the ICU are substantially above recently proposed cutoffs on this measure. Treatment was implemented in an STP, which is an evidenced based treatment program for youth with disruptive behavior problems that is delivered in the context of a summer camp setting. The STP occurred five days a week (Monday through Friday) from 8:00 AM to 5:00PM for eight weeks. Juan was placed in a group with 17 other children ranging from six to twelve years of age, comprised of both boys (n=15) and girls (n=2). He attended 39 out of 39 days of the intervention (there was no treatment on the fourth of July). The primary approach to treatment was behavior management with a focus on positive reinforcement, effective commands, and immediate consequences. Using token reinforcement and response cost methods, Juan received points for appropriate behavior and lost points for inappropriate behavior as he engaged in activities throughout the day. Of most relevance to this study is that treatment also included use of a daily report card (DRC). Three behavioral targets were included on Juan's DRC: (1) interruptions, (2) rule violations during classroom activities, and (3) teasing peers. These goals were selected based on observations of his behavior during the first week of treatment, discussions with his parents, and inspecting information (ratings and written reports) from his classroom teacher in his regular school setting. Juan's goals on his DRC did not change during treatment, but the criteria that defined success on the goals varied from week to week as described below. The DRC was always backed by a reward system that consisted of the chance to earn free time at noon and again at the end of the day, along with home-based rewards delivered by his parents, which consisted of access to screen time (TV, computer, video games). This reward was determined through discussion with Juan, his parents, his lead counselor, and the clinical supervisor. Delivery of home rewards was encouraged by informing Juan and his parents at the end of each day whether Juan earned his reward and if so reminding parents to deliver the reward to Juan. The DRC was also one part of determining whether Juan earned a weekly reward; to participate in a fun field trip on Friday, Juan was required to have achieved at least 75% of his treatment goals on the majority of days in a given week. The majority of each day consisted of recreationally-based therapeutic group activities (i.e., basketball, soccer, baseball or kickball), an art period, lunch, and swimming. These were led by paraprofessional counselors that included one graduate student lead counselor and five undergraduate counselors. Behavioral treatment was delivered during these activities by using a token economy system and cognitive-emotional treatment was delivered between activities by using discussion, role playing, and problem solving. The remainder of each day (two hours) was spent in a classroom setting that was run by a teacher and teacher aide. Children completed individual seatwork (reading, math, writing) that was appropriate for their academic ability, followed by peer tutoring activities to foster reading skills. The behavior management used in the classroom was a response-cost system in that children began class with a set number of points and points were taken for each violation of a classroom rule, which included: be respectful of others, obey adults, work quietly, use materials and possessions appropriately, remain in your assigned seat or area, raise hand to speak or to ask for help, and stay on task. All activities were supervised by Ph.D. level clinicians. The treatment manipulation of interest was whether Juan reacted differentially to fixed versus randomly determined target behavior criteria on his behavioral goals on his DRC. That is, Juan always had the same three goals on his DRC, but the criteria used to determine whether he was successful in achieving the goal (i.e., his target behavior criteria) were decided in different ways -- either fixed ahead of time or randomly determined after the fact. For example, reducing interruptions was always a goal on his DRC, but the number of interruptions he was allowed display and still achieve a reward for reducing interruptions goal was either fixed or random, with condition varying across weeks of treatment. During the fixed-criteria weeks (weeks 2, 5, and 6), the target behavior criteria were determined a priori by his counselors who examined his past behavior and selected a number that represented about 20% improvement. This was done at the start the week and target behavior criteria remained constant throughout the week. Behavioral goals on his DRC, including the fixed criterion for achieving success at each goal, were reviewed with Juan at the start of each day (e.g., "you need to have four or fewer interruptions to meet your interruptions goal this morning"). If he met his criterion goal, a "yes" would be circled on his DRC. Throughout the day, Juan was prompted by staff to keep track of his behavior in relation to his criterion goals (e.g., "you have two interruptions and you can't have more than four to make recess"). Juan was assigned a counselor who reviewed his DRC target behaviors and criterion goals each morning and after each reward period. During the random-criteria weeks (weeks 3, 4, 7, and 8) the target behavior criteria were determined randomly and post hoc. Specifically, Juan was told that the number of behaviors on his DRC that he was allowed to display and still earn his reward was going to be a mystery that would be revealed just before the reward period. Behavioral goals were reviewed with Juan at the start of and throughout each day ("you need to work on reducing your interruptions today") but no specific target behavior criteria were provided. Instead, just before the reward activity that reinforced the DRC, Juan chose a number out of a bag and this number became the target behavior criterion for earning his reward. The range of possible criterion goals (i.e., the numbers placed in the bag to draw from) were based on Juan's behavior during the baseline week (i.e., first week of treatment) and ranged from one to 30. The effect of fixed versus random criteria on the DRC was examined using an alternating treatments design in which the two treatment conditions were presented in an alternating manner. The first week of treatment was used to establish baseline rates of behavior without a DRC in place. The DRC was introduced the second week of treatment, with order of fixed versus random criteria determined by chance. Target behavior criteria procedures were changed weekly rather than daily to maximize Juan's ability to discriminate the treatment conditions, thereby reducing carryover effects, and order of treatment was determined randomly to reduce sequential confounding. Following recommendations, data were examined three ways. First, data were examined visually to illustrate overall trends in the different treatment conditions. Second, alternation randomization tests were computed. This was done by comparing the observed mean difference between the treatment conditions to mean differences randomly generated from the data. Specifically, a difference score was computed for all 35 possible combinations of weeks (e.g., average of weeks 2, 3 and 4 minus average of weeks 5, 6, 7, and 8; average of weeks 2, 3 and 5 minus average of weeks 4, 6, 7, and 8; etc.), including the actual randomization used in the study (i.e., the observed treatment difference). The proportion of the 34 randomly generated mean differences that exceed the one observed treatment difference are reported. Third, three within-subject standardized mean difference effect sizes were computed: (a) fixed-criteria versus baseline; (b) random-criteria versus baseline; and (c) random criteria versus fixed criteria. Effect sizes were computed by subtracting the two conditions and dividing the result by the standard deviation averaged over all conditions.

oppositional defiant disorder, behavioral treatment, callous-unemotional, child, conduct disorder

PMC8992769_01

Female

A 27-year-old female patient was admitted to Trakya University Hospital with a history of recurrent fever, weight loss, and intermittent lumbar back pain lasting for one month. The patient also reported persistent headache, chills, and night sweats. She has no history of TB exposure or chronic lung disease. Cranial and lumbar magnetic resonance imaging (MRI), thoracic and lumbar computed tomography (CT), and whole-body 18F-FDG PET/CT were taken upon her complaints (Figures 1, 2, 3). Based on the symptoms and the examinations, meta-static disease or bone tuberculosis was suspected. Subsequently, to make the definitive diagnosis, open biopsy was performed under the L2 lamina and L2 vertebral bodies. Histopathological examination showed local sequestrum formation. Langerhans cells were detected with giant cells and dead bones, which are the characteristic features of TB disease.

PMC6077018_01

Female

A 60-year-old Saudi woman was admitted through the emergency room for progressively worsening dyspnea, dry cough and mild fever of two weeks duration. The patient had been well until two years earlier, when she presented to another hospital with slowly increasing dyspnea and dry cough. A diagnosis of LIP was established on bronchoscopic biopsy. Since that time she had been on the oral steroids Imuran (azathioprine) and Ventolin (albuterol) inhaler. She denied any history of tuberculosis, exposure to chemicals, organic dust, toxic gas, molds, bird feed or smoking. She was not known to have diabetes, hypertension or heart disease. On physical examination she was mildly febrile and dyspneic, but not hypoxic. There was no finger clubbing or pitting edema. Chest auscultation found inspiratory crackles bilaterally. Cardiac, CNS, abdomen, pelvic, breast and neck examinations were unremarkable. Initial laboratory work up showed elevated ESR (56 mm/h) and a normal CBC, liver and renal function tests. Rheumatoid factor, anti-DNA, antineutrophil and HIV serology were negative. Admission chest radiographs revealed multiple dense and ill-defined nodules of variable size in both lungs for which the patient was evaluated with CT. A high-resolution and conventional CT (Figure 1) of the chest revealed multiple calcific nodules of 0.3 cm to 5 cm size predominantly distributed in the mid-lower lungs subpleurally and peripherally. The calcification was dense and homogenous in the smaller nodules, while irregular and amorphous or punctate in the larger nodules. Consolidations with a variable degree of amorphous and punctate calcifications were noted at the right upper lobe posterior segment, middle lobe and at lung bases. A cavity with a small fluid level and smooth inner wall was present in the right lower lobe consolidation (Figure 1E). Randomly distributed multiple thin-walled air cysts of varying size (0.3 cm to 6 cm) were present in both lungs. There were a few small and discrete reactive lymph nodes in the superior mediastinum. There was no evidence for calcific lesions in the heart musculature. Pleural, pericardial effusions or thickening were absent. Given these radiologic findings, the differential diagnoses were limited. We considered metastatic disease, tuberculosis, amyloidosis and Wegener's granulomatosis. A technicium MDP bone scan was requested, revealing no abnormal uptake in the skeleton, but most of the large calcific nodules in the lung did show increased tracer activity mimicking rib metastasis (Figure 2). There was no tracer uptake in the heart and extrathoracic soft tissues. The patient was further evaluated clinically and radiologically for a primary malignancy. An ultrasound examination of the neck for thyroid and CT scans of the abdomen and pelvis were non-rewarding. We arrived at a diagnosis of metastatic lung disease from an unknown primary tumor or amyloidosis, and a CT-guided transthoracic core biopsy was performed with an 18-gauge needle. A lung core biopsy was fixed in neutral formalin and processed for paraffin embedding. Histologic tissue sections were stained with hematoxylin and eosin stain. After the initial observations, Congo red staining was performed and studied by light and polarized microscopy. Automatized immunohistochemistry was carried out using antigen unmasking and streptavidin peroxidase methods. Commercial antibodies included kappa and lambda. The H&E sections (Figure 3) revealed a variable density of plasma cell infiltration and amorphous interstitial substance with focal microcalcifications. No preserved lung tissue was discernible. Plasma cells showed no atypical features. The amorphous substance showed variable eosinophilic intensity, and stained positive for Congo red, which under polarized light displayed a characteristic "apple-green" color. The vast majority of plasma cells were positive for a kappa light chain (Figure 4). A pathologic diagnosis of amyloidosis with kappa-light-chain restriction was established.

PMC6594314_01

Female

A 45-year-old obese postmenopausal female with a history of coronary artery disease (CAD), hypertension, hyperlipidemia, diabetes, and chronic angina was brought to the Emergency Department midsummer after a motor vehicle accident (MVA) in which she was the restrained driver. While stationary, she was struck by another vehicle from behind at a high rate of speed with immediate airbag deployment. Though the patient did not lose consciousness at the scene and had self-extricated prior to EMS arrival, she requested hospital transport for further evaluation of chest, neck, and back pain. On initial evaluation, the patient complained of chest pain primarily across her left chest and shoulder in a seatbelt-type distribution, though she did also endorse some bilateral chest wall pain, diffuse midline neck pain, and low back pain. In addition to her cardiac risk factors, her medical history was significant for anxiety, gastroesophageal reflux disease (GERD), migraines, and fibromyalgia. Her home medications included escitalopram, buspirone, pantoprazole, ranitidine, aspirin, clopidogrel, evolocumab, and isosorbide mononitrate. She had an extensive surgical history including a total abdominal hysterectomy, bilateral salpingo-oophorectomy, coronary artery bypass grafting (CABG), and placement of coronary stents. She denied current use of tobacco, alcohol, or illicit drugs. She had just been admitted to the hospital for unstable angina a few months prior, at which time cardiac catheterization was performed, demonstrating three patent bypass grafts: right internal mammary artery (RIMA) to left anterior descending artery (LAD), left internal mammary artery (LIMA) to obtuse marginal artery, and a saphenous vein graft from the proximal aorta to the proximal right coronary artery (RCA). One saphenous vein graft from the posterior descending artery (PDA) to the posterolateral ventricular artery segment was occluded, though this was not a new finding as it was first discovered to be occluded several years ago. Both previously placed drug-eluding stents in the second marginal and left circumflex arteries were widely patent. The catheterization also demonstrated severely diseased and diffusely calcified coronary arteries, with 95% occlusion in the proximal LAD and 100% occlusion in both the first marginal artery and the mid to distal RCA. Of note, her stenosis had worsened since her last catheterization one year earlier, which showed 70% occlusion in the mid-LAD, 90% occlusion in the distal LAD, and 90% occlusion in the mid to distal RCA. No intervention was performed during either catheterization procedure. Physical exam revealed that the patient was in notable distress and had diffuse midline spinal and paraspinal tenderness, as well as chest wall tenderness. Her pulse was 100/minute, temperature 37.6 C, blood pressure 157/119 mmHg, respiratory rate 16 breaths/min, and SpO2 99% on room air. Chest radiographs and head computed tomography (CT) scans were unremarkable, and the aorta had a normal course and caliber on thorax CT scan. Electrocardiogram (EKG) was also unremarkable, without any ST depression or elevation, T wave inversions, or QTc prolongation noted. Laboratory workup revealed an elevated troponin-T level at 0.564 [normal <0.010]. The patient was not hyponatremic. Three hours later, her troponin-T level decreased to 0.459. BNP, CK, and lactate levels were not obtained. Cardiac contusion secondary to blunt chest trauma from the MVA was suspected as the initial diagnosis. The patient was admitted to the acute cardiology service and underwent a transthoracic echocardiogram the following morning, which demonstrated reduced systolic function with an ejection fraction of 35%, diffuse areas of mid to apical hypokinesis, and hyperkinesis in the anterior and inferior basal segments (Figure 1). Previous echocardiograms completed three months and one year prior to this episode did not show these abnormalities; those studies lacked wall motion abnormalities and demonstrated normal systolic function with ejection fractions of 60% and 65%, respectively. Thus, these new wall motion abnormalities and reduced systolic function in conjunction with elevated cardiac enzymes, a normal electrocardiogram, and the patient's clinical presentation were consistent with a diagnosis of stress-induced cardiomyopathy. She was started on a beta blocker and discharged the next day. A follow-up echocardiogram four months later demonstrated return of systolic function with an improved ejection fraction of 55% and normal wall motion, indicating complete resolution.

PMC3543948_01

Male

A 23-year-old male presented with mild intermittent peri-umbilical pain and low-grade fever for 3 months. There was a history of loss of appetite and weight loss (4 kg over 3 months). The patient's bowel and bladder habits were normal. There was no significant medical or surgical history. On examination, the patient's vitals were stable and his physical examination was normal except for a well-circumscribed, non-tender mass, about 5 x 5 cm in size, which was palpable in the infra-umbilical area. A routine hemogram, serum biochemistry, liver function, and renal function tests were within normal limits. A chest X-ray revealed no abnormality. Urinalysis revealed occasional pus cells, but the culture was sterile. Contrast-enhanced computed tomography (CT) of the abdomen was suggestive of a smooth-walled, cystic mass measuring 5 x 5 x 6 cm, located above the bladder (Fig. 1). Fine-needle aspiration cytology revealed necrotic material. With a clinical diagnosis of an urachal abscess, surgical excision was planned. At surgery, the mass was located in the pre-peritoneal space, just above the bladder. It was filled with white pultaceous material. With gentle blunt and sharp dissection, the mass was separated from the bladder and could be excised en bloc (Fig. 2). On histopathological examination, urothelium was found along with multiple granulomas, caseation, and epitheloid and Langhans cells, suggestive of urachal tuberculosis (Fig. 3). On the basis of these results, the patient was started on combination anti-tubercular therapy with rifampicin, isoniazid, ethambutol, and pyrazinamide, which were given for 2 months. Culture of the pultaceous material on Lowenstein-Jensen media confirmed the presence of Mycobacterium tuberculosis; the bacilli were sensitive to isoniazid, rifampin, and ethambutol. Blood, sputum, and urine cultures performed three times during the post-operative period were sterile. The patient was then continued on a combination of rifampicin and isoniazid for 4 months, according to national guidelines. The patient completed the treatment and is doing well. Follow-up CT of the abdomen after the completion of anti-tubercular treatment revealed no evidence of disease.

cysts, infection, tuberculosis, urachus

PMC3124991_01

Male

A 7-year-old male child presented with complaints of painless progressive swelling in the left scrotum noticed by parents for last 1 month. The patient had an unremarkable birth history and no significant past medical history. There was no history of trauma. On physical examination, the child was well nourished with normal developmental milestones. He had a normal uncircumcised phallus and a descended right testis. The left half of scrotum was enlarged, tensely cystic in consistency, and nontender. The scrotal skin of the left side was stretched. The swelling was not compressible but transilluminated brilliantly [Figure 1]. The left testis was not palpable. There was no regional lymphadenopathy. The clinical diagnosis of hydrocele was made initially. On scrotal ultrasound, on the left side, unexpectedly there was no hydrocele; left testis was 13x23x21 mm (6.2 cc) in size and parenchyma was hypochoic as compared to right testis. Multiple tiny specks of parenchymal calcification were also noted. On color Doppler study, there was generalized hypervascularity as compared to the right side. Left epididymis was hypoechoic, hypovascular, and thickened. Right testis was homogenous in appearance and measured 22x11x10 mm (2.4 cc). The ultrasonologist reported it as suspected chronic epididymo-orchitis, and it may be tubercular. Additional investigations like complete blood count, liver function test, renal function test, chest X-ray, beta-HCG, serum alfa-fetoprotein (AFP), montoux test, ELISA for tuberculosis were conducted. All investigations were within normal limit. During surgery, the testis was approached through a left inguinal skin crease incision. Vas and vessel were temporarily occluded after opening the inguinal canal. The testis was delivered, which looked normal in appearance but size was larger. On incising the testis, white gelatinous material with yellowish-white flakes came out and no solid component was found [Figure 2]. Orchidectomy was performed. The histopathological finding revealed benign mature cystic teratoma testis with component of all three germ layers, confined within the left testis [Figure 3]. At 3-month followup, the child is asymptomatic.

hydrocele, prepubertal testicular tumor, teratoma testis, testicular tumor

PMC7568117_01

Male

A 37-year-old male presented with progressive lower extremity paraparesis of 3 years duration (motor power of 3/5 in both legs with a 0/5 left foot drop for 1 year). There were no history of back pain, significant trauma, spinal surgery/lumbar puncture, or tuberculosis. The thoracic MR showed, on axial cuts, an arachnoid cyst with lateral extension into both neural foramina between the T12-L1 levels; no further lesions were noted on the cervical or lumbar MR studies. The patient underwent L1 preserving laminectomies from T11 to L2 [Figures 1-3], revealing a distended cyst. Thinning of the dura with arachnoid herniation was observed involving both T12-L1 neural foramina (e.g., especially on the right). The dural defect was directly repaired using a nonabsorbable monofilament suture made of expanded polytetrafluoroethylene (GORE-TEX) plus application of a small muscle patch graft. The wound was then routinely repaired in layers, with a drain placed in the epidural space. The histopathological examination revealed collagenous tissue within the wall of the cyst with occasional cuboidal and flattened cells, suggestive of a meningothelial reaction. Immediately after surgery, the patient had dramatic relief in his symptoms. The follow-up MRI 3 months later confirmed complete excision of cyst and thecal sac decompression. By 9 postoperative months, the patient was completely asymptomatic.

arachnoid cyst, compressive myelopathy, extradural, india, meningeal cyst, spine

PMC7689508_01

Unknown

Both of the judges, one Chief Judge in a District Court and one former District Court judge now working in a Court of Appeal, reported a shift towards conducting urgent Court hearings only or primarily. The urgent hearings entailed inter alia cases where legal deadlines apply, for example because the suspect is detained awaiting trial. Other hearings are cancelled or postponed. Both the prosecution and the defense are often offered to participate via videolink and this is usually accepted by the parties. One of the judges (Chief Judge in the District Court) reported that inside the Court room, social distancing rules are applied so that individuals in the audience are sitting only on every other chair. Also, lay judges over 70 years old are not taking part in the proceedings. Both of the judges reported increased remote working, online meetings and social distancing rules being applied among staff. As outlined in Fig. 1 below, most of the practitioners perceived of the measures undertaken as sufficient, with a mean rating of 7.70 (out of 10). Among the two defense counsels, the ratings varied the most, with the lowest rating being 4 and the highest rating being 9. When asked to provide explanations of their ratings, one of the police officers, who had given a rating of 8, reported that the number of staff on sick leave was actually lower during the pandemic than before. Hence, this constitutes a difference compared to the reports in Swedish media according to which many police officers belonging to another geographical area (Gothenburg) had contracted the virus and were unable to work. The other police officer explained his/her rating of sufficiency (also 8) differently, namely that there is a shortage of sanitizers for cleaning surfaces etc. Similarly, both of the forensic pathologists stated the measures undertaken were reasonable given what is known about the infection risk, while one of them (rating 7) expressed difficulty with ensuring that locks (sluices) are functioning appropriately to separate clean and soiled areas in the ward. Also the prosecutors believed that the measures undertaken were sufficient overall but one of them commented that it is difficult to maintain social distancing when appearing in person in Court. The defense counsel with the highest rating (9) thought that the infection risk was sufficiently reduced through increased remote working and the social distancing applied in the office. However, the other defense counsel, who works in another office and another geographical area, with the lowest rating (4) expressed that only a few measures had been undertaken apart from social distancing as: "we cannot stop seeing clients in person". Both of the judges considered the undertaken measures sufficient and expressed that they had abided by the relevant recommendations from the authorities. Across all categories of practitioners increased remote working as well as online methods for meetings, briefings, presentation of cases/reports or Court participation were reported, although with some individual variation (primarily among the defense counsels), see Fig. 2 below. Hence, these results are similar to those found in the US and Canada, although it seems online methods are used to different extent in the Courts in these respective countries. There were also many examples of cancelled or postponed events (Court hearings, conferences, supplementary training etc.). One of the prosecutors had decided for him/herself to not work from home and one defense counsel could not work from home because of the necessity to see clients in person in his/her work setting. The Chief Judge from the District Court also reported that he/she faced some challenges with keeping the staff motivated and to maintain group cohesion. Among the police, one of the officers with managerial responsibilities reported an initial increase in his/her work load due to the need to plan and establish new routines. For the other police officer, the work load had remained more or less the same. The pathologists reported that the case flow was slower due to the new autopsy routines and also that there was less administration, which is similar to the findings reported from Italy. One of the pathologists reported that he/she now spent more time explaining COVID-19 related issues/difficulties to the police. The prosecutor who had been working from home experienced that he/she gets the same job done in fewer hours and that the digital meetings save time as one does not have to move physically from and within the work place. However, the prosecutor who did not remote work reported that the work load had been constant before and after the pandemic. The defense counsels both reported a more or less constant work load. One of them explained that, despite being in the middle of a pandemic, he/she was still working with large cases in the District Court. The other defense counsel explained that for cases in which the suspects have been deprived of their liberty the work load was the same, while it was reduced for other cases due to cancelled Court hearings. Similar to the police, the judge with managerial responsibilities (Chief Judge, District Court) reported an initial increase in work load due to the necessity to establish new routines. However, this went back to normal again as hearings were cancelled. The other judge reported that the total work load had been constant although there had been a shift in the sense that he/she works more with presentation of cases/reports and less with hearings. Notably, these developments are expected and also consistent with what has been reported from Canadian and American Courts where staff e.g. have to learn new technology and adjust to their new work situations. As illustrated in Fig. 3 below the overall perceived impact of COVID-19 on work load was fairly low, although with some variation across categories of practitioners as well as individual practitioners. The police reported that the number of burglaries is reduced significantly since the outbreak of the virus. Hence, staff assigned to investigate burglaries can instead support investigations regarding e.g. vehicles. However, in relation to gross crimes, the police reported that the numbers from May 2020 are not any different than those from 2019. One of the police officers reported that more serial crimes were investigated, following a somewhat reduced work load. None of the pathologists, prosecutors or defense counsels reported any changes in the type of crime suspicions, evidence etc. that they were working with. Neither the judges reported such differences but both of them explained that with the pandemic more preparatory was conducted instead of hearings. Also, the judges reported that more decisions are made in cases which can be decided on the basis of documents alone. As outlined in Fig. 4, the police and the judges reported the largest impacts on work character. The responses provided by the practitioners can also be compared to the official statistics from The Swedish Police Authority concerning the incidence of reported crimes nationwide. These statistics entail comparisons between crimes reported in March-April 2019 and in March-April 2020. The largest decrease was in relation to crimes of theft (-18.20%) while the largest increase was in relation to narcotic drug offences (+13.10%). Violent crimes against individuals had decreased (-8.40%). Although decreases and increases in reported crimes do not necessarily mean that the actual incidence of crimes has changed, these statistics, as well as what is reported by Swedish practitioners seem to differ from what is reported so far from Italy, the US and Canada. In these countries there are not (yet) any reports of decreases in burglaries but instead increases have been noted in relation to gross crimes including gun violence and assault. It is unknown whether these noted differences are real and constant over time, or instead products of the limited information currently available. One of the police officers explained that since their work is conducted on the basis of best practice and guidelines, the work quality has not been impacted by COVID-19. The other police officer thought this question was difficult to answer but expressed a concern that the processing times at the National Forensic Centre (NFC) are longer than before. One of the pathologists stated that "there is a risk of missing important information when full autopsies are replaced by external examinations." He/she added that crime scene investigations may be complicated due to the usage of Personal Protective Equipment (PPE), since it results in reduced hearing, smell and sight. However, the other pathologist believed that the final products were better since more time could be spent on each case. One of the prosecutors believed that digital meetings cannot fully replace ordinary real-life meetings when it comes to exchange of information and collaboration. The chances to interact and consult with colleagues more informally are reduced, which to a certain extent can impact on the work quality. The other prosecutor saw no differences in work quality. One of the defense counsels noted that the quality of phone meetings was sometimes impeded due to technical issues. Also, this defense counsel noted that when the Courts conduct witness interviews via phone, this may have an impact on the judges' assessments on witness credibility and reliability. The view of this defense counsel is in line with current day research suggesting that the format in which witnesses' as well as plaintiffs' testimonies are presented significantly influences perceptions of them and their testimonies. For example, live testimonies are often considered more detailed and reliable than those presented via video or audio recordings. It is unknown what the effect will be of the more general shift towards using technology rather than in Court testimonies following the pandemic. The other defense counsel believed the work quality was more or less constant. One of the judges noted that the balance between incoming and outgoing cases has been impacted since many hearings have been cancelled. This has resulted in that the processing times are longer. The other judge stated that since the Court is prioritizing some cases above others the balances and processing times are worse for some types of cases but better for other types of cases. However, he/she did not think there were any other impacts on quality. These findings are similar to the backlogs reported in American and Canadian courts. As illustrated in Fig. 5, pathologists reported the largest impact on work quality. However, as noted in their responses above, one of them perceived of this impact as negative and the other one as positive. One of the police officers reported practically no fear of contracting or spread the virus since he/she works with the same people every day and due to the preventive measures undertaken in their work place. The other police officer was mostly concerned about travelling to work because of an increase in the number of people using public transport. He/she stated that: "I know I take responsibility and stay at home even at the slightest sign of being ill, but I am not sure everyone else is doing the same." One of the pathologists explained that "autopsy work entails an obvious risk to be exposed to aerosols from body fluids". He/she explained that, in fact, a number of his/her colleagues have contracted COVID-19, although it is always difficult to know exactly when, where and how they contracted it. The other pathologists did not fear contracting the virus, since he/she believed the exposure to COVID-19 is small and under controlled circumstances. One of the prosecutors stated that since the virus can be transmitted also by non-symptomatic individuals "the risk is everywhere and not larger in relation to the work place than other places, such as the grocery store." The other prosecutor did not feel particularly concerned to contract or spread the disease. One of the defense counsels stated that he/she was exposed to many different individuals, for instance in small Court rooms, visits at detention centers and other contacts with clients. He/she added that a colleague had to travel by plane on repeated occasions within Sweden in order to attend a Court hearing. The other defense counsel perceived of the risk as pretty low since he/she avoids the work place and it has been empty for a long time period. In the assessment of one of the judges, the largest risk is when travelling by train to the Court which he/she does practically every day, particularly since the trains are becoming more and more crowded, following an initial period when most people were working from home. The other judge reported that: "Even though we abide by social distancing, a day at work entails quite a few meetings, but I am rarely very worried." As outlined in Fig. 6, the judges and the defense counsels reported higher perceived risks of contracting or spreading COVID-19 than the police, pathologists and prosecutors, although this should be read in conjunction with the explanations above. While there is large individual variation in the pathologists' ratings (0,7), it can be questioned how a pathologist who directly interacts with a potentially or known COVID-19 positive body perceives of the risk as lower than a judge sitting in a Court room or a defense counsel interacting with his/her client. The more specific reasons for this are unknown but one possibility is that pathologists have access to and experience in using Personal Protective Equipment (PPE) and are also expected to use it, unlike judges and defense counsels who are left to social distancing measures which may appear more uncertain in effect and/or more difficult to apply in practice. One of the police officers indicated some positive impacts of COVID-19 such as improving the preparedness to organize quick operative online meetings. He/she stated that it is likely they will continue working with such meetings also after the pandemic is over. Furthermore, the police stated that there are some remaining questions e.g. how to deal with items and bodies in safe ways. Not having any specific answers to these questions yet has been a cause of concern among some of the staff members. One of the pathologists explained that they have been asked to answer some more general questions like whether elderly homes have undertaken adequate preventive measures in relation to COVID-19. According to this pathologist, such questions are impossible for them to answer. One of the prosecutors added that sometimes witnesses do not want to come to Court due to the infection risk, which is far from ideal. One of the defense counsels stated the inflow of cases to the firm was poor initially but that it is back to normal now. One of the judges explained that some of the co-workers have been quite worried, and as their boss he/she has tried to deal with it appropriately. The worries have been general, in relation to the society, but also following new routines and instructions. Some co-workers have had issues working from home, as they feel stressed, ineffective or isolated. The other judge explained that in his/her opinion all the measures undertaken should be evaluated as to whether they are really necessary.

covid-19, crime, sweden

PMC5388347_01

Female

On March 26, 2016, a 27-year-old woman visited the infectious diseases outpatient department because of persistent arthralgias and rash. She works as a stewardess on a cruise ship and she stayed in Costa Rica for 2 months where she developed symptoms; then she returned to Croatia on March 21. Six months before this illness, she was vaccinated against yellow fever. She remembered a mosquito bite on her left forearm because she noticed a little hematoma around the indurated papule which she had not experienced after earlier mosquito bites. Five days after the mosquito bite, on the first day of her disease, she felt symmetrical arthralgias in her ankles, knees, wrists, and elbows but also in small joints of her hands and feet. The third day, she developed high fever up to 38.5 C with chills. Her arthralgias deteriorated, so she could hardly walk. On the fifth day of her illness, an itchy rash appeared on her trunk, and the next day it extended to her face, extremities, as well as palms and soles. The erythematous papular rash subsided in the next 2 days. At the same time, she became afebrile, while arthralgias remained up to the tenth day of her illness after which she was feeling well, but exhausted. During the acute phase of her illness, she had nausea and she had a few loose stools too. Ten days after she had recovered, severe arthralgias in her ankles, elbows, right shoulder, and in the small joints of hands and feet reappeared. She also complained about morning stiffness lasting for 10-30 min. On the initial visit (day 15 after the disease onset), the physical examination was normal except for rash on the trunk, extremities, palms, and soles (Figure 1). Routine laboratory tests were normal, except for slightly elevated liver transaminases, erythrocytes 4.35x1012/L (reference range [RR]: 3.86-5.08), leukocytes 8.4x109/L (RR: 83.4-9.7), lymphocytes 21.5% (RR: 20-46), C-reactive protein 1.3 mg/L (<5), platelets 219x109/L (RR: 158-424), BUN 5.4 mmol/L (RR: 2.8-8.3), creatinine 70 micromol/L (RR: 63-107), aspartate aminotransferase 32 U/L (RR: 8-30), alanine aminotransferase 51 U/L (RR: 10-36), gamma-glutamyl transferase 21 U/L (RR: 9-35), and lactate dehydrogenase 196 U/L (RR: 25-241). According to the case definition proposed by the international chikungunya expert group (2015), which distinguishes 4 chikungunya case categories; acute clinical case, atypical case, severe acute case, and suspected and/or confirmed chronic case; our patient was classified as a confirmed chronic chikungunya case. The patient was treated with non-steroidal anti-inflammatory drugs and paracetamol. She was regularly followed up during the next few months in order to treat her arthralgias and also to observe the progress of her illness. Her symptoms ameliorated, but 3 months later she still reports arthralgias. Due to similar geographical distribution and clinical symptoms, the serum sample (taken on day 20) was initially tested for CHIKV IgM/IgG antibodies, using indirect immunofluorescent assay (IFA; Euroimmun, Lubeck, Germany) as well as Zika virus (ZIKV) IgM/IgG and dengue virus (DENV) IgM/IgG antibodies using enzyme-linked immunosorbent assay (ELISA; Euroimmun). To exclude potential cross reactivity with other arboviruses, the sample was additionally tested for West Nile virus (WNV) and Usutu virus (USUV) antibodies using ELISA (Euroimmun), as well as yellow fever virus (YFV), Japanese encephalitis virus (JEV), and tick-borne encephalitis virus (TBEV) using IFA (Euroimmun). Serology results are presented in Table 1. CHIKV IgM and IgG antibodies were detected with titre 1:100 and 1:10,000, respectively (Figure 2). In addition, postvaccinal YFV IgG antibodies were found (titer 100). There was no cross reactivity with other tested arboviruses. In addition, the sample was tested for the presence of CHIKV RNA using a qualitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) according to the protocol described by Smith et al. For nucleic acid isolation, an automated system QIAxtractor (QIAGEN, Hilden, Germany) was used. Real-time RT-PCR was performed using a single-tube RT-PCR test kit (Invitrogen SuperScript III Platinum One-Step Qualitative Kit; Carlsbad, CA, USA). The amplification and detection were performed with 7500 Real Time PCR System (Applied Biosystems, Foster City, CA, USA). The test tube contained a 25-microL reaction mixture which included 5 microL of isolated RNA, 0.2 microM forward primer (CCGAAAGGAAACTTCAAAGCAACT), 0.2 microM reverse primer (CAGATGCCCGCCATTATTGAT), and 0.1 microM probe (FAM-GGGAGGTGGAGCATG-MGB). The reaction mixture was exposed to a 30 min 50 C reverse transcription step, 2 min of Taq activation at 95 C, and 50 cycles consisting of 95 C for 15 sec and 55 C for 32 sec. No CHIKV RNA was found in the tested sample. Sensitivity of the RT-PCR is reported to be high (0.3 plaque-forming units; PFU/mL), as is specificity (no cross reactivity with the most common alphaviruses that contained a minimum of 3 log10 PFU of heterologous viral RNA).

croatia, chikungunya, imported

PMC6479785_01

Male

A 19 year-old-spastic man arrived at our emergency department with abdominal distension, vomiting, and fatigue for 3 days. He also had a low-grade fever for 2 weeks. Since birth, he has been diagnosed with CP and has been living in a disabled children's center as a disabled person. His abdominal pain could not be assessed due to his mental status. Physical examination confirmed low-grade fever and showed signs of dehydration and enlarged cervical lymph nodes. There was a presence of abdominal distension with decreased bowel sound and mildly generalized tenderness. Laboratory tests revealed a total white blood cell count of 17,000 per microliter and a neutrophil count of 90%. Test for human immunodeficiency virus was negative. Abdominal radiography showed ileus with dilatation of both small and large bowel (Fig. 1). Due to suspicion of infection, computed tomography (CT) scan was obtained showing a diffusely thickened bowel wall, generalized small and large bowel dilatation, and ascites at the cul-de-sac (Fig. 2). There was no point of obstruction. The appendix could not be outlined and no pneumoperitoneum was found. Initially, intravenous 1 g ceftriaxone and 500 mg metronidazole were started. Following a day of observation, there were sudden changes of abdominal signs. His abdominal signs got worse revealing increased distension, generalized involuntary guarding and marked tenderness at the right side of the abdomen. As a result, a diagnosis of perforated appendicitis was made, as it is commonly founded in this group of patients with peritonitis. Consequently, the patient was transferred to operating room. At the theatre, there was a presence of small and large bowel dilatation without a point of obstruction or perforation. Interestingly, there were multiple small nodules at the serosa of small and large intestine, mesentery, parietal peritoneum, and cul-de-sac (Fig. 3). Clear yellowish ascites about 500 mL at cul-de-sac were obtained. Only the peritoneal tissue biopsy was performed. No acid-fast organism was seen in ascites. The pathologic report unfolded caseous granuloma with a positive 1+ Ziehl-Neelsen staining and a positive PCR for tuberculous complex. The tissue culture result was positive for Mycobacterium TB. Therefore, the sputum was sent for Ziehl-Neelsen stain and found positive 1+. Post-operatively, abdominal distension and bowel movement had improved after taking anti-TB medication. Unfortunately, however, the patient passed away on post-operative day 11 due to Acinetobacter baumannii hospital acquired pneumonia.

case report, cerebral palsy, peritonitis, tuberculous

PMC6802557_01

Female

A 56-year-old never smoking woman was admitted to our Lung Cancer Center with no symptoms, but a big mass was found in the left lower lobe (Computed tomography (CT) of the chest) through annual healthy check-up. She denied hepatitis, tuberculosis, or other infectious disease, and had no history of smoking, drinking, allergies, or surgery. There was no obvious change in body weight. An enhanced CT of the chest, whole abdomen, brain, and nasopharyngeal and a whole body bone scan were arranged. The enhanced CT of the chest showed a bulky soft tissue mass in the left lower lobe with lobulated, burr sign, and the largest cross-section size was about 6.4x6.0 cm. Furthermore, the left lung door and mediastinal lymph nodes showed enlargement. There were no trachea bronchial stenosis and no pericardial or pleural effusion (Figures 1A1, A2, B1, and B2). The enhanced CT of the whole abdomen showed a kind of circular low density shadow of 4.1x3.6 cm in the liver (Figure 1C). The brain and nasopharyngeal enhanced CT and the whole body bone scan were roughly normal except some focal ischemia, deputy nose, and hypertrophy of bilateral inferior turbinate (Figures 1D-F). Serum tumor markers indicated cell keratin fragments antigen 21-1 (CYFRA21-1) and neural specificity enolase (NSE) were higher than the normal values (10.38 ng/mL vs <3 ng/mL and 22.62 ng/mL vs <15 ng/mL, respectively). Carcinoembryonic antigen (CEA), serum carbohydrate antigen 125, 19-9, 15-3, and 72-4 (CA125, CA19-9, CA15-3, and CA72-4) were all negative. Other abnormal blood test results including heat shock protein 90alpha (HSP90alpha) and erythrocyte sedimentation (ESR), especially EBV-EA-IgG was 158.14 RU/mL which was almost eight times higher than normal value. In order to define the diagnosis, fiber optic bronchoscope (FOB) and percutaneous lung biopsy were performed. All levels of the bronchial lumen were normal through the FOB, and the biopsy showed only chronic inflammation. However, percutaneous lung biopsy prompted lymphoepithelioma-like carcinoma combined with the results of hematoxylin-eosin (HE) and immunohistochemical (IHC) staining. IHC staining demonstrated PCK (+), P40 (+), CK5/6 (+), EBER1/2-ISH (+), CK7 (-), TTF-1 (-), and PD-L1 (+, positive proportion about 80%, antibody SP142, ZSGB-BIO Company) (Figure 2). The findings from next generation sequencing (NGS) were negative for mutations in EGFR, KRAS, and BRAF and negative for rearrangements in ALK and ROS1. Then we diagnosed left lower lobe lymphoepithelioma-like carcinoma invading the pericardium and descending aorta, with metastasis of mediastinal lymph nodes and liver (cT4N2M1b, stage IVA). The first treatment regimen was paclitaxel (190 mg) plus carboplatin (550 mg). After two cycles, we evaluated the curative effect according to enhanced CT of the chest and whole abdomen, and we found the size of tumor became larger (Figures 3A1 and A2) and the lesions of liver became more broader than before (Figures 3B1-B4, evaluation result was SD (according to RECIST 1.1)). We evaluated again after four cycles of chemotherapy, and found the CT imaging demonstrated significant progression of disease (Figure 4, evaluation result was PD). After consulting with the patient and considering the high expression of PD-L1, we decided to stop the chemotherapy and began to use nivolumab (Opdivo; Bristol-Myers Squibb, New York, NY). Subsequently, the patient was administered nivolumab 3 mg/kg every 14 days. After two cycles, we evaluated the curative effect again, and to our surprise the size of the mass had reduced significantly (Figures 5A1 and A2, evaluation result was PR), and there was no metastasis in the brain (Figure 5B). After five cycles of nivolumab, the size of the tumor and the lesions of the liver became even smaller (Figure 6, evaluation result was PR). At the same time, we performed the blood tests again and found that the values of CYFRA21-1 and NSE dramatically decreased compared to before, especially the CYFRA21-1 (Figure 7). So far, this patient has finished six cycles of treatment of nivolumab and there have been no obvious side-effects during the treatment process except an occasional mild cough. Meantime, the hormone level of the thyroid and cortisol have remained roughly normal.

lelc, nsclc, pd-l1, nivolumab

The images of enhanced CT of chest and whole abdomen after two cycles of chemotherapy. (A1, A2) A bulky soft tissue mass in the left lower lobe, which was larger than before. (B1-B4) Multiple classes of circular low density shadows in the liver, and the lesions of liver had become broader than before (October 29, 2018).

PMC3619043_01

Female

A 27-year-old woman reported she had been feeling sick for the past 3 weeks. She complained of loss of appetite, loss of weight, and extreme lethargy. There was no fever, no altered bowel habits, and no night sweats. There was minimal cough, with no sputum. She had a strong family history of connective tissue disease; her aunts had SLE and rheumatoid arthritis. She denied taking any medications or supplements. Physical examination revealed generalized lymphadenopathy, hepatosplenomegaly, corneal calcium deposits, and bilateral pleural effusion. Her initial white blood cell count was 12.4x109/L, hemoglobin was 10.8 g/dl, and erythrocyte sedimentation rate (ESR) was 111 mm/h. She had severe hypercalcemia (corrected serum calcium 4.31 umol/L, serum phosphate 1.42 umol/L) with acute kidney injury (AKI) (serum creatinine 367 umol/L). Her chest radiograph showed bilateral pleural effusion, but results of investigations for infection and tuberculosis were negative. Initially, she was investigated for hyperparathyroidism, but intact parathyroid hormone level was low. Her serum calcium responded to intravenous pamidronate 60 mg, and the AKI resolved with hydration. With clinical features of generalized lymphadenopathy and hypercalcemia, a working diagnoses of lymphoma and tuberculosis were considered. Her pleural fluid cytology was negative for malignant cells. CT scan thorax and abdomen revealed multiple enlarged mediastinal, axillary, paraaortic, iliac, and inguinal lymph nodes. Axillary lymph node biopsy was performed and reported as reactive lymphadenitis with no evidence of tuberculosis. Because the patient had a strong family history of connective tissue disease and negative investigations for tuberculosis and lymphoma, she was also screened for connective tissue disease. She had profound hypocomplementemia, with C3 of 0.89 mg/dl and C4 of 0.09 mg/dl, with positive antinuclear antibodies (1: 640 homogenous) and anti-double stranded DNA. Her Coombs' test result was positive, suggesting autoimmune hemolytic anemia secondary to SLE. With these findings, the patient was treated for SLE with intravenous steroid. She responded very well, with improvement of her symptoms, normalization of her serum calcium, and resolution of her bilateral pleural effusion and generalized lymphadenopathy.

atypical presentation, hypercalcemia, systemic lupus erythematosus

PMC6533542_01

Female

We present the case of a 15-year old girl with a history of B-cell acute lymphoblastic leukemia (t(1:19)) in clinical remission for two years. She was under maintenance chemotherapy with dexamethasone, mercaptopurine, and melphalan. In the past year, she was also suffering from pulmonary tuberculosis having completed 9 months of therapy. She presented in our ophthalmology emergency room with acute visual loss of the left eye (LE) and ocular redness for 5 days. Best corrected visual acuity in her RE was 20/20 and absence of light perception in her left eye (LE). Intraocular pressure upon presentation was 12 mmHg in RE and 22 mmHg in LE. In LE biomicroscopy, she presented with a very small hypopyon, small, inferior, keratic precipitates, anterior chamber cells 4+, vitreous cells 3+, and a dense white mass was visible in the vitreous cavity along with organized vitreous hemorrhage (Figure 1 (Fig. 1)). The fundoscopy examination was made difficult by the dense vitritis. It was possible to perceive the presence of a white vitreous mass occupying most of the vitreous cavity and vitreous hemorrhage. Biomicroscopy and fundoscopy were normal in LE. B-scan ultrasound showed a multilobulated vitreous mass occupying practically the entire ocular globe with associated superior choroidal detachment (Figure 2 (Fig. 2)). An orbital and cranial MRI revealed an intraocular mass with gadolinium enhancement and lacrimal gland enlargement (Figure 3 (Fig. 3)). The patient was medicated with an association of Timolol 1% and Dorzolomide 1% bid as well as topical Dexamethasone 1% qid. Two days later, she suffered clinical worsening with severe ocular pain, headache, and nausea. IOP was now 55 mmHg in LE and the biomicroscopy of LE showed a shallow anterior chamber. Acute angle closure was diagnosed, and we added topical Brimonidine 0.1% bid and Acetazolamide 500 mg qid to her therapeutic scheme. A flow cytometry analysis of the aqueous humor and vitreous revealed ALL-B cells sharing the immunophenotype with previously diagnosed leukemic cells (CD34-/CD10+/CD19+/CD20+ weak/CD38+). Microbiologic analysis was negative for bacteria and fungus as well as the PCR study for Mycobacterium tuberculosis. Ocular relapse of B-cell ALL was diagnosed. The patient was re-staged but there were no signs of relapse in the bone marrow, the central nervous system or any other systemic location. Radiotherapy (30Gy) and rescue chemotherapy (INTREALL HR) were started with symptomatic improvement and better IOP control even though the patient was still under topical hypotensive drugs. Final MAVC was absence of light perception and 8 months after presentation, the patient remained without any other signs of systemic relapse.

b-cell acute lymphoblastic leukemia (all-b), acute angle closure, ocular infiltration, relapse

PMC9425888_01

Male

A 33-year-old male student diagnosed with HIV in 2013, with irregular use of ART and prophylaxis, had a CD4 T lymphocyte count of 9 cells/mm and viral load of 137 000 copies of HIV RNA in a milliliter of blood. The patient was hospitalized for investigation of asthenia and dyspnea after low levels of exertion, with 5 days of evolution. These symptoms were accompanied by adynamia, decreased motor force in the left leg, dysphagia, and dysfluency. He also reported weight loss of approximately 8 kg in the 3 months prior to the hospitalization and continuous episodes of forgetfulness. On physical examination, the patient's general condition was regular, though he was pale, febrile (38.9 C), and had normal cardiac and pulmonary auscultation. Liver and spleen were palpable at 2 cm from the right and left costal margins; however, lymph nodes were not palpable. In the perianal region, the patient presented ulcerated lesions with regular edges, regular and well demarcated edges and no phlogistic signs. The neurological examination revealed normal muscle strength in the upper and lower limbs and preserved tactile sensitivity. The initial blood count showed pancytopenia (hemoglobin: 4.7, leukocytes: 1,670/mm3, lymphocytes: 290/mm3, platelets: 32 000 x 103/mm3) with a slight increase in liver function (aspartate aminotransferase: 102 mug/l, alanine aminotransferase: 86 mug/l), normal renal function, triglycerides of 161 mg/dL, lactate dehydrogenase (LDH) of 588 U/L, and ferritin of 585 microg/mL. In view of the clinical and laboratory findings, the initial diagnostic hypothesis was disseminated histoplasmosis. Blood cultures of fungi, mycobacteria, aerobes, and investigation of fungi in leukocyte cream were performed. Meanwhile, amphotericin B deoxycholate was empirically prescribed due to his advanced HIV disease. All results were negative. Other additional procedures were red blood cell transfusions, resumption of ART, and secondary prophylaxis. After a blood transfusion, the patient evolved well in relation to the initial complaints. The etiological investigation of pancytopenia continued, and the myeloculture of fungi and mycobacteria was negative. Abdominal tomography showed moderate hepatosplenomegaly without nodules. Throughout his stay in the hospital, the patient showed partial clinical and laboratory improvement, but 23 days after hospitalization, he developed a febrile episode accompanied by chills and a convulsive crisis. A cranial CT showed no acute findings, and a chest CT showed a budding tree pattern and lesions with bilateral reverse halo signs. Antimicrobial therapy was initiated with piperaziline/tazobactam, which is therapeutic management for suspected pneumocystosis and pulmonary tuberculosis. Corticosteroids were also used, thus completing the vigorous therapy. The patient was transferred to the intensive unit care and evolved to septic shock and respiratory failure, dying approximately 25 days after the onset of the condition. The patient underwent necropsy. Under gross pathology, the lungs weighed 540 g and presented a diffusely hemorrhagic appearance with consolidation spots, which corresponded to extensive areas of intra-alveolar hemorrhages observed under microscopy, foci of bronchopneumonia, bronchiolitis, and acute edema. Microscopically, the lungs presented diffuse alveolar damage in a proliferative phase, with foci of bronchopneumonia, edema, and intra alveolar hemorrhage. Hepatosplenomegaly was observed, with the spleen measuring 15 cm and weighing 350 g, the liver was 25 cm in the largest axis and weighed 1900 g. No macroscopic alterations were observed in the liver. When cutting the spleen, numerous white nodules were noted, and these measured approximately 0.5 cm throughout the splenic surface (Figure 1A). The liver presented extensive areas of pallor that had perivascular permeation distribution in peripheral congestion areas and, under microscopy, areas of necrosis of hepatocytes in zones II and III, associated with macrovacuolar steatosis, were observed. In the peripancreatic region, numerous coalescent lymph nodes could be seen, which were concentrated by cavitation containing purulent material (Figure 1B), and microscopy portrayed extensive areas of necrosis, surrounded by a lymphohistiocytic inflammatory infiltrate with a morphological pattern that was consistent with H. capsulatum (Figure 1C). Using Grocott's method, the staining showed the presence of small, uniformly oval, narrow-based budding yeasts with eccentric acorn-like nuclei compatible with Histoplasma sp., which were also found in the liver and spleen (Figure 1D). In the latter, extensive areas of necrosis were observed, from permeation to congestion and, in the subcapsular area, the presence of red blood cells phagocytized by macrophages (Figure 1E). Others findings were hypercellularity with megakaryocytic hyperplasia in bone marrow, and edema in the brain. Data Use was approved by the Fundacao de Medicina Tropical Dr. Heitor Vieira Dourado Ethics Review Board; CAAE 50819121.2.0000.0005.

hiv, hemophagocytic lymphohistiocytosis, histoplasmosis

PMC5128003_01

Male

A 75-year-old male was admitted to our hospital complaining of persistent fever with general malaise for approximately 1 week. The patient had a productive cough and his medical history showed that he had diabetes mellitus (HbA1C 9.2%), hypertensive cardiovascular disease, and chronic obstructive pulmonary disease. He used oral medication and an inhaled bronchodilator to control his aforementioned diseases. In the admission survey, a complete blood count revealed that the patient had leukocytosis (WBC 21,000 muL). Moreover, a biochemistry survey showed that he had an elevated C-reactive protein level (20.3 mg/dl). A chest X-ray revealed that his left upper lobe was consolidated. The blood culture and sputum culture were performed at the admission under the impression of pneumonia. First, intravenous third-generation cephalosporin (ceftriaxone) combined with macrolide (azithromycin) were used. The patient's clinical symptoms improved slowly, but he developed a high fever. A chest computed tomography (CT) performed 1 week later still showed left upper lung consolidation (Fig. 1). The bacteria laboratory then reported gram-positive bacilli growth in the patient's blood culture, and the acid-fast stain of the bacteria in blood specimen was also revealed to be positive. Nocardia spp. was highly suspected. We performed a bronchoscopy for the lung lesion, and multiple white cheese-like plaque coatings were observed over the left upper lobe bronchial orifice. The transbronchoscopy washing, brushing, and biopsy were performed. The sputum specimen direct smear showed acid-fast stain positive bacilli, and a biopsy specimen showed granulomatous inflammation. According to the blood culture data and bronchoscopy results, a Nocardia spp. pulmonary infection with sepsis was highly suspected. Hence, we changed the antibiotics to intravenous carbapenum (imipenem) and sulfonamide trimethoprim. The patient's clinical condition improved gradually. After 2 weeks, two sets of blood culture at admission finally showed Tsukamurella tyrosinosolvens. Moreover, three transbronchoscopy washing specimen cultures revealed Mycobacterium bovis 1 week later. We started isoniazid, rifabutin, and ethambutol treatment for the lung lesion immediately. The use of imipenem was 3 weeks and the sulfonamide and trimethoprim treatment was maintained for 1 month. Furthermore, the antituberculosis treatment was maintained for 12 months. After medical management, the patient's chest X-ray survey and physical condition markedly improved.

bacteremia, pcr (polymerase chain reaction), pneumonia, rrna (ribosome rna)

The chest CT shows left upper lung consolidation.

PMC9733669_01

Male

An 50-year-old male was admitted to hospital on August 22th, 2021 for cough and expectoration without obvious cause. He had 35 years history of smoking a pack a day, and history of drinking 100ml/day. He had no history of infectious diseases such as dysentery, malaria, viral hepatitis or tuberculosis. His father died of esophageal cancer, denying a family history of the disease. As the timeline of the clinical course in this patient ( Supplementary Figure 1 ), On August 23th, 2021, a positron emission tomography-computed tomography (PET-CT) revealed a large cystic solid lesion (8.6 x 5.9 x 9.9 cm) in the lung field from the right hilum to the right upper lobe, which was considered to be a right thoracic malignant tumor. The lesion invaded mediastinum adjacent superior vena cava and main right pulmonary artery. Additionally, multiple enlarged lymph nodes were observed in both hilum, mediastinum and right supraclavicular fossa, with the largest being 1.5x1.4 cm, with mild to moderate increase in metabolism, which was considered as multiple lymph node inflammation ( Figure 1A ). On August 26th, 2021, an electronic bronchoscopy revealed stenosis of the right upper lobe opening and obstruction of the lumen by necrotic material ( Figure 1B ). An electronic bronchoscopy biopsy of the superior lobe of right lung led to a pathological diagnosis of PSC ( Figure 1C ). The malignancy was consistent with stage III (cT4N0M0) disease. Upon NGS analysis of the biopsy tissue sample, the patient was identified to harbor EGFR mutations (EGFR exon21 p.L861Q, EGFR exon18 p.G719C) ( Supplementary Figure 2 ), TP53 mutation (exon8 p.R273C), BCORL1 amplification, and CCNE1 amplification. In addition, the patient was identified as having microsatellite stable (MSS) and tumor mutation burden (TMB) of 6.15Muts/Mb by NGS. In addition, immunohistochemistry (IHC) for PD-L1 was strong positive (TPS=80%). Considering the patient's PET-CT results showed that the tumor was large and adjacent to the mediastinum and main pulmonary artery, which made it difficult to resect. The patient had no indications for surgery, and chemotherapy plus immunotherapy (albumin paclitaxel 400mg d1+ cisplatin 90mg dl+ tislelizumab 200mg dl) was subsequently started on September 4th and September 30th, 2021. After two cycles of chemotherapy plus immunotherapy, on October 27, 2021, a chest computed tomography (CT) scan showed that the size of the lesion in the lung field from the right hilum to the right upper lobe was 6.6 x 4.6 x 6.0 cm, and the largest enlarged lymph node was 1.5 x 1.3 cm, but the lesion was still close to the mediastinum and the main pulmonary artery, which was difficult to be surgically removed ( Figure 2A ). In addition, the patient's transaminase increased during the treatment period, indicating abnormal liver function, liver protection treatment returned to normal after a period of time. Moreover, it has been reported that immunotherapy may cause abnormal liver function in NSCLC patients, in which transaminases are increased. Considering that immunotherapy may cause liver injury, immunization was discontinued. Immediately after, the patient received chemotherapy plus EGFR-TKI (albumin paclitaxel 400mg d1+ cisplatin 50mg dl+ osimertinib 30mg dl-14) on October 30th, 2021. On December 6, 2021, after one cycle of chemotherapy plus EGFR-TKI, a chest CT scan showed that the size of the lesion in the lung field from the right hilum to the right upper lobe was 6.6 x 4.6 x 6.0 cm, and the largest enlarged lymph node was 1.7 x 0.8 cm ( Figure 2B ). After chemotherapy plus EGFR-TKI treatment, there was a gap between the lesion and the mediastinum, as well as between the lesion and the right pulmonary trunk, indicating that the lesion may be resected by surgery. Since no obvious contraindications were found, the patient underwent thoracoscopic radical resection of right upper lung cancer on December 15th, 2021. Postoperative pathology showed no residual tumor cells in the right upper lung lesion, no residual tumor cells in the resection margins of the trachea and blood vessels, and no tumor metastasis in the lymph nodes, reached pathological complete response (pCR) ( Figure 3 ). On February 27th and May 23th, 2022, about 2.5 months and 5.5 months after surgical resection, chest CT scan showed no evidence of malignant tumor recurrence ( Figures 4A, B ).

egfr, chemotherapy, neoadjuvant, osimertinib, pulmonary sarcomatoid carcinoma

PMC5382511_02

Male

The examinations performed in herd A are summarized in Table 4. The first two episodes of sudden death problems in 3 day old piglets (December 2013 and January 2014) were not thought to be related with EMCV because no signs indicative for EMCV were observed. Instead E. coli was suspected as the causative pathogen. However, in January 2014 no virulence factors for E. coli (F4, F5, F6 or F41 adhesion factors; LT, STa and STb toxins) were found. An intoxication appeared to be unlikely due to the clustering of problems. Dead piglets did not appear to have been crushed by the sow and they were often heavier than the remaining pigs. The microclimate appeared to be good for the piglets. The first examination suggesting EMCV took place in June 2014 and was performed by the herd veterinarian. Upon necropsy of a 5 day old piglet, a very subtle lesion on the heart compatible with EMCV was observed (Fig. 2). Necropsies that followed were also suggestive to an EMCV infection except the one on August 12 probably because no typical piglets were available at that time. The hearts of two necropsied piglets were submitted to a real-time TaqMan PCR assay targeting a 80 bp segment in the 3D polymerase region. No conclusive diagnosis could be made as PCR results turned out negative. Pathognomonic EMCV lesions were not present or appeared to be very subtle. In addition to these examinations, all individual sow reproduction data were analyzed in August 2014 whether parity, number of live born piglets, number of stillborn piglets, and number of mummies were associated with the problems. None of these factors turned out as a potential risk factor. In herd B two main examinations took place, summarized in Table 5. Immediately EMCV was suspected in this case although other diseases such as edema and Glassers disease and streptococcal meningitis could cause sudden death in the nursery. However clinical nervous signs and slower progression of disease would be expected. A real time PCR was performed to demonstrate EMCV but similar as in herd A the result was negative. Because all PCR results were negative, the hypothesis rose that these farms were facing an uncommon variant of EMCV. The samples from farm A and B were submitted to two individual gel-based real time PCR assays targeting either a 903 bp region in the capsid coding region using primer CCR-L and CCR-R or a 268 bp region in the 3D polymerase gene using primers P1 and P2. PCR results turned out to be positive with the gel-based real time PCR. Sequencing of the 3D pol segment did not indicate the presence of mutation in the genetic sequence susceptible to alter the hybridization of the primers or the probe in the real-time PCR assay. It was further demonstrated that amplification with the real-time PCR primers occurred but detection with the Taqman probe failed. As a consequence, the real-time PCR test was adapted with replacement of the Taqman probe by SYBR Green dye (Roche diagnostics, Belgium) in order to improve pathogen detection. Control of EMCV infections is mainly focused on preventing EMCV to enter the pig herd and to prevent transmission within the herd and hence internal and external biosecurity play a major role in controlling this disease. Herd A was advised to pay more attention to cleaning and disinfection, especially the feeding troughs of the sows and the drinking troughs of the piglets. A longer stand-empty period of the compartments had to be practiced. As mentioned before, herd A produced according to a 4-week batch system and farrowing houses were continuously in use, making it rather impossible to implement this measure. Furthermore, the farmer was advised to reduce stress and excitation as much as possible e.g. limiting moving piglets from one sow to another, not performing teeth clipping and washing sows for the time being. The farmer refused to drop all preventive treatments of the piglets because he expected a lot of problems afterwards. Piglets were still being treated against coccidiosis, vaccinated against Mycoplasma hyopneumoniae, tails were docked and ear tags were placed. Feeding practices, light scheme and climate conditions were not altered. Pets such as cats and dogs were not allowed to enter the stables anymore. Because of insufficient quality of the water, water from the public supply was provided to the next group. The farmer of this herd was advised to increase the overall biosecurity level of his herd. Examples of this advice were: providing boots and clothes for visitors, installing disinfection baths, following logical walking lines, color codes for material used per age group, removing cadavers as soon as possible, etc... Interventions inducing stress or excitation were reduced as much as possible. A longer stand-empty period after disinfection and cleaning of the rooms was practiced. Furthermore, a more stringent rodent control was implemented by a professional company. Possible access routes (windows, ventilation gaps in doors) for rodents were closed including the top of feeding troughs in the nursery. Similar as in herd A, pets were denied access to buildings. After implementing all recommendations no EMCV outbreak has occurred until the time of submitting this paper. Only one piglet was suspected of EMCV by the farmer, but no diagnostics were performed. To avoid any risk, the herd was advised to utilize water from the public supply for next groups as well. After 3 months water was switched back to rainwater and ground water without negative consequences. After the two suspicious cases, no more pigs with typical EMCV signs had died. It seemed the situation was normalized on this herd.

case report, emcv, encephalomyocarditis virus, suckling and nursery pigs, sudden death

PMC5382511_04

Unknown

Affected piglets in herd A and B were clustered i.e. some litters or pens were affected whereas others were not, although pigs of adjacent pens could have direct nose-nose contact. This supports earlier findings that horizontal transmission in swine is not very effective. This could also be an indication that transmission of EMCV between pigs is more effective via feces than via nasal secretions. The infection pattern on these herds (i.e. clustering) however, could be explained by multiple introductions because of the many infected pens and the low basic reproduction ratio (R0) between pigs within pens described by Kluivers et al. (2006). The most convenient cause of multiple introductions in this case would be rodents. The low R0 could also explain the die out of EMCV problems in herd A and B after implementing a more stringent rodent control. Since infected pigs are able to excrete the virus, feces may play a role in transmission. Contact with feces on herd A and B is minimal due to fully slatted floors. Manure coming up through the slatted floor would consequently be a potential risk for infection but Maurice et al. (2007) found this event to be protective (OR = 0.11) against EMCV infection. The authors suggested this protective effect was observed because pigs acquired immunity after they had contact with a low dose of EMCV in manure. This seems indeed controversial as feces and consequently manure could also be considered as sources of infection. Alternatively, the flow of manure up through the slatted floor could have resulted in a decrease in rodents (unable to walk on crusts in the manure pit, drowning) and thereby protected against EMCV. On herd A, piglets of 3 days old were already affected which supports the hypothesis of horizontal transmission because they didn't use drinking nipples or feeding troughs yet. Horizontal transmission between pigs remains a concern, therefore it is recommended to separate different age groups, limit movements of animals, apply a good quarantine management and general biosecurity principles. Further research on transmission patterns is warranted. Typical EMCV lesions were not found during the initial stages of the problems and/or were very subtle on herd A. This is uncommon in an EMCV outbreak and results in a more difficult diagnosis. In other cases where lesions are commonly present, diagnosis is rather straightforward. Possibly the disease progressed that quickly so that no macroscopically visible lesions developed. It was thereby important not to exclude EMCV from the differential diagnosis. As a consequence, practitioners should clinically examine as many pigs as possible to avoid missing out lesions on necropsy. White foci of necrosis on the myocardium are pathognomonic. If no typical lesions are observed or in order to establish a conclusive diagnosis, the practitioner should submit piglets or hearts to a diagnostic laboratory in order to demonstrate the virus via identification tests mentioned in the background section. These tests may differ among laboratories. In this case real time PCR was performed. After several real time PCR tests turned out negative due to quality of the test, the technique used by the veterinary and agrochemical research centre, was optimized with success. Supplementation with vit E and Se failed to reduce EMCV problems probably because the vit E and Se levels in standard feed were sufficient. After the change to drinking water from the public supply in herd A no problems occurred in the following batches. It is not known whether both were related, as switching back to ground and rain water three months later, no clinical EMCV problems were observed. Practicing a stand-empty period for a few days in the compartments following cleaning and disinfection could reduce the presence of EMCV in the environment because farrowing unit 1-2 in herd A, which was consistently left depopulated for 5-6 days, did not show problems.

case report, emcv, encephalomyocarditis virus, suckling and nursery pigs, sudden death

PMC10023231_01

Female

A 54-year-old female patient came to the observation in May 2022, complaining of gingival bleeding during brushing: the patient was unaware of her periodontal problems and did not have a regular professional oral hygiene session. The medical history shows a familiarity with periodontal disease attributable to the father; the patient suffers from McArdle's disease, glycogenosis GSD V, due to the lack of the enzyme glycogen-phosphorylase muscle. McArdle is a serious disease, characterized by muscular intolerance to stress, associated with myalgia, cramps, fatigue, and muscle weakness. McArdle sufferers experience pain or fatigue during some repetitive movements such as chewing and washing their teeth. About 33% of sufferers of this disease complain of a permanent weakness of the muscles closest to the trunk, such as the shoulder muscles. The patient also says she needs many small snacks rich in complex carbohydrates. The diagnosis made by the periodontist was Stage 3 generalized periodontitis, Grade B. At the baseline, the patient had 82 pockets with probing pocket depth (PPD) equal or greater than 4 mm: of these 82 pockets, 50 have PPD equal to or greater than 5 mm. The values of the inflammation indices are 48% for full mouth bleeding score (FMBS)and 73% for full mouth plaque score (FMPS). Figures 1, 2, 3, and 4 show periodontal charting, RX, and photos of the patient at baseline. When periodontal disease was intercepted, the patient was instructed and motivated by the "tailored brushing method" (TBM) approach, to promote correct lifestyles, reduce the greater number of periodontal pockets 5 mm, reduce FMBS and FMPS below 15%, and recreate a healthy oral microbiota with revaluation after 3 months. Once the periodontal disease was diagnosed, radiographic and photographic data were collected, and the periodontal clinical record and motivational interview (T0) were compiled. After 7 days, the patient was instructed to have an effective and efficient control of oral biofilm through the personalized and shared TBM approach. It was recommended to replace the manual toothbrush with a sonic electric toothbrush, which helps her with a minimal physical effort to improve her oral hygiene (DiamondClean 9000, Philips, Amsterdam, Netherlands). The use of toothpaste with probiotics was suggested (Peribioma Pro Gengive Piu, Coswell, Fano, Italy), which counteracts the symptoms and causes of periodontitis by promoting the rebalancing of the oral microbiota. The use of a mouthwash with probiotics (Treatment Mousse Peribioma, Coswell, Fano, Italy) was recommended twice a day for 1 minute without rinsing, drinking, and eating for at least the first 30 minutes. For the cleaning of the interdental spaces, it was recommended to use antibacterial rubber brushes. To complete the oral hygiene at home, the importance of the use of chewable gum with probiotics (Peribioma Pro, Coswell, Fano, Italy) was explained. The latter are enriched with BIOMA microRepair (added with three billion specific probiotics), vitamin C, and D3, which help to protect the gums making them stronger and keeping the microbiota in balance even with a diet not properly correct. Table 1 shows the compositions of the domiciliary products used. Using the 4.3x prismatic magnification technology, the etiological factor over gingival tissue inflammation was removed. The clinical method D-BioTECH, which allows to realize a deplaquing and a debridement above and below minimally invasive gingival, was performed. During these maneuvers, a high-volume suction cannula with an integrated mirror was used (Purevac HVE), which ensures a greater reduction of fluids, optimized acoustics, and a decrease of up to 90% of aerosols and splatter compared to a traditional saliva vacuum (T1). After a further 7 days, before continuing with the instrumentation under gingival, the patient's motivation was strengthened. Plaque detectors were used to share biofilm with the patient using photographic images. The instrumentation under gingival in full mouth (FM) regime in 2 days was performed. Ultrasonic inserts of different shapes were used, and some periodontal pockets were also equipped with mini-five curettes (T2). After 21 days, the dental team received the patient for a motivational session and D-biotech (T3). To strengthen the motivation and engraftment of probiotics in the oral cavity, the patient after another 21 days was reviewed, where the clinical approach D-BioTECH was used (T4). Figures 5, 6, and 7 show photos of the patient at first deplaquing.

PMC6343378_01

Male

A 13-year-old male presented with complaints of sudden onset vomiting and palpitations. On examination, pulse was not palpable, and the child had hypotension (systemic blood pressure of 60/40 mmHg). There was no lymphadenopathy. Electrocardiogram showed ventricular tachycardia (VT) [Figure 1]. Cardioversion reverted the rhythm to normal sinus rhythm. Soon after cardioversion, he was asymptomatic and showed no signs of congestive heart failure, and there was no cardiac murmur. There was no history of significant preceding febrile illness, anorexia, or weight loss. There was no family history of cardiovascular diseases and sudden cardiac death. Echocardiography showed left ventricular (LV) ejection fraction of 37%, LV fractional shortening of 20%, LV dilatation with LV end-diastolic dimension of 6.7 cm, and no other structural heart disease. A 24-h Holter monitoring showed ventricular ectopic activity, and the fastest ventricular run consisted of 12 beats with maximum heart rate of 154 and minimum of 82/min. The blood investigations showed hemoglobin: 14.2 g/dl, total leukocyte count: 5100/cubic mm, and creatinine: 0.9 mg/dl, erythrocyte sedimentation rate was high - 37 mm/1st h, and troponin was raised with levels of 149. There was significant mediastinal widening on chest X-ray. Mantoux test was positive with reading of 20 mm after 48 h. Quantiferon gold test for tuberculosis was also positive. Serum angiotensin-converting enzyme levels were mildly raised 89 u/l (normal range: 8-52 u/l). Computerized tomography (CT) chest showed extensive confluent mediastinal and right hilar lymphadenopathy with focal calcification in subcarinal lymph node [Figure 2]. CT coronary angiography showed normal coronaries. Magnetic resonance imaging (MRI) was done which showed mediastinal lymphadenopathy [Figure 3], diffuse LV dilatation, with myocardial edema, subendocardial septal and lateral wall scarring, and punctate mid-wall-enhancing granulomas [Figure 4] consistent with acute myocarditis, with granulomatous cardiomyopathy. Physical examination revealed that there were no palpable cervical, supraclavicular, axillary, or inguinal lymph nodes available for excision or biopsy. Bronchoscopic lymph node biopsy was suggestive of a chronic granulomatous lesion. Bronchoalveolar lavage was negative for acid-fast bacilli. A standard antitubercular regimen was commenced, comprising rifampicin (120 mg), isoniazid (50 mg), pyrazinamide (300 mg), ethambutol (1 g), and pyridoxine (10 mg; all taken once daily) with steroids and amiodarone, which was gradually tapered with completion of antiarrhythmic therapy. On follow after 12 months, the child continued to be asymptomatic with no fresh episode of palpitations. Repeat Holter study done showed normal sinus rhythm with heart rates around 80/min, but the child has no significant improvement in LV function. The child had sudden cardiac arrest 16 months after therapy while at home.

tubercular myocarditis, magnetic resonance imaging, ventricular arrhythmia

PMC8521190_01

Unknown

The patients are described in Tables 1 , 2 . The median age of the 14 patients was 70 years old at MDS/CMML diagnosis (ranging 62-81) and was 69 years old at the time of cutaneous manifestations (ranging 30-82). The MDS subtypes were MDS with multilineage dysplasia (n=3, including one with myelofibrosis), MDS with excess blasts (n=1), MDS with unilineage dysplasia (n=1), MDS/myeloproliferative neoplasm (MPN) (n=2), and CMML (n=7). Karyotype was normal in eight patients, abnormalities were found in five patients [del(20)(q11q13) in patient 5; iso(X)(p10) and t(3,12)(p2?2;q24) in patient 6; trisomy 18 in patient 11; trisomy 8, del(1)(p?3?4), and del(5) (q?3?1q35) in patient 13; and del(4)(q?23q?26) in patient 14], and the karyotype could not be performed for one patient (patient 7). The MDS were low or intermediate-1 risk in 93% cases with median IPSS at 0.5 (0-2) and very-low, low, or intermediate risk in 93% cases with median IPSS-R at 2.3 (0.6-5.1). Skin lesions preceded the MDS/CMML diagnosis in 5 (36%) patients. In 7 (50%) cases, extracutaneous symptoms were associated; fever (n=5; 36%) and arthralgia and/or arthritis (n=6; 43%) were the most prevalent. Based on clinical, histological, and immunohistochemical findings and before NGS results, skin lesions have been classified as H-SS in four cases (patients 2, 7, 9, and 12), CMML cutis in three cases (patients 4, 6, and 11), and ECD associated with CMML cutis in two cases (patients 1 and 3), Kikuchi-Fujimoto disease in one case (patient 5), neutrophilic folliculitis in one case (patient 10), erythema nodosum in one case (patient 13), pyoderma gangrenosum in one case (patient 14), and extensive livedo reticularis with non-specific findings on skin biopsy in one case (patient 8) ( Tables 1 , 2 ). Clinical and histological lesions are shown for patients 6, 7, and 14 ( Figure 1 ). Patients all had concomitant blood/marrow and skin sampling apart from patient 2 (skin biopsy performed 1 year before blood analysis with NGS) and patient 13 (skin biopsy performed 2 years before bone marrow analysis with NGS). At least one mutation was identified using NGS in blood/bone marrow in all patients with a median number of two mutations (ranging 1-8) and in skin biopsies in 12 patients with a median number of 3.5 mutations (ranging 1-7). Patient 5 was considered negative on skin owing to a very low skin VAF (<1%). Patient 8 was considered as a blood contamination as the weakly positive skin NGS (3% VAF) was not associated with a cutaneous myeloid infiltrate. Median VAF in skin was 12% (ranging from 1 to 76%) ( Table 1 ). The same main mutation between blood/bone marrow and skin was found in eight patients (67% of patients with mutations in the skin). Six patients had paired mutations in blood/marrow and skin lesions (patients 1, 2, 3, 4, 11, 12 with respectively ECD/CMML cutis, H-SS, ECCD/CMML cutis, CMML cutis, CMML cutis, and H-SS). For the six other patients, three had more mutations on blood/marrow than skin (patients 6, 10, and 14, with respectively CMML cutis, neutrophilic folliculitis, and pyoderma gangrenosum), and three had more mutations on skin than blood/marrow (patients 7, 9, and 13, with respectively H-SS, H-SS, and erythema nodosum). Patient 7 had one extra-mutation in skin (in TP53, VAF 2%), patient 9 had two extra-mutations in skin (in SETBP1, VAF 4%, and in KMT2D/MLL2, VAF 3%), and patient 13 had two extra-mutations in skin (in KRAS, VAF 11%, and in RUNX1, VAF 6%) and one extra-mutation in blood (in ZRSR2, VAF 7%) with a bone marrow analysis performed 2 years after skin sampling ( Tables 2 , 3 ). Regarding VAF, 10 patients had at least one mutation in skin with VAF >10% (patients 1, 3, 4, 6, 7, 9, 10, 11, 13, 14, with respectively ECD/CMML cutis, ECD/CMML cutis, CMML cutis, CMML cutis, H-SS, H-SS, neutrophilic folliculitis, CMML cutis, erythema nodosum, and pyoderma gangrenosum), of whom six had at least one mutation with VAF >20% (patients 4, 7, 10, 11, 13, 14, with respectively CMML cutis, H-SS, neutrophilic folliculitis, CMML cutis, erythema nodosum, and pyoderma gangrenosum), and two patients had detectable mutation with VAF <10% (patients 2 and 12 with 40 and 20% myeloid cells in the infiltrate, respectively, both diagnosed with H-SS). The myeloid infiltrate was of only 5% in three patients, but all of them had VAF >10% (patients 4, 7, and 9) ( Tables 2 , 3 ). The most frequent mutations were in DNMT3A and TET2 both found in four patients. Two patients harbored the recently identified mutations in UBA1 (2 and 12), both having H-SS associated with a febrile polyarthritis. Eleven patients have been treated and received oral steroids (n=8), hydroxychloroquine (n=2), immunosuppressive therapies (dapsone n=1), biological-targeted therapy (anakinra n=2, low-dose interleukin-2 n=1), or azacytidine as the hematological therapy (n=7). Azacytidine was associated with complete skin disease remission in three patients (two H-SS and one CMML cutis), partial in two (H-SS and pyoderma gangrenosum), and did not improve skin lesions in two (xanthelasma and folliculitis) ( Table 4 ). Two out of the 14 patients were dead by the end of data collection. One of them died of central nervous system infection (patient 11), and the other one of acute myeloid leukemia (patient 13). It is known that leukemia cutis is characterized by a skin infiltrate of blastic cells directly related to the myeloid leukemia. Therefore, NGS mutational profile of blood and skin lesions should be similar, and these patients could be used as "positive controls." We aimed to compare the results of our MDS/CMML patients with patients having leukemia cutis focusing on the "VAF/percentage of myeloid cells in the skin infiltrate" ratio. Four patients referred for cutaneous lesions compatible with leukemia cutis had NGS on skin samples. Two had AML and two had CMML evolving to AML. Skin symptoms were prominent with nodular lesions diagnosed in three patients and erythroderma in one. Leukemia cutis NGS found a median number of mutations of 4 (versus 4,5 in blood or marrow for the same patients). The median VAF was of 22% (ranging from 2 to 71%) in leukemia cutis (with a median percentage of myeloid cells in the infiltrate of >50%) compared with 12% (ranging from 1 to 76%) in the skin samples analyzed in our study (with a median percentage of myeloid cells in the infiltrate of 20%). The "VAF/percentage of myeloid cells in the skin infiltrate" ratio was similar between leukemia cutis and our skin samples (p=0.265 using Mann-Whitney test), supporting that mutations detected in skin biopsies of our MDS/CMML patients were related to a significant clonal myeloid infiltrate.

chronic myelomonocytic leukemia, clonal hematopoiesis, myelodysplastic syndrome, next-generation sequencing, skin

PMC9520138_01

Male

A 74-year-old male was diagnosed with an advanced iCC of both liver lobes and pulmonary metastases (Figures 5 and 6). First-line chemotherapy with gemcitabine 800 mg/m2, cisplatin 25 mg/m2, and nab-paclitaxel 100 mg/m2 days 1 and 8 qd22 was initiated. After the fifth treatment cycle, progressive disease was observed. Biopsies of the liver lesions as well as a liquid biopsy were taken and a hybrid capture-based next-generation sequencing (NGS; FoundationOne CDx, Penzberg, Germany) was performed for the tissue biopsies and FoundationOne Liquide CDx for the blood samples. The test is based on the examination of 324 genes as well as introns of 34 genes known to be involved in rearrangements. In addition, tumor mutation burden and microsatellite instability were evaluated. Sequencing revealed a p.C382R mutation located in the transmembrane receptor domain. The p.C382R was detected in both specimens with a variant allele frequency of 76.48% in the tissue biopsy and 8.1% in the blood sample. Regarding downstream signaling pathways, we detected a PTEN alteration (loss of exons 7-9 in tissue samples and loss of exons 3-8 in the liquid biopsy). The sequencing results are shown in Table 1. The results of the histologic examination are shown in Figure 4. Furthermore, we performed an in silico study to understand the potential mode of p.C382R action. To modulate and visualize the protein structure results from p.C382R, we used AlphaFold2 (https://alphafold.ebi.ac.uk/entry/P21802). The evaluation revealed that the p.C382R mutation is located in the transmembrane domain at a position that is crucial for the oncogenic tyrosine kinase activation but does not interfere with the binding ability and inhibition of autophosphorylation of FGFR by pemigatinib. Following the promising in vitro data for pemigatinib-targeted treatment and the reported results of three patients carrying FGFR2 p.C382R mutations who were treated with pemigatinib in the FIGHT 202 trial, we decided to initiate therapy after a discussion of the clinical case in the molecular tumor board (MTB). Pemigatinib of 13.5 mg was administered once daily for 14 days, followed by 7 days of therapy-free interval. The treatment outcome was evaluated by magnetic resonance imaging (MRI) and fluorodeoxyglucose-positron emission tomography/computed tomography (FDG-PET/CT) before pemigatinib administration and after 3 months (Figures 5 and 6). In the pre- and post-MRI image data, an interactive tumor delineation method previously applied to liver CT data was used to determine the change in tumor size. The images show a significant decrease in the tumor lesion volume from 453.9 to 133.7 ml after 3 months of treatment (Figure 5). The FDG-PET/CT revealed a complete functional remission of the iCC and lung metastases after 3 months of treatment (Figure 6). The therapy is well tolerated without any side effects. The patient continues to be treated with 13.5 mg as described above. Over the course of the treatment, tumor markers that were elevated at baseline measurement decreased to a plateau (Figure 7).

fgfr2, cholangiocarcinoma, mixed-all-nominated-in-one method, next-generation sequencing, targeted therapy, tyrosine kinase inhibitor

PMC4674577_01

Female

A 26-year-old multiparous woman from Ghana, with a history of positive PPD (purified protein derivative) test and gestational diabetes, presented to labor and delivery at 38-week gestation with complaints of suprapubic pain, pressure, and possible leakage of amniotic fluid. The patient's suprapubic pain had occurred for a week and was associated with vomiting. The patient also complained of a productive cough for the past 3 to 4 months with a decrease in vision occurring at the start of pregnancy. She reported good fetal movement and denied vaginal bleeding. She also denied the use of alcohol, tobacco, and illicit drugs. The patient had a history of positive PPD with a normal chest X-ray in 2009. Treatment never occurred as the patient was lost to follow-up. Physical examination revealed a frequent productive cough with urinary incontinence. The patient had a visual acuity worse than 20/200 in each eye and was referred to ophthalmology. Ophthalmology diagnosed her with optic atrophy OS (left eye) and papillitis, choroiditis, and uveitis OD (right eye). She was prescribed ophthalmic prednisolone and cyclopentolate for the uveitis and timolol for secondary glaucoma due to the uveitis. However, the patient refused all eye medications stating that headaches and eye pain occurred with use. The patient was also evaluated by pulmonology for chronic cough. Initial imaging was delayed due to patient refusal. The mother believed that imaging would be harmful to the fetus and would not consent to the procedure. Day one after admission the patient delivered a healthy infant of 2960 grams at 38 weeks via vacuum assisted vaginal delivery. APGAR score was 9/9 with no perinatal complications. After the patient delivered, a chest X-ray (CXR) showed right nodular opacity in the apex of the lung field measuring 1.6 x 1.0 cm (Figure 1(a)). Mycobacterium tuberculosis was confirmed by positive AFB smear and culture leading to the diagnosis of active TB. The baby was isolated from the mother and fed with formula due to increased likelihood of TB transmission. Physical examination performed on the newborn revealed no anatomic, visual, or neurologic deficits. As a safety precaution, the infant was initiated on isoniazid oral suspension of 0.1 mg and pyridoxine oral suspension of 29 mg daily (10 mg/kg/day). Immediately following maternal diagnosis of active TB, the patient was isolated and started on an antituberculosis regimen comprising of isoniazid and pyridoxine 300 mg once daily, rifampin 300 mg twice daily, pyrazinamide 500 mg three times daily, and ethambutol 1,200 mg daily to be completed on a 6-month course. However, ethambutol was discontinued due to the patient's history of left optic nerve atrophy, which may progress due to ethambutol toxicity. Prior to being discharged, a CXR was done on April 7, 2015, which revealed increased density in the right upper lobe that appeared to be more prominent compared to the previous imaging (Figure 1(b)). On April 13, 2015, the patient was cleared for discharge after the documentation of three consecutive partially negative AFB smears and culture. She was released to the care of a public health advisor at the Department of Health who will provide follow-up care.